Literature DB >> 24031344

Frequency of virulence genes in Escherichia coli strains isolated from piglets with diarrhea in the North Parana State, Brazil.

Marilda C Vidotto1, Natália C S de Lima, Juliana T T Fritzen, Júlio C de Freitas, Merson J Venâncio, Mario A Ono.   

Abstract

Identification of Escherichia coli causing porcine postweaning diarrhea requires knowledge regarding the prevalent pathotypes within a given region. A total of 100 Escherichia coli isolates from piglets with diarrhea in Londrina city, Parana State, South Brazil, were screened for the presence of genes for F4, F5, F6, F18, F41 fimbrial antigens by specific probes and for enterotoxins (STa, STb, LT and STx2e) by polymerase chain reaction (PCR). The results showed that 60% of the isolates were positive for one or more of the fimbrial antigens and 92% were positive at least for one of the virulence factors examined. Virulence factor genes detected were F4 (44%), F18 (38%), F5 (30%), F41 (32%), F6 (25%), LTp-I (71%), STa (40%), STb (47%) and STx2e (3%). Twenty four patterns of virulence factor according to the different virulence genes form were found and the most frequent virulence gene pattern was F4, F18, F41, STa, STb and LT. Most of the isolates that carried genes for adhesins also harboured genes for toxins.

Entities:  

Keywords:  porcine Escherichia coli; postweaning diarrhea; toxins; virulence genes

Year:  2009        PMID: 24031344      PMCID: PMC3768501          DOI: 10.1590/S1517-838220090001000035

Source DB:  PubMed          Journal:  Braz J Microbiol        ISSN: 1517-8382            Impact factor:   2.476


INTRODUCTION

Postweaning diarrhea (PWD) in pigs is a disease of considerable economic importance and is characterized by watery diarrhea, dehydration, loss of body weight and sometimes death of infected pigs (17,20). Enterotoxigenic E. coli (ETEC) is an important cause of PWD, and its pathogenicity involves adherence of the pathogen to the small intestine by means of specific adhesion factors (fimbriae) and production of one or several exotoxins responsible for the disease. ETEC produce heat-stable (STa or STb) and/ or heat-labile (LT) enterotoxins that cause secretion of fluid and electrolytes, and STx2 that interfere with protein synthesis (17). In ETEC strains, the fimbrial types F4 (K88) and F18 (F18ab, F18ac) are commonly found in pathogenic E. coli isolated from weaned pigs (4,18,25). There are also other fimbrial structures, such as F5 (K99), F6 (987P), F41, which are associated with porcine ETEC strains, but are more frequently associated with E. coli causing neonatal diarrhea (18,24). In Brazil, there is little information on the prevalence of virulence factors of porcine E. coli. Some studies with E. coli isolated from piglets with diarrhea have been showed different frequencies of the F4, F5, F6, F18 and F41 fímbriae and toxins in the São Paulo, Minas Gerais and Santa Catarina States (6,14,15). The objective of this study was to evaluate the presence and distribution of virulence genes associated with E. coli strains isolated from piglets with diarrhea in Paraná State, Brazil

MATERIAL AND METHODS

Bacterial strains

Three hundred Escherichia coli strains were isolated from 100 piglets with diarrhea (3 strains/piglets) from four farms in the region of Londrina, Parana State, South Brazil. Samples were collected with swabs and transported in Stuart modified medium at 4º C to the laboratory. The samples were streaked on sheep blood agar and Mac Conkey agar and kept at 37º C for 48 hours. Putative E. coli colonies were identified by morphology and biochemical characteristics, including indole production, citrate utilization, glucose and lactose fermentation, hydrogen sulfate production, and ß hemolysis. All isolates were stored at -20º C in Luria-Bertani (LB) broth to which 15% glycerol was added after growth, and they were tested for the presence of virulence factors. The following reference of E. coli strains were included S02 (F4, LT) (21), B41 (F5, F41, STa) (1), S33 (F6), S25 (F18) (positive wild type isolate by specific antibody), E. coli ATCC 43889 (STx2e) and HB 101 (3).

