Literature DB >> 24040267

Export of extracellular polysaccharides modulates adherence of the Cyanobacterium synechocystis.

Michael L Fisher1, Rebecca Allen, Yingqin Luo, Roy Curtiss.   

Abstract

The field of cyanobacterial biofuel production is advancing rapidly, yet we know little of the basic biology of these organisms outside of their photosynthetic pathways. We aimed to gain a greater understanding of how the cyanobacterium Synechocystis PCC 6803 (Synechocystis, hereafter) modulates its cell surface. Such understanding will allow for the creation of mutants that autoflocculate in a regulated way, thus avoiding energy intensive centrifugation in the creation of biofuels. We constructed mutant strains lacking genes predicted to function in carbohydrate transport or synthesis. Strains with gene deletions of slr0977 (predicted to encode a permease component of an ABC transporter), slr0982 (predicted to encode an ATP binding component of an ABC transporter) and slr1610 (predicted to encode a methyltransferase) demonstrated flocculent phenotypes and increased adherence to glass. Upon bioinformatic inspection, the gene products of slr0977, slr0982, and slr1610 appear to function in O-antigen (OAg) transport and synthesis. However, the analysis provided here demonstrated no differences between OAg purified from wild-type and mutants. However, exopolysaccharides (EPS) purified from mutants were altered in composition when compared to wild-type. Our data suggest that there are multiple means to modulate the cell surface of Synechocystis by disrupting different combinations of ABC transporters and/or glycosyl transferases. Further understanding of these mechanisms may allow for the development of industrially and ecologically useful strains of cyanobacteria. Additionally, these data imply that many cyanobacterial gene products may possess as-yet undiscovered functions, and are meritorious of further study.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 24040267      PMCID: PMC3769361          DOI: 10.1371/journal.pone.0074514

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The need for alternative and sustainable fuels has become widely accepted, and biofuel production in microalgae and cyanobacteria has been developed to that end. In our laboratory we have engineered the cyanobacteria, Synechocystis to produce high levels of fatty acid and to automatically process their own biomass in an inducible manner [1]–[4]. Unlike traditional sources of biofuels, the use of photosynthetic microorganisms does not require the use of cultivatable land or potable water. However, the large culture volumes required to produce biofuels at commercial scale are considerable. Traditional sources of biomass dewatering rely on potentially toxic flocculants, filtration or centrifugation, making biomass dewatering an energy intensive process [5]. In an attempt to diminish the energy requirements for biomass dewatering, cyanobacteria have been constructed with modulated adherence properties with potential for use in biomass harvest and bioremediation [6]–[8]. Both extracellular polysaccharides (EPS) and O-antigen (OAg) are carbohydrate moieties on the cell surface that mediate bacterial protection and provide a mechanism for bacterial cells to interact with their environments [9]–[11]. Between species, OAg is a highly variable, surface-exposed component of lipopolysaccharide in the outer membrane of Gram-negative bacteria. This key structure modulates susceptibility to phage [12], [13], surface charge [14] and permeability of the outer membrane [14]. Similarly, EPS is a large, polymeric carbohydrate structure that serves to protect cells from environmental stress such as UV irradiation [15], heavy-metal toxicity [8], [16], [17], osmotic stress [8], [18] and desiccation [19]. In this study, we completed a whole genome comparison of in silico translated genes from Synechocystis, E. coli K-12 and S. Typhimurium LT2. We searched for genes in Synechocystis that showed homology to genes involved in modulating the cell surface moieties in other species. Two of the genes we identified were slr0977 and slr0982. These genes encode products that are homologous to the Wzm and Wzt proteins in E. coli. Together, these gene products comprise the permease and oligosaccharide binding proteins that function together as a ABC-transporter [20], [21]. We noted that slr0977 and slr0982 were located in a cluster of contiguous genes that were annotated as OAg transport genes in the Cyanobase genome database [22], [23]. Subsequent mutation of these genes resulted in flocculating strains with modulated adherence properties. Surprisingly, neither the OAg structure nor its composition was altered in these mutants. Rather, we provide evidence that the phenotypes exhibited by these mutants are due to altered extracellular polysaccharide. Together with previously published studies, these data indicate multiple mechanisms for autoflocculation through disruption of EPS biosynthesis and/or export. This understanding is important for the construction of autoflocculating mutant strains.

Materials and Methods

Bioinformatics Searches and Analyses

The complete genomes for E. coli K-12 (NC_000913.2), S. Typhimurium LT2 (NP_459707.1), and Synechocystis 6803 (BA000022.2) were downloaded from NCBI GenBank and gene information was extracted using Perl scripts. The COG database [24] was also used in categorizing genes. All of the features were stored in a MySQL database. For gene identification, we used BLASTP implemented in NCBI blast-2.2.18 to identify possible homologous genes of E. coli or Salmonella in the Synechocystis genome with a threshold e-value less than 1.0–4. Three methods were used to define genes of synthesis and assembly of cell wall components: (1) Based on a set of genes in E. coli K-12 and S. Typhimurium LT2, the homologous genes in Synechocystis using were determined. (2) a set of genes based on the functional descriptions of the COG database were determined, and then the homologs in Synechocystis were identified using BLASTP (3) We searched for genes directly based on the functional annotation of Synechocystis. Thus, 519 gene products potentially involved in the synthesis and assembly of the Synechocystis cell wall and cell-surface macromolecular components were identified.

Bacterial Growth Conditions

Cultures were inoculated to a starting OD730 of 0.1 in BG-11 medium [25] from starter cultures. Cultures were incubated at 30°C with 40 µmol photons m−1 s−1. Kanamycin was added at a concentration of 50 µg/mL when appropriate. To assess the effect of NaCl on EPS mutants, Synechocystis cultures were inoculated in triplicate to an OD730 2 mL of BG-11 or BG-11+0.8M NaCl in test tubes. Every 24 h cultures were gently agitated with a vortex until adherent cells were fully in suspension. The OD730 was then measured and recorded.

