| Literature DB >> 24067943 |
K M Antoniou1, K D Samara, I Lasithiotaki, G A Margaritopoulos, G Soufla, I Lambiri, I Giannarakis, I Drositis, D A Spandidos, N M Siafakas.
Abstract
Telomerase is a reverse transcriptase ribonucleo-protein (h-TERT) that synthesizes telomeric repeats using its RNA component (h-TERC) as a template. Telomerase dysfunction has been associated with both fibrogenesis and carcinogenesis. In this study, we aimed to evaluate the telomerase mRNA expression levels of both subunits (h-TERT and h-TERC) in lung tissue and bronchoalveolar lavage fluid (BALF) from patients with idiopathic pulmonary fibrosis (IPF) and non-small cell lung cancer (NSCLC), since there are indications of common pathogenetic pathways in these diseases. We prospectively examined lung tissue samples from 29 patients with IPF, 10 patients with NSCLC and 21 controls. Furthermore, we examined BALF samples from 31 patients with NSCLC, 23 patients with IPF and 12 control subjects. The mRNA expression for both h-TERT and h-TERC was measured by real-time RT-PCR. In the lung tissue samples, both h-TERT and h-TERC mRNA expression levels varied among the 3 groups (p=0.036 and p=0.002, respectively). h-TERT mRNA levels in the patients with IPF were lower compared with those in the controls (p=0.009) and patients with NSCLC (p=0.004). h-TERC mRNA levels in the patients with IPF were lower compared with those in the controls (p=0.0005) and patients with NSCLC (p=0.0004). In the BALF samples, h-TERT mRNA expression levels varied among the groups (p=0.012). More specifically, h-TERT mRNA levels in the patients with IPF were higher compared with those in the controls (p=0.03) and patients with NSCLC (p=0.007). The attenuation of telomerase gene expression in IPF in comparison to lung cancer suggests a differential role of this regulatory gene in fibrogenesis and carcinogenesis. Further functional studies are required in order to further elucidate the role of telomerase in these devastating diseases.Entities:
Mesh:
Substances:
Year: 2013 PMID: 24067943 PMCID: PMC3839993 DOI: 10.3892/or.2013.2753
Source DB: PubMed Journal: Oncol Rep ISSN: 1021-335X Impact factor: 3.906
Clinical characteristics and pulmonary function tests of all patients studied.
| A, Lung tissue samples | ||||
|---|---|---|---|---|
|
| ||||
| Characteristics | Controls | IPF | NSCLC | p-value |
| No. | 21 | 29 | 10 | |
| Age | 63.41±4.12 | 67.8±3.93 | 59.38±6.81 | p1, p2, p3=NS |
| Gender (M/F) | 17/4 | 21/8 | 9/1 | |
| Non-smoker | 9 | 13 | 0 | |
| Smokers | 6 | 5 | 8 | |
| Ex-smokers | 6 | 11 | 2 | |
| FEV1 | 85.31±8.49 | 75.64±4.23 | 83.78±5.74 | p1, p2, p3=NS |
| FVC | 93.22±7.50 | 74.85±3.30 | 92.19±8.25 | p1<0.05, p2, p3=NS |
| FEV1/FVC | 73.33±4.29 | 82.14±1.85 | 71.89±4.91 | p1, p3<0.05, p2=NS |
| DLCO | 74.43±11.37 | 50.73±4.30 | - | p1<0.05 |
|
| ||||
| B, BALF samples | ||||
|
| ||||
| Characteristics | Controls | IPF | NSCLC | p-value |
|
| ||||
| No. | 12 | 23 | 31 | |
| Age | 61.75±3.51 | 69.17±1.23 | 66.62±1.74 | p1, p2, p3=NS |
| Gender (M/F) | 10/2 | 18/5 | 27/4 | |
| Non-smoker | 5 | 9 | 2 | |
| Smokers | 4 | 3 | 18 | |
| Ex-smokers | 3 | 11 | 11 | |
| FEV1 | 86.78±8.71 | 77.88±3.45 | 82.34±4.71 | p1, p2, p3=NS |
| FVC | 91.88±6.90 | 71.68±4.52 | 91.13±8.92 | p1, p3<0.05, p2=NS |
| FEV1/FVC | 75.41±5.19 | 85.31±1.79 | 72.14±5.23 | p1, p3<0.05, p2=NS |
| DLCO | 72.28±9.71 | 52.69±4.13 | - | p1<0.05 |
Values are expressed as the means ± SEM (standard error of the mean).
t-test; p<0.05 was considered to indicate a statistically significant difference.
NS, not significant. p1, IPF vs. controls; p2, NSCLC vs. controls; p3, IPF vs. NSCLC. NSCLC, non-small cell lung cancer; IFP, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid; M, male; F, female; FEV1, forced expiratory volume in 1 sec; FVC, forced vital capacity; DLCO, diffusing capacity for carbon monoxide.