Polymerase chain reaction assay (PCR)

PCR was used to detect the toxin genes and to prepare the chemiluminescent digoxigenin-labelled probes for fimbrial genes. The base sequences for specific oligonucleotide primers used in this study and the predicted sizes of amplified products are shown in Table 1.
Table 1

Oligonucleotide sequences, annealing temperature and predicted size of amplification products for different virulence-associated genes.

Target GeneOligonucleotide sequences (5′ – 3′)Size fragment (bp)Annealing Temperatur (°C)Reference
F4GAA TCT GTC CGA GAA TAT CA GGT ACA GGT CTT AAT GG50553(2)
F5AAT ACT TGT TCA GGG AGA AA AAC TTT GTG GTT AAC TTC CT23050(2)
F6GTA ACT CCA CCG TTT GTA TC AAGTTACTGCCAGTCTATGC40953(2)
F18ATGCGTTTAAAATATATCTTG CTG TAT CTC GAA AAC AAT GG90050This study DQ995282
F41AGT ATC TGG TTC AGT GAT GG CCA CTA TAA GAG GTT GAA GC61253(18)
StaCAA CTG AAT CAC TTG ACT CTT TTA ATA ACA TCC AGC ACA GG15850(2)
StbTGC CTA TGC ATC TAC ACA AT CTC CAG CAG TAC CAT CTC TA11350(2)
LTp-IGGC GTT ACT ATC CTC TCT AT TGG TCT CGG TCA GAT ATG T27250(26)
Stx2eAAT AGT ATA GGG ACA GCG AT TCT GAC ATT CTG GTT GAC TC73350(2)
Oligonucleotide sequences, annealing temperature and predicted size of amplification products for different virulence-associated genes. Bacterial DNA to be amplified was released from whole organisms by boiling, and PCR was carried out in a total volume of 25 µl containing 5 µl of template DNA, 20 pmol of each primer, 200 µM of dNTPs, 1x PCR buffer and 1.5 U of Taq DNA polymerase. PCR amplifications consisted of 30 cycles at 94º C for 1 min, annealing temperature specific for each primer for 1 min (Table 1) and 72º C for 2 min in a Thermal Cycler (Gene Amp PCR System 9700/Perkin Elmer Corporation, Norwal CT, USA). The amplified DNA was visualized in 1.5% agarose gels stained with ethidium bromide. The 100-pb ladder (Promega, Madison, WI) was used as standard.

Detection of fimbrial and toxin genes by probe

Chemiluminescent digoxigenin (Boehringer Mannheim Biochemicals) labeled probes for fimbrial genes were prepared by PCR as described above using primers for each factor (Table 1). In order to promote colony hybridization, the colonies were transferred onto Whatman 541 filter paper, lysed, and the DNA was fixed as previously described (12). The filters were incubated for 1 h in the following prehybridization solution: 5 x SSC (1 x SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 0.1% SDS, 0.02% laurylsarcosine and blocking solution (Boehringer Mannheim Biochemicals). The probe was denaturated by boiling for 10 min and was added to the prehybridization mixture, which was incubated overnight at 63º C. The filters were washed twice in 2 x SSC plus 0.1% SDS for 15 min, and in 1 x SSC plus 0.1% SDS for 30 min at 37º C. The digoxigenin-labeled probe was identified by means of alkaline phosphatase (AP)-conjugated anti-digoxigenin and color development reagent CDP-star (Amersham, Biosciences, England, UK).

RESULTS

Of 100 isolates examined, ninety two (92%) were positive at least for one of the virulence factors, and 60% presented one or more fimbrial genes, using probes for specific adhesions. The fimbrial genes for F4, F5, F6, F18 and F41 were detected in 44%, 30%, 25%, 38% and 32%, respectively (Table 2). Forty isolates (40%) did not harbor any of the colonization factor genes investigated (Table 3).
Table 2

Frequency of individual virulence genes from E. coli strains isolated from piglets with diarrhea.

Virulence factorFrequency (%)
F4 (K88)44
F5 (K99)30
F6 (987P)25
F4132
F1838
STa40
STb47
LTp-I71
STx2e3
none8
Table 3

Distribution of genes for fimbrial and enterotoxins among E. coli strains isolated from diarrheic piglets.

