Non-lethal heat shock increased Hsp70 and immune protein transcripts but not Vibrio tolerance in the white-leg shrimp.

Non-lethal heat shock boosts bacterial and viral disease tolerance in shrimp, possibly due to increases in endogenous heat shock protein 70 (Hsp70) and/or immune proteins. To further understand the mechanisms protecting shrimp against infection, Hsp70 and the mRNAs encoding the immune-related proteins prophenoloxidase (proPO), peroxinectin, penaeidin, crustin and hemocyanin were studied in post-larvae of the white-leg shrimp Litopenaeus vannamei, following a non-lethal heat shock. As indicated by RT-qPCR, a 30 min abrupt heat shock increased Hsp70 mRNA in comparison to non-heated animals. Immunoprobing of western blots and quantification by ELISA revealed that Hsp70 production after heat shock was correlated with enhanced Hsp70 mRNA. proPO and hemocyanin mRNA levels were augmented, whereas peroxinectin and crustin mRNA levels were unchanged following non-lethal heat shock. Penaeidin mRNA was decreased by all heat shock treatments. Thirty min abrupt heat shock failed to improve survival of post-larvae in a standardized challenge test with Vibrio harveyi, indicating that under the conditions of this study, L. vannamei tolerance to Vibrio infection was influenced neither by Hsp70 accumulation nor the changes in the immune-related proteins, observations dissimilar to other shrimp species examined.

Introduction

Exposure to long-term hyperthermic stress disrupts the normal physiological processes of shrimp and under severe conditions may decrease feeding, retard growth and molting, and weaken the immune response, resulting in mortality [1]. However, a non-lethal heat shock (NLHS) enhances shrimp resistance against bacterial and viral infections. For example, heating from 28°C to 37°C for 30 min with 6 h recovery shielded the brine shrimp Artemia against Vibrio campbellii and V. proteolyticus challenge, with survival enhanced 2-fold over non-heated animals [2]. A NLHS from 29°C to 35°C for 24 h increased the tolerance of the Tiger shrimp Penaeus monodon to gill associated virus (GAV) by reducing viral replication [3].

Several mechanisms have been proposed to explain how heat shock defends against bacterial and viral diseases in aquatic animals. A NLHS may enhance heat shock protein (Hsp) production, particularly Hsp70, which is required to stabilize cells against injury due to pathogen proliferation, properly fold cell proteins synthesized in response to bacterial pathogens, store and re-fold partially denatured proteins and stimulate the innate immune response [4]. On the other hand, NLHS may increase the expression of selected immune-related genes resulting in enhanced immunity. In this context, heating from 24°C to 27°C and 30°C stimulates the prophenoloxidase (proPO) cascade system of L. vannamei, a mechanism important for pathogen melanisation by the innate immune system [5]. proPO occurs naturally as an inactive pro-form of phenoloxidase (PO), activated by an endogenous trypsin-like serine protease referred to as prophenoloxidase activating enzyme (ppA) [6]. proPO activates melanin production and increases cell adhesion, encapsulation and phagocytosis [7], [8], important mechanisms by which the crustacean innate immune system combats microbial invasion.

An associated protein of the proPO system, referred to as peroxinectin, mediates cellular adhesion to invading microorganisms and enhances the antimicrobial oxidase burst ability of hemocytes [9]. This protein is a secreted opsonin [10] which regulates granule exocytosis and promotes encapsulation of foreign particles [11]. Peroxinectin normally occurs in the granular and semigranular hemocytes of L. vannamei. Elevated synthesis of transcripts in the gills indicates peroxinectin traps and encapsulates invasive bacteria in this organ, a putative defense mechanism for pathogen elimination in shrimp [12]. Penaeidins are the most prominent antimicrobial peptides in shrimp, occurring naturally in the hemolymph. Five types of penaeidins exist of which three, namely penaeidin-1, -2, -3 were isolated from hemocytes of L. vannamei [13]. Pen-4 and Pen-5 were isolated from hemocyte organelle-rich fractions of L. vannamei [14] and P. monodon [15]. Penaeidins possess potent antifungal and antibacterial properties [16] and they are effective against filamentous fungi and Gram positive bacteria [17]. However, the penaeidins function weakly against yeast such as Candida albican and Sacharomyces cerevisiae and Gram negative bacteria, including Vibrio sp [18]. Of the five penaeidins, Pen-3 is the most effective and it is abundant in the hemocytes of L. vannamei [13] and P. monodon [19]. Hemocyanin, an oxygen transporter unique to crustaceans [20], plays a crucial role in protein storage, osmotic regulation [21] and ecdysone transportation [22]. Astacidin, a hemocyanin from crayfish, exhibits anti-bacterial activities [23] and hemocyanins isolated from L. vannamei and P. stylirostris have antifungal capabilities [24]. Hemocynin from P. monodon possesses non-specific antiviral properties [25]. Crustins are cationic cysteine-rich antimicrobial peptides consisting of a single whey acidic protein (WAP) domain recognized as a signature motif for a serine protease inhibitor [26]. Two types of crustins, namely crustin II and III, are abundant in the hemocytes of P. monodon, each having different sequence characteristics and antimicrobial activities [27]. Most crustins exhibit potent activity against Gram positive bacteria [28] but are weak against Gram negative bacteria and fungi [29], except the crus-likePm which kills some Gram negative bacteria [30]. Certain isoforms of crustin have biological functions other than immunity. CrustinPm5, a type II crustin gene with complete heat shock regulatory elements (HSEs), upregulates robustly under heat and salinity stress, suggesting involvement in abiotic stress tolerance of the Penaeid shrimp [31].