Primer sequences used for real-time RT-PCR.
| Gene | Primer pair sequence (5′→3′) | Annealing temperature (°C) |
|---|---|---|
| TGF-β | Forward AAGGACCTCGGCTGGAAGTGC | 62 |
| h-TERT | Forward TGACACCTCACCTCACCCAC | 51 |
| h-TERC | Forward GCCTGCCGCCTTCCACCGTTCATT | 59 |
| β-globin | Forward GCTTCTGACACAACTGTGTTCACTAGC | 58 |
Percentage of subjects expressing h-TERT and h-TERC mRNA in lung tissue and BALF samples.
| A, Lung tissue samples | ||||
|---|---|---|---|---|
|
| ||||
| Control (n=21) | IPF (n=29) | NSCLC (n=10) | p-value | |
| h-TERT | 52.4% | 13.8% | 60% | p1=0.003 |
| h-TERC | 61.9% | 17.3% | 90% | p1=0.001 |
|
| ||||
| B, BALF samples | ||||
|
| ||||
| Control (n=12) | IPF (n=23) | NSCLC (n=31) | p-value | |
|
| ||||
| h-TERT | 33% | 65.2% | 25.8% | p1=0.07 |
| h-TERC | 50% | 73.9% | 59.1% | p1, p2, p3=NS |
χ2 test, p<0.05 was considered to indicate a statistically significant difference.
NS, not significant p1, IPF vs. controls; p2, NSCLC vs. controls; p3, IPF vs. NSCLC. NSCLC, non-small cell lung cancer; IFP, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid.
h-TERT and h-TERC relative mRNA expression levels in lung tissue and BALF samples from patients with IPF and NSCLC and the control subjects.
| A, Lung tissue samples | ||||
|---|---|---|---|---|
|
| ||||
| Control (n=21) | IPF (n=29) | NSCLC (n=10) | p-value | |
| h-TERT | 0.01 [0–0.35] | 0.00 [0–0] | 0.695 [0–2.34] | 0.036 |
| h-TERC | 1.12 [0–2.66] | 0.00 [0–0] | 0.97 [0.68–2.88] | 0.002 |
| TGF-β | 0.7390 [0.1280–3.220] | 194 [0.0015–3070] | 0.00 [0.00–0.03] | <0.0001 |
|
| ||||
| B, BALF samples | ||||
|
| ||||
| Control (n=12) | IPF (n=23) | NSCLC (n=31) | p-value | |
|
| ||||
| h-TERT | 0.00 [0–0.02] | 0.09 [0–0.23] | 0.00 [0–0.01] | 0.012 |
| h-TERC | 0.005 [0–0.385] | 0.44 [0–1.21] | 0.06 [0–0.73] | 0.07 |
| TGF-β | 100.3 [1.51–533.6] | 199.2 [1.873–11200000] | 0.0020 [0–2.7933] | <0.0001 |
Data are presented as the median (lower-upper quartiles) and a value of p<0.05 was considered to indicate a statistically significant difference, Kruskal-Wallis test. NSCLC, non-small cell lung cancer; IFP, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid.
Figure 1(A) h-TERT and (B) h-TERC relative mRNA expression in the lung tissue samples from the control subjects (parenchyma) and patients with IPF and NSCLC (tumor samples). *p<0.05 vs. IPF. NSCLC, non-small cell lung cancer; IFP, idiopathic pulmonary fibrosis.
Correlation of h-TERT and h-TERC relative mRNA expression with TGF-β relative mRNA expression in patients with IPF and NSCLC.
| Group | ||
|---|---|---|
|
| ||
| Telomerase gene per biological sample | IPF | NSCLC |
| TGF-β relative mRNA expression in BALF correlated with h-TERT | r2=0.015, r=0.3012, p=NS | r2=0.006, r=0.055, p=NS |
| TGF-β relative mRNA expression in BALF correlated with h-TERC | r2=0.022, r=0.070, p=NS | r2=0.016, r=0.126, p=NS |
| TGF-β relative mRNA expression in lung tissue correlated with h-TERT | r2=0.106, r=−0.074, p=NS | r2=0.006, r=0.077, p=NS |
| TGF-β relative mRNA expression in lung tissue correlated with h-TERC | r2=0.089, r=−0.065, p=NS | r2=0.343, r=0.585, p=0.028 |
NSCLC, non-small cell lung cancer; IFP, idiopathic pulmonary fibrosis. BALF, bronchoalveolar lavage fluid.
Figure 2(A) h-TERT and (B) h-TERC relative mRNA expression in the BALF samples from the control subjects and patients with IPF and NSCLC. *p<0.05 vs. IPF. NSCLC, non-small cell lung cancer; IFP, idiopathic pulmonary fibrosis; BALF, bronchoalveolar lavage fluid.
Figure 3Correlation of h-TERC relative mRNA expression with TGF-β relative mRNA expression in lung tissue samples from patinets with NSCLC (tumor samples) (r2=0.343, p=0.028). NSCLC, non-small cell lung cancer.