AdhesinsNº of strainsSTaSTbLTSTa STbSTa LTSTb LTSTb STx2eSTa STb LTNone toxin
F4422
F18211
F511
F622
F41211
F4 + F533
F4+F1811
F4+F4111
F5 + F611
F5 + F1822
F6+F1822
F18, F4111
F4+F5+F63111
F4+F6+F18211
F4+F6+F41211
F4, F18, F4181115
F4+F6+F18211
F5+F6+F4111
F5+F18+F4122
F4+F5+F6+F1822
F4+F5+F6+F41211
F4+F5+F18+F416213
F4+F6+F18+F413111
F4+F5+F6+F18+F41514
None4013173628
Total1006928511133199
Frequency of individual virulence genes from E. coli strains isolated from piglets with diarrhea. Distribution of genes for fimbrial and enterotoxins among E. coli strains isolated from diarrheic piglets. PCR analysis detected the gene for LTp-I in 71 strains (71%), which was the most prevalent gene for toxins, while the genes for STa, STb, STx2e were found in 44%, 47% and 3% of the isolates (Table 2). Forty eight (48%) isolates harboured more than one enterotoxin gene, and the most prevalent combination was STa/STb/LT, which was detected in 19 isolates. Only nine isolates did not harbour any of the toxin genes investigated (Table 3). We found 24 types of virulence factor patterns according to the different virulence gene form (Table 3). The combination of most frequent virulence genes was F4, F18, F41, STa, STb and LT. Most of the isolates that carried genes for adhesions also harboured genes for toxins.

