Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil.

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Brucellosis is an important disease of animals caused by bacterial species included in the genus Brucella, some being zoonotic. Brucella ovis is a non-zoonotic, stable rough species that produces a clinical or subclinical chronic disease of sheep characterized by testicular alterations and subsequent low fertility in rams and occasional abortions in ewes (7).

In Brazil, some attention has been given to ram epididymitis caused by B. ovis, particularly in the Southern states where the sheep industry is more developed (12). B. ovis was firstly isolated in Brazil in 1972 in the State of Rio Grande do Sul (3). More recent studies were conducted and showed that the infection is spread in some states of the country, with antibody prevalences ranging from five to 35% (5,6,9,10,11,14).

In the Northeast region of Brazil, where 58% of brazilian sheep are concentrated, B. ovis was never isolated. The aim of this study was to report the detection of B. ovis in sheep in Paraíba State by microbiological culture and polymerase chain reaction (PCR).

Eighty sheep (64 males and 16 females) slaughtered in the public slaughterhouse of Patos city (7º01´S, 37º16´W) were used during September 2005 to May 2006. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles and epidydimus or uterus were aseptically collected. Samples were stored on ice in a cooler during transport to the Federal University of Campina Grande (UFCG), Patos, Paraíba State, Brazil. Sera were separated after clotting, centrifuged, and stored in sterile cryotubes at -20º C until further analysis. For PCR analyses, testicle, epidydimus and uterus samples were also stored at -20º C.

Serological diagnosis of B. ovis infection was carried out using the agar gel immunodiffusion test (AGID) with lipopolysaccharides and proteins antigens from B. ovis, strain Reo 198 (Instituto de Tecnologia do Paraná – TECPAR, Curitiba, PR, Brazil). The Rose Bengal test (RBT) using B. abortus 1119-3 antigen (Instituto Biológico, São Paulo, SP, Brazil) was used for the detection of serum antibodies against smooth Brucella. The tests were performed according to the manufacturer’s instructions.

For the isolation of B. ovis testicle, epidydimus and uterus swab samples were cultured on enriched Brucella agar plates with an antibiotic mixture (4) and incubated at 37 ºC under aerobic conditions for seven days. B. ovis colonies were presumptively identified by morphological and biochemical characteristics (1).

For the PCR analysis, two samples were used (samples 1 and 2). Each sample consisted of a pool of testicle and epidydimus fragments from two males, and uterus fragment from one female, all tested positive for the presence of anti-B. ovis antibodies. Pools were crushed in a sterile mortar and pestle, and resuspended as 10% suspension (w/v) in ultrapure water (Milli-Q, Millipore Inc.). For the DNA extraction, the proteinase K protocol was used (13).

The PCR was performed using the primers directed to the 16S-23S rRNA interspace region of Brucella spp. (ITS66: ACATAGATCGCAGGCCAGTCA and ITS279: AGATACCGACGCAAACGCTAC) (8). ITS66 and ITS279 primers are specific to Brucella spp. and the expected size of the amplification product from Brucella is 214 bp. The amplification reaction mixture was prepared in a volume of 50 mL containing 200 µM of each deoxynucleoside tryphosphate, 50 mM KCl, 10 mM Tris–HCl (pH 9.0), 1.5 mM MgCl2, 0.5 mM of each primer, 1.5 U platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) and 5 mL of template DNA. The reaction was performed in a DNA thermal cycler (MJ Research PTC 200 DNA engine, Watertown, MA, USA) without mineral oil. Ultrapure water was used as negative control and B. ovis strain 63/290 as positive control. After an initial denaturation at 95 ºC for 2 min, the PCR profile was set as follows: 30 s of template denaturation at 95 ºC, 30 s of primer annealing at 62 ºC and 30 s of primer extension at 72 ºC, for a total of 40 cycles, with a final extension at 72 ºC for 5 min. The samples were analyzed by electrophoresis in a 2% agarose gel and then stained with ethidium bromide (0.5 mg/mL). The DNA bands were visualized under UV light.

Six animals (7.5%) tested positive for the presence of anti-B. ovis antibodies at AGID, with four males and two females. All animals were RBT negative. One AGID- positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicles, epidydimus and uterus samples from AGID positive animals (Fig. 1).

Figure 1

PCR for detection of Brucella spp. in pools of testicles, epidydimus and uterus. Eletrophoretic separation of the amplicon into 2% agarose gel is documented across lanes 1-14. Lane 1, 100 bp DNA ladder (Invitrogen, Carlsbad, CA, USA); lane 2, pure sample 1; lanes 3-5, sample 1 diluted 1:2, 1:3 and 1:4, respectively; lane 6, sample 2 diluted 1:2; lane 7, pure sample 2; lane 8 and 9, sample 2 diluted 1:3 and 1:4, respectively; lanes 10-12, TE buffer; lane 13, ultrapure water; lane 14, B. ovis strain 63/290.

In the Northeast region of Brazil, serological surveys for the B. ovis infection were carried out in several states. In Rio Grande do Norte State, Silva et al. (14) used AGID test and detected 35% of seropositive rams. In Pernambuco State, Coleto et al. (6) found 17.5% of positive ovine at AGID test. Clementino et al. (5), in Sertão and Borborema mesoregions of the Paraíba State, found the prevalence of seropositive rams of 5.57% (95% CI = 3.86%-7.97%). However, B. ovis was never isolated from ovine in the Northeast region of Brazil. This is the first report of isolation and detection of B. ovis DNA by PCR in this area, and indicates that preventive measures should be taken to control and prevent the infection.