Agrobacterium-mediated Transformation of the Winter Mushroom, Flammulina velutipes.

Flammulina velutipes was transformed efficiently by Agrobacterium-mediated transformation system. The transformation frequency was about 16% with the gill tissues of the fungal fruiting body. Southern hybridization and genetic analysis suggest that the introduced DNA was inserted onto different locations of the fungal genome, and inherited stably to the next generation via basidiospores. Transformation or gene tagging with Agrobacterium T-DNA based vector should be useful for wide ranges of genetic or molecular biological studies of the mushroom.

Winter mushroom, Flammulina velutipes is widely cultivated in Japan (Magae et al., 2005) and Korea (Yoo et al., 2005). This mushroom has been studied not only for practical application but also for basic research because it has been used as a model organism of fungal graviresponse (Kern et al., 1997; Moore and Stockus, 1998). To solve many biological questions, molecular techniques have been used. Among the techniques, transformation and gene tagging are essential tools for the studies of molecular genetics, molecular breeding, and functional genomics in economically important mushrooms. Most of transformation methods for mushrooms were based on electroporation of protoplasts (Van de Rhee et al., 1996), treatment with CaCl2 and polyethylene glycol (Kim et al., 2003; Ogawa et al., 1998), or restriction enzyme-mediated integration (REMI, Joh et al., 2003; Hirano et al., 2000; Irie et al., 2003). Agrobacterium-mediated transformation (AMT) has some advantages over the other methods. One of them is that it does not need to prepare the protoplasts. Since it had been reported that T-DNA from Agrobacterium tumefaciens could transform Saccharomyces cerevisiae (Bundock et al., 1995) and some filamentous fungi (de Groot et al., 1998), Agrobacterium-mediated transformation system was developed for many important fungi including Agaricus bisporus (Rhee, 1996; Chen et al., 2000; Mikosch et al., 2001). In this study, we transformed economically important mushroom, Flammulina velutipes by AMT which is the first report in F. velutipes.

Transformation of F. velutipes was carried out with the Agrobacterium tumefaciens AGL-1 strain containing pBGgHg (Chen et al., 2000). The plasmid has hygromycin B resistance gene (hph, hygromycin B phosphotranferase) as a selection marker with the gpd (glyceraldehydes-3-phosphate dehydrogenase) promoter from A. bisporus and the CaMV 35S terminator. The Agrobacterium was grown in minimal medium (MM salts-K2HPO4 2.05 g, KH2PO4 1.45 g, NaCl 0.15 g, MgSO4·7H2O 0.5 g, CaCl2·6H2O 0.1 g, FeSO4·7H2O 2.5 mg, (NH4)2SO4 0.5 g, and 2 g per liter; Hooykaas et al., 1979) having kanamycin at 50 µg/ml for 2 days at 25 using a rotary shaker set with 200 rpm. The culture was diluted to an optical density of 0.15 at 600 nm in the induction medium (MM salts containing 40 mM MES pH 5.3, 10 mM glucose, 0.5% glycerol, and 200 µM acetosyringone; Bundock et al., 1995), and further cultured for 6 hr. The gill tissues of Flammulina velutipes fruiting body were aseptically excised and sectioned into 2 to 3-mm square pieces. The tissue pieces were vacuum infiltrated for 10 minutes with the suspension of the bacteria grown in induction medium, and was transferred to co-cultivation agar medium (induction medium containing 5 mM glucose instead of 10 mM glucose). After incubation on the co-cultivation agar for 3 days at 25℃~28℃, the tissue pieces were transferred to selection agar medium (malt extract agar containing 50 µg/ml hygromycin, 200 µM cefotaxime and 100 µg/ml moxalactum). The mycelium grown from the gill tissue piece on the selection agar medium was transferred to new selection agar medium, and finally to malt extract agar medium containing 50 µg/ml hygromycin.

The hygromycin resistant transformants were cultured in potato dextrose broth (Becton, Dickinson & Co., Sparks, MD, USA) for 30~45 days, and mycelial mats were harvested from the cultures and freeze-dried. Total DNA of the freeze dried mycelium was isolated with a Genomic DNA Isolation Kit (NucleoGen, Siheung, Gyeonggi, Korea) or with the method described by Ishii et al. (2001). PCR was conducted using primers, gpd-FH (5'GAAGAAGCTTTAAGAGGTCCGC3') and hph-R (5'GGCGACCTCGTATTGGGAATC3') (Chen et al., 2000).