Vector Construction

DNA manipulation was carried out using standard procedures [26]. Suicide vectors were constructed in a two-step process. For each gene deletion, PCR primers (Table 1) were used to amplify ∼400bp of genomic DNA from the flanking region of of each gene. Flanking regions were stitched together by a modified overlap extension PCR as previously described [27]. Briefly, BamHI and NdeI restriction sites were generated between the two flanking sequences. Thus, we created the plasmids pψ508 (slr0977 flanking regions), pψ512 (slr1610 flanking regions), ψ514 (sll0574-5 flanking regions) and pψ560 (slr0982 flanking regions). The KanR-SacB cassette from pPsbA2ks [28] was purified following digestion with BamHI and NdeI and ligated into pψ508, pψ512, ψ514 and pψ560 to generate pψ509 (Δslr0977) pψ513 (Δslr1610), pψ515 (Δ(slr0977;Δsll0574-5)) and pψ561 (Δslr0982) respectively. In the case of pψ560, an NdeI site native to the 3′ flanking region was removed by introducing a silent mutation using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacture’s protocol, using primers MLF-68 and MLF-69.
Table 1

Primers used in this study.

Primer NamePrimer sequenceDescriptionPlasmids constructed
MLF-1tttatgccactaggttcc5′ primer for upstream region of slr0977 pψ508 and pψ618
MLF-2ggatcctttaaaccccatatgcatacttgaggtcaatttttg3′ primer for upstream region of slr0977
MLF-3catatggggtttaaaggatcctaaccatggcaacaaac5′ primer for downstream region of slr0977
MLF-4ccttcctcaactcttcgttg3′ primer for downstream region of slr0977
MLF-9ctactatgggaagatttttg5′ primer for upstream region of slr1610 pψ511 and pψ620
MLF-10ggatcctttaaaccccatatgcactcaatccctaggcgag3′ primer for upstream region of slr1610
MLF-11catatggggtttaaaggatcctgttagaatgttgagcagg5′ primer for downstream region of slr1610
MLF-12tcaagaatttgacccag3′ primer for downstream region of slr1610
MLF-13agtcaactcggaattgt5′ primer for upstream region of slr0982 pψ560 and pψ619
MLF-14ggatcctttaaaccccatatgcgaatgactgtatcagacat3′ primer for upstream region of slr0982
MLF-15catatggggtttaaaggatccattgcatgaaagctgtaattc5′ primer for downstream region of slr0982
MLF-16attagaccgccatcaccg3′ primer for downstream region of slr0982
MFL-68caattattttctacacatgtccgatgtaacc5′ NdeI SDM removal in flanking region 2 of theslr0982 construct
MFL-69tgttacatcggacatgtgtagaaaataattg3′ NdeI SDM removal in flanking region 2 of theslr0982 construct
MLF-17ggtttgaacagaatcaag5′ primer for upstream region of sll0574-5 pψ513
MLF-18ggatcctttaaaccccatatgcggtagcgaaagagccat3′ primer for upstream region of sll0574-5
MLF-19catatggggtttaaaggatccccccaataattctggcaag5′ primer for downstream region of sll0574-5
MLF-20ccaccttagttactccatag3′ primer for downstream region of sll0574-5
To rule out second-site mutations that might have accumulated during the construction of mutant strains, we constructed vectors for genomic complementation. Complementation was carried out by replacing the KanR-SacB in each mutant with the wild-type allele. Complementation vectors pψ618, pψ619 and pψ620 were constructed to complement the mutations Δslr0977, Δslr0982, Δslr1610 in SD506, SD553 and SD507, respectively. To construct these vectors, DNA from SD100 was amplified with primer pairs MLF-1/MLF-4, MLF-5/MLF-8 and MLF-9/MLF-12. The PCR products were ligated into pJET1.2 to generate pψ618, pψ619 and pψ620, respectively. SD553 was transformed with pψ619 to generate SD563. SD507 was transformed with pψ620 to generate SD564. Several attempts were made to complement the Δslr0977 strain by transformation of SD506 with pψ618. However, no transformants were recovered.

Transformation and Complementation

Mutants of Synechocystis were generated as previously described [1]. Briefly, 4 µg of suicide vector was added to 100 µL of a late log phase culture of and incubated overnight in BG-11 without antibiotic. The entire transformation mixture was then spread onto a Nuclepore Track-etch membrane (Whatman #111707) on a BG-11 plate. These were then incubated for three days at 30°C with 40 µmol photons m−1 s−1. Following this incubation, membranes were transferred to a BG-11 plate containing 100 µg/mL kanamycin and incubated until single colonies appeared. To ensure complete segregation of the mutants, colonies were patched onto BG-11+6% sucrose and BG-11+100 µg/mL kanamycin. Kanamycin resistant colonies that were sucrose sensitive were further verified by PCR to ensure complete segregation. To complement mutants in SD553 and SD507, 100 µL late log cultures of each strain were transformed with 4 µg of either pΨ619 or pΨ620, respectively to generate SD563 and SD564. Following an overnight incubation at 30°C with 40 µmol photons m−1 s−1, transformation mixtures were resuspended in 1mL of BG-11 and allowed to recover for three days. Following the recover step, 100 µL of culture was then plated on BG-11+6% sucrose and incubated until single colonies arose. Isolated colonies were then patched onto BG-11+6% sucrose and BG-11+100 µg/mL kanamycin. Colonies that were sucrose resistant and kanamycin sensitive were verified by PCR and phenotypic assays (see crystal violet adherence assay below) for complete segregation.