Because the relationship between NLHS and the innate immune response is poorly understood, the formulation of strategies that favor shrimp tolerance to bacterial infection, and other important diseases in aquaculture is hampered. The effect of NLHS on the production of Hsp70 and of mRNAs encoding the immune proteins, proPO, peroxinectin, penaeidin, crustin and hemocyanin in L. vannamei post-larvae, an intermediate stage between mysis and juveniles in the Penaeid shrimp life cycle, was studied. The synthesis of Hsp70 mRNA and protein were induced by NLHS. The production of mRNAs encoding proPO and hemocyanin was enhanced whereas penaeidin mRNA was reduced. This study is the first to demonstrate that NLHS has a differential effect on mRNAs encoding proteins involved in the innate immune response of L. vannamei. Although the mRNA for the immune proteins proPO and hemocyanin increased, along with Hsp70 upon NLHS, L. vannamei post-larvae did not acquire increased tolerance to infection.

Methodology

Heat Shock of L. vannamei

Post-larvae of L. vannamei were acclimated at 28°C, 30 g/L salinity and 50 animals/L stocking density for 7 days prior to use. During acclimation, animals were fed twice daily to satiation with live Artemia nauplii. Faeces were withdrawn and 50% of the rearing water was replaced daily. Gentle aeration maintained dissolved oxygen (DO) at 5 ppm. Post-larvae were exposed to abrupt 30 min heat shocks from 28°C to 30°C, 32°C, 34°C, 36°C and 38°C with an immersion circulator water bath system (WiseCirCu®, Germany) accurate to ±0.5°C. Post-larvae were transferred immediately after heating to 28°C for 8 h recovery prior to sampling of protein and RNA. Control post-larvae were maintained at 28°C.

Quantification of mRNAs by RT-qPCR

Total RNA was extracted from 100 mg of L. vannamei post-larvae with TRIsure™ following manufacturer’s instructions (Bioline, U.K.). The purity and quantity of the RNA were determined spectrophotometrically at 260 and 280 nm. First strand cDNA was obtained from 1 µg total RNA with a cDNA synthesis kit (Bioline, UK) by incubating 45 min at 42°C following manufacturer’s instructions. PCRs were done in the absence of reverse transcript to confirm the lack of DNA carryover.

RT-qPCR was performed with 2×SensiMix SYBR No-ROX kit (Bioline, UK) with forward and reverse primers specific for proPO, peroxinectin, penaeidin, crustin, haemocyanin, Hsp70 and β-Actin (Table 1). Amplification was in a Miniopticon Real-time PCR system (Bio-Rad, USA) at 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 58°C for 1 min for immune-related mRNA or 40 cycles of 95°C for 5s and 60°C for 31s for Hsp70. Melting curve analysis of PCR products was performed to confirm that only one product was amplified. The cycle threshold (CT) values were recorded by Opticon Monitor 3 software (Bio-Rad, USA) and fold difference in quantity for each immune-related cDNA, relative to the β-actin gene, was calculated by the 2−ΔΔCt method [32]. Amplifications were done with 3 replicates for each heat shock treatment and samples were collected from two separate experiments.

Table 1

Accession numbers and primer sequences for RT-qPCR.