For Southern hybridization analysis, 10 µg of total DNA was restricted with SacI, separated on a 0.7% agarose gel, and transferred to a nylon membrane by capillary blotting. Hybridization and detection were carried out with Dig High Prime DNA Labelling and Detection Kit II (Roche Diagnostics GmbH, Manneheim, Germany). The DNA amplified by PCR with gpd-FH and hph-R was used as a probe. Fruiting body of hygromycin resistant transformants (T0 generation) was obtained by conventional cultivation method of winter mushroom. Single spore cultures (haploid, T1 generation) were obtained from the T0 fruiting body and maintained on PDA. Hygromycin resistance of the T1 single spore culture was determined on MEA containing hygromycin (50 µg/ml).

It was observed that some hypha grew on the selection agar out of the sixteen gill tissues among 100 gill tissues treated with the A. tumefaciens AGL-1. PCR with the primers specific for hygromycin resistance gene amplified the expected size of DNA from all 16 hygromycin resistant transformants, but it did not form the hygromycin sensitive transformants (Fig. 1). Southern hybridization using the probe of the hygromycin resistance gene showed the hybridized band on all hygromycin resistant transformants (Fig. 3). These results suggest that the 16 hygromycin resistant transformants out of 100 tissues were transformed with the marker, hygromycin resistant gene from A. tumefaciens AGL-1. Transformation frequency, 16%, is comparable to transformation frequency of Agaricus bisporus in Chen et al's study (Chen et al., 2000) in which the gill tissue of A. bisporus was used for transformation and the frequency was 30~40%. The sizes of the hybridized bands detected by Southern hybridization were different one another, which suggests the marker genes were inserted onto different locations of the F. velutipes genome. Kue et al. (2004) showed the hygromycin resistant marker gene inserted once in different locations of F. velutipes genome by non-homologous recombination in their transformation study by electroporation of basiospores.

Fig. 1

PCR analysis of DNA isolated from the hygromycin resistant transformants (T0) of F. velutipes. PCR amplification was carried out using primers, gpd-FH and hph-R, defining a 970 bp sequence spanning the gpd promoter and the hph gene. Lanes 2~3 for DNA from negative control and lane 4 for pBGgHg as a positive control and lanes 5~20 for DNA from 1~16 hygromycin resistant transformants.

Fig. 3

Southern blot hybridization analysis of F. velutipes transformants. Genomic DNA from the transformants (T0) was digested with SacI and probed with the hph gene. Lane: 1 hygromycin sensitive strain as negative control, lanes 2~17: hygromycin resistant transformants, and lane 18: hph gene probe.

The 100 T1 generation single spore cultures from each 16 hygromycin resistant transformants were segregated in their response to hyg B with the ratio of 1 resistance and 1 sensitive except (Table 1). Hygromycin resistant gene specific DNA was amplified only in hyg T1 clones (Fig. 2). The Southern hybridization also showed the hybridized band only in the hyg T1 clones (data not shown). These results indicate that the marker gene was inserted once and the gene was maintained stably during meiosis and inherited to the next generation via basidiospore. This is the first result showing the transformed foreign gene inherited to the next generation through meiosis in F. velutipes. Kue et al. (2004) confirmed the marker gene that is the same gene as used in this study maintained stably during mitotic cell division for 3 months in mycelium.

Table 1

Segregation ratio of the hygromycin resistant gene in T1 generation single spore cultures

*Indicates significantly different (0.05 < P < 0.025).

Fig. 2

PCR analysis of DNA isolated from the single spore cultures (T1) from the hygromycin resistant transformants (T0) of F. velutipes. PCR amplification was carried out using primers, gpd-FH and hph-R, defining a 970 bp sequence spanning the gpd promoter and the hph gene. Lanes 2~7 for DNA from hygromycin sensitive single spore cultures and lanes 8~13 for DNA from hygromycin resistant single spore cultures.

Transformation of F. velutipes by AMT showed in this study is easy to carry out with moderate efficiency and the marker gene was inserted once in the fungal genome randomly and inherited to the next generation through meiosis. This AMT method should be usefully applied for the molecular genetic analysis, molecular breeding, and biotechnological application of the economically important winter mushroom.