Crystal Violet Adherence Assay

Synechocystis cultures were inoculated at an OD730 of 0.1 in 2 mL of BG-11 medium in test tubes. Kanamycin was added at a concentration of 50 µg/mL when appropriate. In each experimental replicate, static cultures were grown in triplicate for 96 hours at 30°C with 40 µmol photons m−1 s−1. The adherence of three cultures was then measured as follows: The culture medium containing non-adherent cells was decanted from each of the tubes. Each tube was gently washed 2× with 2 mL of BG-11. Tubes were then stained with 1% crystal violet in ddH2O for 15 min. The tubes were then gently rinsed 3× with ddH2O. Adherent cells were resuspended in 1 mL of DMSO and vortexed vigorously. The OD630 of each tube was then measured. Each strain was analyzed in triplicate. Representative data of three separate experiments are presented.

LPS Extraction and Analysis

LPS extraction was carried out as described [29]. Briefly, 25 mL cultures of Synechocystis were inoculated to an initial cell density of 0.1 OD730 in 50 mL of BG-11 in 125 mL Erlenmeyer flasks for 4 days at 30°C with 40 µmol photons m−1 s−1, shaking at 115 rpm. Cultures were normalized for cell density and centrifuged at 6000 rpm in a Sorvall SS-34 rotor for 20 min. Bacterial pellets were resuspended in 5 mL TRI reagent (Sigma) in 15 mL conical tubes, vortexed and incubated at room temperature overnight with gentle shaking. Then, 1 mL of chloroform was added to each tube which was then vortexed well and incubated at room temperature for 15 min. Samples were then centrifuged at 11,000 rpm in a Sorvall SS-34 rotor for 10 min. The aqueous phase was transferred to a fresh tube and the organic phase was back-extracted with 2 mL of ddH2O. Samples were frozen and lyophilized overnight. Samples were then resuspended in cold 0.375 M NaCl in 95% ethanol, transferred to 1.5 mL centrifuge tubes and washed 2× in 0.375 M NaCl in 95% ethanol, resuspended in 1mL of cold 100% ethanol and lyophilized overnight. Samples were then washed three times in cold Folch reagent (2∶1 CHCl3:MeOH), lyophilized and resuspended in 100 µL ddH2O. LPS was analyzed by SDS-PAGE on a 4–15% gradient gel (Biorad) and then visualized by silver staining [30].

EPS Extraction and Analysis

EPS was extracted by mechanical disruption as described [31]. Cells were grown to early stationary phase (OD730 ∼1.0) and normalized for equal OD730. Fifty milliliters of cells were centrifuged for 20 minat 10,000×g (Sorvall SS-34). Samples were resuspended in 10 mL BG-11 and fixed with 60 µL of formaldehyde (Sigma) overnight at 4°C. 4 mL of 1 M NaOH was added to each sample, which was then vigorously agitated with a vortex for 15 sec. Samples were centrifuged for 20 min at 20,000×g (Sorvall SS-34). The supernatants were frozen, lyophilized and resuspended in 2 mL of water, each. At this point, samples were dialyzed three times against 4 L of water, lyophilized overnight and resuspended in 100 µL of water. 10 µL of each sample was loaded onto a 12% Mini-PROTEAN® TGX™ Precast Gel (BioRad #456-1045) and stained with Alcian Blue. Briefly, gels were fixed with 12.5% trichloroacetic acid for 30 min and rinsed with water. Following incubation in a solution containing 1% periodate and 3% acetic acid, gels were washed five times in water. Gels were then incubated in 0.5% potassium disulfite for thirty min and washed three times in water. At this point, gels were stained with a solution of 0.5% Alcian blue in 3% acetic acid overnight. Prior to visualization, gels were destained with 7% acetic for 5 min or until EPS bands were visible.

Outer Membrane Protein Analysis

Outer membrane proteins were extracted as described [32]. Cultures were grown under static conditions as described above. Fifty milliliters of culture at OD730 0.4 were centrifuged and the outer membrane faction was purified. Membrane fractions were resuspended in 20 µL of Laemmli buffer with 5.5% β-mercaptoethanol (Sigma). Each sample was loaded in its entirety onto a 12% SDS-PAGE gel and stained with Coomassie brilliant blue.

Glycosyl Composition Analysis of OAg and EPS

Glycosyl composition analysis was performed by combined gas chromatography/mass spectrometry (GC/MS) of the per-O-trimethylsilyl (TMS) derivatives of the monosaccharide methyl glycosides produced from the sample by acidic methanolysis. Between 200 and 300 µg of each sample was used for the analysis. The samples were placed into test tubes and 20 µg of inositol was added. Methyl glycosides were then prepared from the dry samples by methanolysis in 1 M HCl in methanol at 80°C (17 hours), followed by re-N-acetylation with pyridine and acetic anhydride in methanol (for detection of amino sugars). The samples were then per-O-trimethylsilylated by treatment with Tri-Sil (Pierce) at 80°C (0.5 hours). These procedures were carried out as previously described [33], [34]. GC/MS analysis of the TMS methyl glycosides was performed on an Agilent 7890A GC interfaced to a 5975C MSD, using a Agilent DB-1 fused silica capillary column (30 mm × 0.25 mm ID).