Gene	Accession #	Primer sequence (5′–3′)Forward (F) and Reverse (R)	Size bp	References
Hemocyanin	X82502	(F) TCTTAGTGGTTCTTGGGCTTGTC(R) GGTCTCCGTCCTGAATGTCTCC	124	[43]
Crustin	AF430076	(F) ACGAGGCAACCATGAAGG(R) AACCACCACCAACACCTAC	141	[43]
Penaeidin-3a	Y14926	(F) CACCCTTCGTGAGACCTTTG(R) AATATCCCTTTCCCACGTGAC	121	[43]
Peroxinectin	AF188840	(F) CGAAGCTTCTTGCAACTACCA(R) GCAGGCTGATTAAACTGGCTT	56	[37]
Prophenoloxidase	AY723296	(F) CGGTGACAAAGTTCCTCTTC(R) GCAGGTCGCCGTAGTAAG	122	[43]
Hsp70	EF495128	(F) CCTCCAGGACTTCTTCAACG(R) GGTCACGTCCAACAGCAAC	144	[50]
β- actin	AF300705	(F) CCACGAGACCACCTACAAC(R) AGCGAGGGCAGTGATTTC	142	[43]

Immunodetection of Hsp70

Protein extraction was performed as described with minor modifications [33]. Fifty mg of post-larvae was homogenized in 500 µl cold buffer K (150 mM sorbitol, 70 mM potassium gluconate, 5 mM MgCl2, 5 mM NaH2PO4, 40 mM HEPES, pH 7.4) [34] containing protease inhibitor cocktail (Catalogue #P8340, Sigma-Aldrich, Missouri, USA) at the highest recommended level. After centrifugation at 4000×g for 3 min at 4°C, 10 µl aliquots of supernatant were combined separately with 5 µl SDS sample buffer, mixed and heated at 95°C for 5 min. Samples were cooled and centrifuged at 2200×g for 1 min. Fifty µg of protein sample was loaded in each lane of 10% SDS polyacrylamide gels and electrophoresis was at 120 V for 15 min followed by 150 V for 45 min [2]. Gels were either stained with Coomassie Biosafe (BioRad, USA) or blotted to polyvinylidene fluoride transfer membrane (BioRad Immun-Blot™ PVDF, USA) for probing with antibodies. Membranes were incubated with blocking buffer (50 ml of phosphate buffered saline containing 0.2% (v/v) Tween-20 and 5% (w/v) bovine serum albumin) at 25°C for 60 min at room temperature and then with a mouse monoclonal antibody specific to Hsp70 (Product# MA3-006) (Pierce Biotechnology, Rockford, USA), diluted 1∶5000. Membranes were washed 3 times for 5 min with Tris-buffered saline Tween-20 prior to incubation with HRP conjugated goat anti-mouse IgG (Pierce Biotechnology, Rockford, USA) diluted 1∶2500. Membranes were washed 3 times for 5 min with Tris-buffered saline Tween-20, and detection was with 0.7 mM diaminobenzidine tetrahydrochloride dehydrate in association with 0.01% (v/v) H2O2 in 0.1 M Tris-HCl, pH 7.6 [35].

Hsp70 Quantification by ELISA

One hundred µl of MA3-006 antibody, diluted 1∶5000 in phosphate-buffered saline (PBS) was placed in each well of a 96-well round-bottom polystyrene plate (Nunc-Immunoplate Maxisorp, Denmark) and incubated 1 h at room temperature. The antibody was removed and the plates rinsed 3 times with PBS. One hundred µl blocking buffer (PBS containing 0.2% Tween-20 and 5% bovine serum albumin) was added to each well followed by incubation for 1 h at room temperature. The blocking buffer was decanted and the wells rinsed 3 times with PBS. One hundred µl of protein extract from L. vannamei diluted 10 times in PBS was added to each well and incubated 1 h at room temperature. The protein extracts were decanted and the wells rinsed 3 times with PBS prior to 1 h incubation at room temperature in 100 µl MA3-006 antibody diluted 1∶5000 in PBS. The antibody was discarded and the wells washed 3 times with PBS. One hundred µl of HRP conjugated goat anti-mouse IgG antibody (Affinity BioReagents Inc.) diluted 1∶5000 in PBS was added to the wells and incubated 1 h at room temperature. The wells were washed 3 times with PBS and incubated 30 min with 100 µl Tetramethylbenzidine (TMB) solution at room temperature. One hundred µl 1N H2SO4 was added to each well and after incubation for 30 min at room temperature, color intensity was determined at 450 nm in a microplate reader (Thermo Electron, USA). A standard curve, constructed with human Hsp70 recombinant protein (Sigma-Aldrich, USA) was used to convert sample absorbance to Hsp70 content with values expressed as human Hsp70 equivalent. All experiments were done in duplicate.