Results and Discussion

We wished to ascertain what genes in Synechocystis were likely involved in the biosynthesis of structural components of cell surface structures. To this end, whole genome comparisons of Synechocystis were carried out against E. coli K-12 and S. enterica serovar Typhimurium LT2. We identified over 500 putative genes potentially involved in the synthesis and assembly of the Synechocystis 6803 cell wall and cell-surface macromolecular components. Additionally, we identified gene products involved in LPS biosynthesis, polysaccharide biosynthesis, extracellular appendages, cell wall biosynthesis, metabolite biosynthesis and peptidoglycan biosynthesis (Tables S1). The nomenclature for OAg biosynthesis has changed over the years [35]. Whereas the OAg ABC transporter components were once designated rfbA (permease component) and rfbB (ATP binding component), some of these are now given designations wzm (permease component) and wzt (ATP binding component) [35]. Our analysis revealed that Synechocystis contains two systems similar to the wzm/wzt genes that encode OAg transporters in E. coli. Genes encoding products annotated as involved in OAg synthesis and assembly, are present in the same gene cluster. Specifically, slr0983, slr0984 and slr0985 were also assigned the “rfb” designations rfbF, rfbG and rfbC, respectively. Interestingly, a similar gene arrangement (rfbFGC) was bioinformatically identified in Azotobacter vineladnii [36]. Following slr0985 in the Synechocystis gene cluster described here is slr1610, which is annotated as encoding a methyltransferase (Table 2).
Table 2

Bioinformatic analysis of the slr0977 gene cluster.

Synechocystis geneCyanobase AnnotationCyanobase functionE. coli Gene NameE. coli Gene FunctionProtein Identityc
slr0977rfbAABC transporter, permease componentwzmABC transporter membraneprotein71/259 (27%)
slr0978-81hypotheticalunknown
slr0980hypotheticalunknown
slr0981hypotheticalunknown
slr0982rfbBpolysaccharide ABC transporterATP binding subunitwztATP binding component ofABC-transporter100/232 (43%)
slr0983rfbFglucose-1-phosphate cytidylyltransferaseNAa dTDP-glucose 4,6-dehydratase 289/358 (25%)
slr0984rfbGCDP-glucose 4,6-dehydrataseNAdTDP-4-deoxyrhamnose-3,5-epimerase97/341 (28%)
slr0985rfbCdTDP-4-dehydrorhamnose 3,5-epimerasermlCdTDP-4-dehydrorhamnose 3,5-epimerase100/165 (60%)
slr1610hypotheticalputative C-3 methyltransferaseNAbifunctional 3-demethylubiquinone-9 3-methyltransferase32/142 (23%)
sll0574rfbApermease protein of lipopolysaccharideABC transporterwzmABC transporter membrane protein72/266 (27%)
sll0575rfbBlipopolysaccharide ABC transporter ATP binding subunitwztATP binding component of ABC-transporter86/239 (36%)

a. Not Assigned.

a. Not Assigned. The genes slr0977 and sll0574 encode homologs of the integral membrane protein Wxm. The slr0977 and sll0574 gene products possessed 24% and 29% identity to Wzm in E. coli, respectively (Table 1). Similarly, slr0982 and sll0575 are annotated as rfbB [22]. These gene products are 34% and 41% identical to the ABC protein, Wzt in E. coli. Wzt possess a C-terminal nucleotide binding cassette and an N-terminal carbohydrate binding domain [37]. While the C-terminal, nucleotide binding regions of the slr0982 and sll0575 gene products are highly homologous, there is little homology at the N-terminal region of these predicted gene products. This lack of N-terminal homology is likely indicative of differential substrate specificity for the type of polysaccharides transported by these systems.

Disruption ABC Transporters Leads to Flocculent Cultures with Modulated Adherence Properties

In Synechocystis, genes encoding products that function in the same biosynthetic pathway are not consistently organized in operons [22]. It is interesting therefore, that the genes slr0977 and slr0982 are part of a nine-gene cluster in Synechocystis (Fig. 1A). These two ABC transporter components are separated by slr0978, slr0980, and slr0981, which are hypothetical genes with no known function. These genes are followed by slr0983 (glucose-1-phosphate cytidylyltransferase), slr0984 (CDP-glucose 4,6-dehydratase), slr0985 (dTDP-4-dehydrorhamnose 3,5-epimerase) and slr1610 (putative C-3 methyltransferase). We also observed that the genes sll0574 and sll0575 located distantly on the complementary strand of the genome (Fig. 1B) encoded for homologs of Wzm and Wzt respectively.
Figure 1

Genetic organization of the slr0977 gene cluster.

(A) slr0977 and slr0982 are predicted to encode a permease and ATPase components of an ATP-transporter, respectively. slr0978-0981 encode hypothetical proteins of unknown function. slr1610 is a predicted methyltransferase. (B) sll0574 and sll0575 are predicted to encode a permease and ATPase components of an ATP-transporter, respectively.

Genetic organization of the slr0977 gene cluster.

(A) slr0977 and slr0982 are predicted to encode a permease and ATPase components of an ATP-transporter, respectively. slr0978-0981 encode hypothetical proteins of unknown function. slr1610 is a predicted methyltransferase. (B) sll0574 and sll0575 are predicted to encode a permease and ATPase components of an ATP-transporter, respectively. To investigate the role of slr0977 and slr0982 in cell surface modification, we generated mutants by deleting these genes in the SD100 background [1]. Mutant strains lacking different combinations of these genes were created through allelic replacement with a kanamycin-resistance cassette and the counter-selectable sacB gene (Table 3) [38]. The growth rates of Δslr0977, Δslr0982, Δslr1610, or the triple mutant Δ(slr0977;Δsll0574-5) were identical to wild type. However, mutants demonstrated readily apparent flocculent phenotypes and adherence to glass culture vessels (Fig. 2).
Table 3

Strains and Plasmids.

StrainRelevant GenotypeSource
SD100 Synechocystis PCC 6803 [1]
SD506Δslr0977 this study
SD553Δslr0982 this study
SD507Δslr1610 this study
SD565Δ(slr0977sll0574-5)this study
SD563Δslr0982+ slr0982 this study
SD564Δslr1610+ slr1610 this study
pJet1.2general cloning vector (pUC19 derivative)Fermentas
pPbsA2ksSource of kanamycin-resistance-sacB cassette [41]
pψ508suicide vector for counterselecting sacB in SD506this study
pψ509suicide vector for constructing SD506this study
pψ510suicide vector for counterselecting sacB in SD501this study
pψ511suicide vector for constructing SD501this study
pψ512suicide vector for counterselecting sacB in SD507this study
pψ513suicide vector for constructing SD507this study
pψ514suicide vector for counterselecting sacB in SD565this study
pψ515suicide vector for constructing SD565this study
pψ560suicide vector for counterselecting sacB in SD553this study
pψ561suicide vector for constructing SD553this study
pψ618suicide vector for complementing slr0977mutation in SD506this study
pψ619suicide vector for complementing slr0982mutation in SD507this study
pψ620suicide vector for complementing slr1610mutation in SD507this study
Figure 2

Adherence of Synechocysis mutants to glass culture vessels.

Quantification was carried out by spectrophotometry of crystal violet staining of attached cells. Strains were grown statically in 2-11 at 30°C with 40 µmol photons m−1 s−1 for 4 days. Data are the combination of at least three biological replicates. Representative data of strains adhering to glass culture vessels (inset). Error bars indicate the standard deviation from the mean.

Adherence of Synechocysis mutants to glass culture vessels.

Quantification was carried out by spectrophotometry of crystal violet staining of attached cells. Strains were grown statically in 2-11 at 30°C with 40 µmol photons m−1 s−1 for 4 days. Data are the combination of at least three biological replicates. Representative data of strains adhering to glass culture vessels (inset). Error bars indicate the standard deviation from the mean. We quantified the adherence of each mutant to the growth vessel by the crystal violet binding assay (Fig. 2). All mutant strains tested were significantly better able to adhere to glass culture vessels. Following four days of static growth in a two milliliter culture, the mutant strains Δslr0977, Δslr0982, and Δslr1610 all demonstrated a 4-6 fold increase in binding (Fig. 2). The adherence of these strains was specific to glass vessels. Mutant strains grown in polystyrene flat-bottom 96 well plates (Costar or Nunc MaxiSorp®) did not demonstrate increased adherence relative to wild-type (data not shown). The ability of these mutants to flocculate and not adhere to plastic may have industrial applications. This is particularly true of production in closed photobioreactors (PBR), which are often constructed from plastics. Such flocculent strains would decrease the energy requirements for centrifugation or filtration during biofuel production. Concomitantly, such phenotypes may eliminate the risk of biofouling by cyanobacterial growth on the PBR surface. It is intuitive that Δslr0977 and Δslr0982 would demonstrate similar phenotypes given that they are both lacking genes encoding products in the same transport system. The failure to transport the same substrate likely accounts for this phenotype. It is interesting that the Δslr1610 mutant demonstrated a nearly identical phenotype to both the Δslr0977 and Δslr0982 strains. The slr1610 gene encodes a putative methyltransferase. In OAg production, a methyltransferase is responsible for terminating carbohydrate polymerization [22]. Additionally, methylation of the carbohydrate chain is important for recognition by the ABC transporter for subsequent transport [39]. Given this, one parsimonious model is that in the absence of the slr1610 gene product, larger carbohydrate moieties are synthesized by the mutant than in wild-type. It is likely that such long carbohydrate chains would be unable to properly interact with the slr0977/slr0982 gene products for extracellular transport. It is unlikely that the phenotypes of these mutants are due to polar effects created while constructing the slr0977 or slr0982 deletions. This is evidenced by the fact that a similar mutation Δ(slr0978-81) (located between the slr0977 and slr0982 ORFs) was indistinguishable from wild-type in adherence, flocculence and growth (data not shown).

Mutant Adherence Occurs as a Monolayer

To further examine the adherence of cell to glass, wild-type and mutants were grown on sterile coverslips for four days in static culture and examined by fluorescence microscopy (Fig. 3). Consistent with crystal violet staining, wild-type cells adhered poorly to glass (Fig. 3A), whereas Δslr0977, Δslr0982, Δslr1610 and Δ(slr0977;Δsll0574-5) readily adhered to coverslips (Fig. 3B-E, respectively). Furthermore, the adherence phenotypes of the Δslr0982 or Δslr1610 mutants is unlikely due to compensatory mutations as strains complemented with a wild-type allele were indistinguishable from wild-type (Fig. 2 and Fig. 3E-F).
Figure 3

Adherence of mutant strains to glass coverslips after 4 days of growth.

Following four days of static growth on sterile glass coverslips, slides were washed gently with water and Synechocystis autofluorescence was visualized by fluorescence microscopy. (A) wild-type, (B) Δslr09777, (C) Δslr0982, (D) Δslr1610 (E) Δ(slr0977; Δsll0974-5), (F) Δslr0982+ slr0982, (G) Δslr1610+slr1610. White scale bars indicate 200 µm.

Adherence of mutant strains to glass coverslips after 4 days of growth.

Following four days of static growth on sterile glass coverslips, slides were washed gently with water and Synechocystis autofluorescence was visualized by fluorescence microscopy. (A) wild-type, (B) Δslr09777, (C) Δslr0982, (D) Δslr1610 (E) Δ(slr0977; Δsll0974-5), (F) Δslr0982+ slr0982, (G) Δslr1610+slr1610. White scale bars indicate 200 µm. We did not observe complex, three-dimensional architecture consistent with biofilm formation [40]. Rather, we saw monolayers of cells strongly adhered to glass (Fig. 3A). These data are consistent with the idea that disruption of these gene products leads to a change in the charge of the cell surface. In fact, EPS biosynthesis mutants lacking sll1581 (gumB) and sll5052 (gumC) aggregated out of solution and had altered cell surface charges [8].