Vibrio Culture

V. harveyi was grown at 28°C on Marine Agar 2216 (Difco Laboratories, Detroit, MI). Colonies were transferred individually to Marine Broth 2216 (Difco Laboratories) and grown to stationary phase by incubation overnight with constant shaking at 28°C. Bacteria were harvested by centrifugation at 1800×g for 10 min at 28°C, the supernatant removed and pellets suspended in filtered autoclaved sea water. Cell density was determined spectrophotometrically at 550 nm and the number of bacteria was calculated according to the McFarland standard (BioMerieux, Marcy L’Etoile, France) with an optical density of 1.0 corresponding to 1.2×109 cells/ml [35].

Development of a Vibrio Challenge Test System for L. vannamei

Thirty post-larvae reared at 28°C were incubated in separate aquaria containing 1L of filtered seawater with 1×101, 1×103, 1×105 and 1×107 V. harveyi/ml. Survival was determined 24, 36, 48 and 96 h after challenge by counting swimming animals. Each treatment was performed in triplicate and the survival percentage calculated as Nt×100/No where Nt and No represent the final and initial number of post-larvae, respectively [35]. The lowest number of bacteria causing more than 50% mortality after 48 h was used for challenge tests. The experiments were repeated once.

Cross-protection Experiment

Thirty post-larvae subjected to a NLHS from 28°C to 30°C, 32°C, 34°C, 36°C and 38°C, with a recovery period of 8 h, were challenged with 1.0×107 V. harveyi/ml and their survival was determined after 24, 48 and 72 h. following methods just described. Moribund shrimp were counted as dead. Treatments were performed in triplicate and the experiments were repeated once.

Results

Quantification of mRNAs Encoding Immune-related Proteins after NLHS

When compared to non-heated post-larvae the mRNAs encoding proPO and hemocyanin increased significantly after NLHS with the former augmented approximately 10.0, 9.3 and 7.9-fold and the latter 15.0, 5.6 and 2.6-fold at 34°C, 36°C and 38°C respectively (Fig. 1). In both cases, the amounts of mRNA peaked at 34°C and declined at 36°C and 38°C. Peroxinectin and crustin mRNAs were unchanged by NLHS whereas penaeidin mRNA was reduced significantly (Fig. 1).

Figure 1

Quantification of mRNA encoding shrimp immune-related proteins following NLHS.

Post-larvae were exposed to 30 min heat shock from 28°C to 30°C, 32°C, 34°C, 36°C and 38°C, then transferred to 28°C for 8 h. mRNAs encoding immune related proteins were quantified by RT-qPCR with beta-actin as reference. The error bars represent SD from 3 replicates. proPO, prophenoloxidase; He, hemocyanin; Pe, peroxinectin; Crus, crustin; Pen, penaedin; HS, heat shock. Asterisks denote statistically significant differences between values obtained for control and heat shocked post-larvae (P<0.05). The figure is a representation from two separate experiments.

Hsp70 mRNA and Protein Increased after NLHS

Thirty min NLHS from 28°C to 36°C and 38°C followed by recovery for 8 h increased Hsp70 mRNA approximately 1.4 and 2.1-fold, respectively (Fig. 2). Conversely, heating at 30°C and 32°C did not add to Hsp70 mRNA.

Figure 2

NLHS increased shrimp Hsp70 mRNA.

Post-larvae were exposed to 30 min heat shock from 28°C to 30°C, 32°C, 34°C, 36°C and 38°C, then transferred to 28°C for 8 h. Hsp70 mRNA was quantified by RT-qPCR, with beta-actin as reference. Bars represent the fold difference of Hsp70 mRNA with comparison to the non-heated control. The error bars represent the SD from 3 replicates. Asterisks denote statistically significant differences between values obtained for control and heat shocked post-larvae (P<0.05). The figure is a representation from two separate experiments.

The protein extracts prepared from heated and non-heated shrimp were similar when resolved in SDS polyacrylamide gels and stained with Coomassie Blue (Fig. 3A). Immunoprobing of western blots revealed a single polypeptide of approximately 70 kDa which was boosted in amount by NLHS at 34°C and 38°C for 30 min (Fig. 3B). When compared to non-heated animals quantification by ELISA revealed that Hsp70 increased 2.5, 2.8 and 2.6-fold at the temperatures just mentioned (Fig. 4).

Figure 3

NLHS increased Hsp70 in L. vannamei post-larvae.

Protein extracts were resolved by electrophoresis in SDS polyacrylamide gels and either stained with Coomassie Biosafe (A) or blotted to polyvinylidene fluoride membranes and incubated with antibody to Hsp70 (B). Approximately 50 µg of protein was loaded in each lane. 28, non-heat shocked post-larvae heat shock at 30°C, 32°C, 34°C, 36°C and 38°C was for 30 min with recovery at 28°C for 8 h H-Hsp70: Human Hsp70 recombinant protein M: molecular mass standards in kDa. The figure is a representation from two separate experiments.

Figure 4

NLHS enhanced Hsp70 production in L. vannamei.

Post-larvae were exposed to 30 min heat shock from 28°C to 30°C, 32°C, 34°C, 36°C and 38°C, then transferred to 28°C for 8 h. Quantification of Hsp70 was by ELISA. A standard curve, constructed with Human Hsp70 recombinant protein was used to convert ELISA readings obtained with shrimp tissue protein extracts to Hsp70 content. Bars represent the fold difference of Hsp70 quantity in comparison to a non-heated control. The error bars represent the SD from 3 replicates. Asterisks denote statistically significant differences between values obtained for control and heat shocked post-larvae (P<0.05). The figure is a representation from two separate experiments.

Heat Shock had no Effect on Vibrio Tolerance

More than 50% mortality of L. vannamei post-larvae was caused by 1×107 V. harveyi/ml in 48 h (Table 2) and these conditions were chosen for challenge testing. NLHS for 30 min at various temperatures followed by recovery for 8 h had no effect on the survival of L. vannamei post-larvae during V. harveyi challenge, with the number of surviving heat shocked animals not significantly different from non-heated animals (P>0.05) (Table 3).

Table 2

Survival (%) of L. vannamei post-larvae after 24, 48, 72 and 96 h challenges with 1×101, 1×103, 1×105 and 1×107 V. harveyi/mL.

Treatment	Dose (Bacteria/ml)	Survival (%)
		24 h	48 h	72 h	96 h
Control	0	97±2b	86±2c	73±3c	61±5b
V. harveyi	1×101	83±3a	66±2b	55±5b	33±3a
	1×103	82±2a	67±7b	47±6b	32±4a
	1×105	80±3a	60±7b	48±4b	31±4a
	1×107	80±3a	41±5a	32±5a	26±2a

The standard deviation is added (mean±SD) for each value. All treatments were done in triplicate. Values in a single column for each experiment showing the same superscript letter are not significantly different (P>0.05).

Table 3

Average survival (%) of heat shocked L. vannamei post-larvae after challenge for 24, 48 and 72 h with 1×107 V. harveyi/ml.

NLHS	Survival (%)
	24 h	48 h	72 h
Control-28°C	66±2a	37±3a	23±3a
30°C	59±8a	38±5a	23±3a
32°C	58±3a	38±4a	24±2a
34°C	59±5a	38±4a	22±2a
36°C	63±3a	47±3a	28±2a
38°C	67±7a	38±4a	29±4a

The standard deviation (mean±SD) is given for each value. All treatments were performed in triplicate. Values in a single column showing the same superscript letter are not significantly different (P>0.05).

Discussion

A 30 min NLHS significantly increased the amount of proPO and hemocyanin mRNA in L. vannamei post-larvae, in line with the observation that the shrimp immune response is influenced by temperature [5]. In contrast to the results shown here with L. vannamei, proPO and hemocyanin mRNA in P. monodon decrease significantly after 24 h heat shock [36]. The contrasting syntheses of proPO and hemocyanin mRNAs between these species may be due to the intensity of heat shock and the shrimp stages employed in the experiments.

The amount of peroxinectin mRNA in L. vannamei post-larvae was unchanged by NLHS, an observation similar to those described for adult L. vannamei. As one example, heating from 26°C to 34°C failed to induce peroxinectin production in adult L. vannamei within 24 h but a significant reduction occurred 2 days after heat shock, indicating that hyperthermic stress results in the loss of this antimicrobial peptide during prolonged post-stress recovery [37]. High levels of peroxinectin occur naturally in early larval stages of shrimp [38] and reduction of this immune protein may increase risk upon exposure to invading pathogens because the primary functions of peroxinectin are to regulate granule exocytosis [8], promote encapsulation [39] and mediate non-self recognition during microbial attack [40], [41].