OAg Structure and Composition is Unaffected by Mutations in Δslr0977, Δslr0982, Δslr1610 and Δ(slr0977;Δsll0574-5)

To determine if OAg was responsible for the modulated adherence and flocculation of the mutants generated, total LPS was extracted from mid-log cultures of wild-type or mutant strains and analyzed by SDS-PAGE (Fig. 4). A previously characterized fucose synthase mutant (Δsll1213) [41] was also processed as a positive control for disrupted OAg structures. As expected, the fucose synthase mutant demonstrated marked differences in size and intensities of purified LPS species from the wild-type strain. However, LPS from the mutant strains demonstrate very little difference from wild-type (Fig. 4). Occasionally, some variation in band intensities was observed between the mutant strains and wild-type (e.g. Fig. 4 low molecular weight bands). However, these differences were sporadic and likely due to minor variations in growth stage from one experiment to another, rather than the introduced mutations.
Figure 4

Purified LPS analysis from the adhesive mutants: Δslr0977, Δslr0982, Δslr1610 and Δ(slr0977;Δsll0574-5).

LPS was purified from wild-type (WT) or the corresponding mutants. Samples were analyzed by 12% SDS-PAGE and silver staining.

Purified LPS analysis from the adhesive mutants: Δslr0977, Δslr0982, Δslr1610 and Δ(slr0977;Δsll0574-5).

LPS was purified from wild-type (WT) or the corresponding mutants. Samples were analyzed by 12% SDS-PAGE and silver staining. Although there were no obvious differences in size of the OAg derived from Δslr0977, Δslr0982, Δslr1610 or Δ(slr0977;Δsll0574-5), it seemed possible that compositional changes in OAg accounted for the phenotypes of these strains. Therefore, purified OAg was analyzed by gas chromatography to determine its composition (Table 4). The results of the overall composition of Synechocystis OAg are consistent with similar analyses [42]. Glucose was the major component in all wild-type and mutant strains (62.1–76.5%). OAg from mutant and wild-type strains contained similar amounts of glucose as well as of xylose, fucose, galactose, and mannose (Table 4).
Table 4

Gas chromatographic analysis of OAg componentsa.

WT Δslr0977 Δslr0982 Δslr1610
SugarMol %SDMol %SDMol %SDMol %SD
glucose66.28.262.1054.11776.55.7
xylose100.519.414.813.348.71.2
fucose9.945.47.67.78.67.85.4
galactose7.38.31.426.25.14.74.9
mannose3.24.59.41.83.24.52.43.4
ribose2.11.211.3000
rhamnose1.52.10.70.915.62200
N-Acetyl Galactosamine00.30.400
N-Acetyl Glucosamine00.50.700
N-Acetyl Mannosamine0000
glucuronic Acid0000
galacturonic acid0000
arabinose0000

Composition of OAg from the indicated strain. Data are presented as the Mol% of each sugar from the total carbohydrate extracted. Sums may not add to 100% due to rounding.

Composition of OAg from the indicated strain. Data are presented as the Mol% of each sugar from the total carbohydrate extracted. Sums may not add to 100% due to rounding. Although no significant differences were observed in the OAg profile of the Δslr0982 mutant, increased concentrations of sugars such as rhamnose were detected. These differences were sporadic between experiments, but it is interesting to speculate that the slr0977 gene product may be interacting non-specifically with unidentified homologs of the slr0982 gene product (i.e. other ABC transporter components). Since such slr0982 homologs would have affinity for different carbohydrates, it may explain the sporadic display of unusual sugars in the OAg of this mutant. We have identified 157 putative glycosyl transferases in Synechocystis with homology to gene products of E. coli and Salmonella (Table S1). It is unclear how many of these function in EPS biosynthesis. By engineering strains that have altered glycosyl transferase profiles, it may be possible to engineer altered EPS for designer purposes such as re-capturing waste products from waste water [8], [16], [17].

EPS is Altered in Strains Δslr0977, Δslr0982, Δslr1610 and Δ(slr0977; sll0574-5)

Surprisingly, OAg structure was not disrupted in the mutant strains Δslr0977, Δslr0982, Δslr1610 and Δ(slr0977;Δsll0574-5). It seemed likely, therefore, that these gene products play a role in the export of other carbohydrate substrates. To determine if these gene products functioned in EPS biosynthesis, EPS was extracted from stationary phase cultures of wild-type, Δslr0977, Δslr0982, Δslr1610 and Δ(slr0977;Δsll0574-5) strains. Samples from each culture were analyzed by SDS-PAGE and Alcian blue staining. The Δsll1213 mutant had been previously characterized as an EPS mutant [41] and was used as a positive control for EPS disruption (Fig. 5). The major band from EPS extraction (See Fig. 5, black arrow) is a large molecular weight polymer that runs above 250 kDa. The mutant strains Δslr0977, Δslr0982, Δslr1610 and Δ(slr0977;Δsll0574-5) all lacked the major EPS band. However, EPS from all mutants tested displayed a smaller EPS band similar to that from the Δsll1213 strain, previously demonstrated to produce altered EPS [41].
Figure 5

EPS and OMP profiles are effected by mutations in Δslr0977, Δslr0982, Δslr1610 or in a triple mutant Δ(slr0977;Δsll0574-5).

(A) EPS as purified from wild-type (WT) or the corresponding mutants by mechanical extraction. EPS from a Δslr1213 strain is known to be deficient in EPS production and was loaded as a control. Samples were analyzed by SDS-PAGE and Alcian Blue staining. Black arrow indicates major EPS band. (B) OMP profile of wild-type or mutant Synechocystis as analyzed by SDS-PAGE and Coomassie brilliant blue staining. Molecular weights of protein standards are indicated for both analyses are indicated by numbers on the left.

EPS and OMP profiles are effected by mutations in Δslr0977, Δslr0982, Δslr1610 or in a triple mutant Δ(slr0977;Δsll0574-5).