NLHS did not alter crustin mRNA in L. vannamei post-larvae, this differing from observations made for other crustaceans encountering hyperthermic stress. As a case in point, transcription of the crustinPm5 gene is greatly increased in P. monodon at 35°C whereas the level was unchanged in shrimp maintained at 30°C [31]. Carcinin, a crustin-type antimicrobial protein of Carcinus maenas was up-regulated 2.9 fold when crabs reared at 10°C were transferred to 20°C for 2 weeks [42]. The levels of induced crustin depend on the intensity and duration of heat shock, and induction may be species-specific, especially when considering the range of physiological diversity across crustaceans. In L. vannamei, crustin occurs naturally in hemocytes, lymphoid organ, gill, hepatopancreas, stomach, midgut and the neural ganglion [43] and it protects against fungi [44] and several Gram positive and negative bacteria, including Staphylococcus aureus, Streptococcus iniae, Escherichia coli 363 and V. harveyi [45], [46].

Penaeidin mRNA was down-regulated in L. vannamei post-larvae after NLHS. The appearance of penaeidin following microbial challenge has been described but this study is the first to report the status of penaeidin after heat perturbation. Penaeidin is expressed in the hematopoietic nodules and testis of L. vannamei, but not in the brain, hemocyte, lymphoid organ, gill, hepatopancreas, stomach, midgut and neural ganglion after heat shock [45], [47]. Penaeidins are potent immune proteins, acting against Gram positive bacteria and filamentous fungi [17], [48]. Penaeidins are highly up-regulated after V. harveyi challenge, indicating these antimicrobial peptides have immunomodulatory roles against this pathogen [49]. The study described herein illustrates that protection of L. vannamei post-larvae against V. harveyi is not enhanced following proPO and hemocyanin mRNA accumulation. However, it is necessary to quantify the corresponding immune proteins to definitively determine their role in the immune status of post-larvae and tolerance to bacterial infection.

NLHS induced Hsp70 production in L. vannamei post-larvae, with RT-qPCR and ELISA revealing increases in mRNA and protein respectively. In juvenile L. vannamei 6 h heat shock from 15°C to 28°C enhanced Hsp70 mRNA accumulation 2-fold as compared to non-heated controls [50], indicating that Hsp70 synthesis across L. vannamei life stages is promoted by heat. Hyperthermic stress increases Hsp70 accretion in shrimp other than L. vannamei with 90 min heat shock from 28°C to 35°C up-regulating Hsp70 mRNA in juveniles of P. monodon 24-fold [51]. In another example, 30 min transfer from 28°C to 37°C with recovery at 28°C for 6 h enhanced Hsp70 build-up in larvae and adults of the brine shrimp Artemia 2 to 3-fold more than non-heated controls [2], [34]. These studies demonstrate that an acute hyperthermic stress triggers Hsp70 accumulation and protects shrimp against abiotic and biotic stresses.

A 30 min NLHS enhanced Artemia survival 2-fold against pathogenic V. campbellii challenge. In another example, NLHS increased P. monodon tolerance to Gill associated virus (GAV) [3]. In both studies, augmentation of survival following microbial challenge correlated with Hsp70 accumulation. Reduction of bacterial and viral load in hosts suggests a role for Hsp70 in pathogen attenuation [52]. NLHS however did not enhance L. vannamei tolerance against V. harveyi even though Hsp70 was significantly up regulated, indicating that protection is not afforded solely by endogenous Hsp70 accumulation as demonstrated in Artemia sp. [2] and P. monodon [3]. An increase in Hsp70 following NLHS fails to safeguard platyfish Xiphophorus maculates against Yersinia ruckeri infection, but protection is enhanced when NLHS is combined with injection of GroEL and DnaK, bacterial Hsps equivalent to Hsp60 and Hsp70 [53]. How endogenous and exogenous Hsps influence the disease tolerance of shrimp is unknown, although based on evidence for other crustaceans [54], [55], [56], immune stimulation is possible.

Elucidating associations between Hsps, the immune system and pathogen resistance in shrimp represents an intriguing challenge. It will be especially interesting to dissect this complex and highly integrated relationship in order to revisit questions regarding Hsp functions, and gain new insights into Hsp activity in commercially important aquaculture organisms such as L. vannamei.