(A) EPS as purified from wild-type (WT) or the corresponding mutants by mechanical extraction. EPS from a Δslr1213 strain is known to be deficient in EPS production and was loaded as a control. Samples were analyzed by SDS-PAGE and Alcian Blue staining. Black arrow indicates major EPS band. (B) OMP profile of wild-type or mutant Synechocystis as analyzed by SDS-PAGE and Coomassie brilliant blue staining. Molecular weights of protein standards are indicated for both analyses are indicated by numbers on the left. Given that the mutants we analyzed were deficient in EPS export compared to wild-type, we determined the composition of mutant EPS. Consistent with altered EPS sizes detected in SDS-PAGE (Fig. 5), we observed differences in both the total carbohydrate in the EPS samples and alterations in the sugar content (Table 5). As previously described [31], Synechocystis EPS is primarily composed of glucose (∼72%), fucose (∼10%), xylose (∼9%), mannose (∼5%), and galactose (∼3%) with trace percentages of ribose, rhamnose and N-acetyl glucosamine (Table 5). EPS samples from Δslr0977 showed a marked decrease in glucose composition (35%) compared to wild-type samples and a concomitant increase in the percentage of ribose (29%). One possibility is that in the absence of the native pore, increased activity of a slr0977 gene product homolog leads to the improper transport of extracellular carbohydrates. In fact, this is likely due to the ABC transporter encoded by sll0574-5, as Δ(slr0977; Δsll0574-5) demonstrated carbohydrate composition nearly identical to wild-type (Table 5). EPS derived from Δslr0982 and Δslr1610 showed a modest increase in the percentage of ribose from wild-type. While the EPS from the Δslr1610 showed a marked decrease in glucose composition (50%), the EPS of the Δslr0982 mutant was composed of 80% glucose. In addition, the EPS extracted from Δslr0982 contained less fucose than the wild-type. This may indicate that in the absence of slr0982, the slr0977 gene product is capable of utilizing alternative ABC transporter components with a similar affinity for glucose as the slr0982 gene product.
Table 5

Gas chromatographic analysis of EPS componentsa.

Sugar (Mol %)Wild-typeΔslr0977Δslr0982Δslr1610Δ(slr0977; Δsll0574-5)Δsll1213
glucose71.73580.850.473.876.3
fucose9.710.11.1109.3-
xylose8.66.90.38.77.12.8
mannose53.46.93.94.59.8
galactose3.19.96.39.53.27.4
ribose0.629.44.115.31.22.8
rhamnose0.65.42.20.3
N-acety glucosamine0.60.50.71

Composition of OAg from the indicated stain. Data are presented as the Mol% of each sugar from the total carbohydrate extracted. Sums may not add to 100% due to rounding.

Composition of OAg from the indicated stain. Data are presented as the Mol% of each sugar from the total carbohydrate extracted. Sums may not add to 100% due to rounding. It is possible that changes in EPS or OAg can lead to altered outer membrane protein (OMP) profiles, which may play a role in cellular attachment. To determine if this was the case with our mutants, we isolated OMPs from mutant strains and analyzed them by SDS-PAGE. Proteins were visualized by staining with Coomassie brilliant blue (Fig). This analysis demonstrated that the Δslr0982 strain lacked a protein with A molecular wieght of ∼250 kDa, which likely represents the monomer that comprises the proteinaceous S-layer. This result indicates an important role in fucose production and transport in the attachment of the S-layer to the cell surface, as the fucose minus strain, Δsll1213, is also deficient in S-layer attachment [41]. As expected, no detectable fucose was present in the Δsll1213 strain, which is aberrant in cell wall structure, thylakoid membrane biogenesis, EPS as well as LPS production ([41] and Fig. 4). Aggregation of the Δsll1213 strain is detectable microscopically [41]. However, a defect in fucose production does not illicit autoflocculation from the culture medium. This may be due to the pleotropic effects of the Δsll1213 mutation, which compensate cell surface charge or structures by an unknown mechanism. However, the differences between these strains may also indicate that perturbations of the transport machinery, rather than the EPS or LPS content per se are responsible for the cellular aggregation. Here we have bioinformatically identified over five hundred gene products associated cell surface structures in Synechocystis with homology to genes in E. coli and Salmonella (Table S1). These data included slr0977/slr0982 and slr0574-5 which were annotated as gene products in involved in OAg transport. We provide evidence that they are, in fact, involved in the transport of a similar carbohydrate structure, EPS. By modulating such cell surface moieties, strains can be developed for with autoflocculant phenotypes useful in biomass recovery. Additionally, genetically engineering cyanobacteria with altered cell surface carbohydrate structures in cyanobacteria will prove to be useful tools for bioremediation. Gene products potentially involved in the synthesis and assembly of the Synechocystis cell wall and cell-surface macromolecular components. (XLS) Click here for additional data file.
  35 in total

1.  Lipopolysaccharide dependence of cyanophage sensitivity and aerobic nitrogen fixation in Anabaena sp. strain PCC 7120.

Authors:  X Xu; I Khudyakov; C P Wolk
Journal:  J Bacteriol       Date:  1997-05       Impact factor: 3.490

2.  Cloning of the psbK gene from Synechocystis sp. PCC 6803 and characterization of photosystem II in mutants lacking PSII-K.

Authors:  M Ikeuchi; B Eggers; G Z Shen; A Webber; J J Yu; A Hirano; Y Inoue; W Vermaas
Journal:  J Biol Chem       Date:  1991-06-15       Impact factor: 5.157

3.  Site-directed mutagenesis by overlap extension using the polymerase chain reaction.

Authors:  S N Ho; H D Hunt; R M Horton; J K Pullen; L R Pease
Journal:  Gene       Date:  1989-04-15       Impact factor: 3.688

4.  Rapid microprocedure for isolating detergent-insoluble outer membrane proteins from Haemophilus species.

Authors:  G M Carlone; M L Thomas; H S Rumschlag; F O Sottnek
Journal:  J Clin Microbiol       Date:  1986-09       Impact factor: 5.948

5.  Selective isolation of blue-green algae from water and soil.

Authors:  M M Allen; R Y Stanier
Journal:  J Gen Microbiol       Date:  1968-04

6.  Allelic exchange in Escherichia coli using the Bacillus subtilis sacB gene and a temperature-sensitive pSC101 replicon.

Authors:  I C Blomfield; V Vaughn; R F Rest; B I Eisenstein
Journal:  Mol Microbiol       Date:  1991-06       Impact factor: 3.501

7.  Carbohydrate composition analysis of glycoconjugates by gas-liquid chromatography/mass spectrometry.

Authors:  R K Merkle; I Poppe
Journal:  Methods Enzymol       Date:  1994       Impact factor: 1.600

Review 8.  Bacterial polysaccharide synthesis and gene nomenclature.

Authors:  P R Reeves; M Hobbs; M A Valvano; M Skurnik; C Whitfield; D Coplin; N Kido; J Klena; D Maskell; C R Raetz; P D Rick
Journal:  Trends Microbiol       Date:  1996-12       Impact factor: 17.079

Review 9.  Biosynthesis of O-antigens: genes and pathways involved in nucleotide sugar precursor synthesis and O-antigen assembly.

Authors:  Gabrielle Samuel; Peter Reeves
Journal:  Carbohydr Res       Date:  2003-11-14       Impact factor: 2.104

10.  Expression of the O9 polysaccharide of Escherichia coli: sequencing of the E. coli O9 rfb gene cluster, characterization of mannosyl transferases, and evidence for an ATP-binding cassette transport system.

Authors:  N Kido; V I Torgov; T Sugiyama; K Uchiya; H Sugihara; T Komatsu; N Kato; K Jann
Journal:  J Bacteriol       Date:  1995-04       Impact factor: 3.490

View more
  23 in total

1.  Ethylene Regulates the Physiology of the Cyanobacterium Synechocystis sp. PCC 6803 via an Ethylene Receptor.

Authors:  Randy F Lacey; Brad M Binder
Journal:  Plant Physiol       Date:  2016-05-31       Impact factor: 8.340

2.  Slr2019, lipid A transporter homolog, is essential for acidic tolerance in Synechocystis sp. PCC6803.

Authors:  Ayumi Matsuhashi; Hiroko Tahara; Yutaro Ito; Junji Uchiyama; Satoru Ogawa; Hisataka Ohta
Journal:  Photosynth Res       Date:  2015-03-31       Impact factor: 3.573

3.  Reduction of Spermidine Content Resulting from Inactivation of Two Arginine Decarboxylases Increases Biofilm Formation in Synechocystis sp. Strain PCC 6803.

Authors:  Kota Kera; Tatsuya Nagayama; Kei Nanatani; Chika Saeki-Yamoto; Akira Tominaga; Satoshi Souma; Nozomi Miura; Kota Takeda; Syunsuke Kayamori; Eiji Ando; Kyohei Higashi; Kazuei Igarashi; Nobuyuki Uozumi
Journal:  J Bacteriol       Date:  2018-04-09       Impact factor: 3.490

4.  Quantification of Chlorophyll as a Proxy for Biofilm Formation in the Cyanobacterium Synechococcus elongatus.

Authors:  Eleonora Sendersky; Ryan Simkovsky; Susan S Golden; Rakefet Schwarz
Journal:  Bio Protoc       Date:  2017-07-20

Review 5.  Engineering cyanobacteria as photosynthetic feedstock factories.

Authors:  Stephanie G Hays; Daniel C Ducat
Journal:  Photosynth Res       Date:  2014-02-14       Impact factor: 3.573

6.  Axenic Biofilm Formation and Aggregation by Synechocystis sp. Strain PCC 6803 Are Induced by Changes in Nutrient Concentration and Require Cell Surface Structures.

Authors:  Rey Allen; Bruce E Rittmann; Roy Curtiss
Journal:  Appl Environ Microbiol       Date:  2019-03-22       Impact factor: 4.792

7.  Finding approximate gene clusters with Gecko 3.

Authors:  Sascha Winter; Katharina Jahn; Stefanie Wehner; Leon Kuchenbecker; Manja Marz; Jens Stoye; Sebastian Böcker
Journal:  Nucleic Acids Res       Date:  2016-09-26       Impact factor: 16.971

8.  Proteome Mapping of a Cyanobacterium Reveals Distinct Compartment Organization and Cell-Dispersed Metabolism.

Authors:  Laura L Baers; Lisa M Breckels; Lauren A Mills; Laurent Gatto; Michael J Deery; Tim J Stevens; Christopher J Howe; Kathryn S Lilley; David J Lea-Smith
Journal:  Plant Physiol       Date:  2019-10-02       Impact factor: 8.340

9.  Identification of a transporter Slr0982 involved in ethanol tolerance in cyanobacterium Synechocystis sp. PCC 6803.

Authors:  Yanan Zhang; Xiangfeng Niu; Mengliang Shi; Guangsheng Pei; Xiaoqing Zhang; Lei Chen; Weiwen Zhang
Journal:  Front Microbiol       Date:  2015-05-18       Impact factor: 5.640

10.  Phylum-wide analysis of genes/proteins related to the last steps of assembly and export of extracellular polymeric substances (EPS) in cyanobacteria.

Authors:  Sara B Pereira; Rita Mota; Cristina P Vieira; Jorge Vieira; Paula Tamagnini
Journal:  Sci Rep       Date:  2015-10-06       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.