DISCUSSION

The presence of ETEC virulence factors, fimbriae and enterotoxins production is a common feature of isolates associated with diarrhoea during the pre-weaning and weaning periods (17). This study shows high prevalence (92%) of genes for fimbriae and enterotoxins in the E. coli isolates from diarrheic piglets in the Parana State, and the most prevalent association of these genes was F4+ F18+ F41+ STa+ STb+ and LT+. The frequency of virulence genes in E. coli isolates from diarrheic piglets in the Minas Gerais State was of 42% (14). Several studies have demonstrated variation in fimbriae frequencies, and this variation can be due to the different techniques utilized, number of isolates from each diarrhoeal pig and age of piglets. A study with E. coli isolated from newborn piglets with diarrhea of São Paulo State showed that F18ac was expressed, but not fimbriae F4, F5, F6 or F41 (15). However, the F4 fimbriae are common in ETEC from swine diarrhea, and the prevalence of F4-positive strains in various countries has ranged from 3.7% to 65%. In this work, we found (44%) of F4-positive isolates, in agreement with the high frequency (64.6%) for F4 presented by PCR in the isolates from US (27). A significant proportion (23.9%) of E. coli isolated from 2 to 4-week-old piglets with diarrhoea in the Slovak Republic carried the gene for F4 fimbriae (22). Harel et al. (1991) (11) found 23.4% F4-positive isolates in Québec, Canada. Frydendahl (2002) (9) detected 44% F4 gene in isolates of E. coli from PWD in Denmark. However, a lower prevalence (14.3%) of F4-positive E. coli strains was found in the Minas Gerais State, Brazil (14); (9.8%) of F4-positive E. coli strains was found in China by agglutination tests (4); 3.75% by PCR (5); and 4.3% in Korea (13). The fimbrial antigen F18 is one of the most important fimbriae associated with PWD (9,16,25). In this study we found the gene for F18 in 38% of E. coli strains examined, whereas 27.5% and 19% of F18-positive E. coli strains were found in the Santa Catarina and Minas Gerais States, respectively (6,14). Our findings are in accordance with those of other studies (5,9,23,27). Several studies in many countries have reported that infection with ETEC carrying the F5, F6 or F41 fimbriae is age-related, occurring in pigs less than 2 weeks of age (10, 17, 18). In this study we detected the genes for F5 (30%), F41 (32%) and F6 (25%), similarly these genes were found in 32%, 9.5% and 14.3% in the Minas Gerais State (14). Martins et al. (2000) (15) did not detect F5, F6 and F41 in E. coli isolates from newborn piglets with diarrhea in São Paulo State, but used the microhemagglutination assay and agglutination with specific antisera to detect fimbriae. The detection of F4, F5, F41 and especially F6 fimbriae can be difficult due to the fimbrial antigens expression in vitro. In other countries, the percentage of these fimbriae was low. Genes for the F5 (K99), F6 (987P) and F41 fimbriae were detected in 2%, 6% and 3.3% of the E. coli isolates, respectively, in Korea (13). The frequencies of genes for F5, F6 and F41 fimbriae were 0.9%, 5% and 0.9%, respectively, in the E. coli isolates from pigs with PWD in Slovakia (23). The prevalence of F6 fimbriae, in isolates of E. coli in China, was 15.6% (4). In this study, the results of the PCR analysis showed that E. coli strains isolated from pigs with diarrhoea possessed the genes for LT or/and ST (STa or/and STb) enterotoxins. The gene for LTp-I was the most prevalent (71%) and the STa and STb genes were found in 40% and 47% of isolates. Macedo et al. (2007) (14) found 33.3% and 40% for STa and STb. Frydendahl (2002) (9) also found high frequency of the LT gene (61.6%) among swine ETEC, but the gene for STb was the most prevalent (77.6%). Several studies demonstrated that isolates positive for STb were also positive for other toxins, and the most prevalent gene combination was LT-STb (9, 11). The presence of various toxins in ETEC can be explained by the presence of conjugative plasmids widely distributed among porcine ETEC strains. The ST genes, sta and stb, and a tetracycline resistance gene were located on a self conjugative 120-kb plasmid, called pTC (19). The occurrence of enterotoxins is associated with specific fimbriae in E. coli from pigs and several strains produced more than one fimbrial antigen (17). We found 24 types of virulence gene patterns (Table 3), and the F4+ F18+ F41+ STa+ STb+ and LT+ was the most frequent. The presence of various virulence genes together is explained by linkages of resistance and virulence genes on plasmids. Preliminary results in our laboratory confirm this hypothesis, the association of F4 (K88) with conjugative plasmids codifying resistance to tetracycline, chloranfenicol and ampicilin were detected in ETEC strains isolated from piglets with diarrhea in Parana, Brazil (21). Similarly, the E. coli isolates associated with PWD in China could be assigned into 20 different virulence factor patterns; F18ab+, F4+ and/or intimin+ ETEC and high-pathogenicity island (HPI)+ and/ or LEE+ E. coli are the dominant pathogens of PWD (5). The F4+ STa+ STb+ LT+ pathotype was most commonly identified in Ontario and Vietnam (2,7). This pathotype was also the most prevalent in neonatal and 1-3 week old pigs, while the F18+ STa+ STb+ LT+ were most prevalent in weaned pigs (8). The F4+ LT+ STb+, F4+ LT+ STb+ EAST1+ and F18+ STa+ STb+ STx2e+ pathotypes were the most prevalent in the US (27). In this study, only a small number of strains (3%) were stx2epositive, in contrast of strains isolated in the US that presented 17,4% (27) and of strains isolated in Minas Gerais State, Brazil that presented 21,4% (14). In conclusion, this study showed the frequency of virulence genes in E. coli strains isolated from piglets with diarrhea in the Londrina city, Parana State, South Brazil, and confirms the combination of various virulence genes in ETEC.
  22 in total

1.  Pathogenic characteristics of Escherichia coli strains isolated from newborn piglets with diarrhea in Brazil.

Authors:  M F Martins; N M Martinez-Rossi; A Ferreira; M Brocchi; T Yano; A F Castro; W D Silveira
Journal:  Vet Microbiol       Date:  2000-09-15       Impact factor: 3.293

2.  Genotypic prevalence of the fimbrial adhesins (F4, F5, F6, F41 and F18) and toxins (LT, STa, STb and STx2e) in Escherichia coli isolated from postweaning pigs with diarrhoea or oedema disease in Korea.

Authors:  D Kwon; C Choi; T Jung; H K Chung; J P Kim; S S Bae; W S Cho; J Kim; C Chae
Journal:  Vet Rec       Date:  2002-01-12       Impact factor: 2.695

3.  Distribution of virulence genes in Escherichia coli strains isolated from diarrhoeic piglets in the Slovak Republic.

Authors:  H Vu-Khac; E Holoda; E Pilipcinec
Journal:  J Vet Med B Infect Dis Vet Public Health       Date:  2004-09

4.  Colonization antigens of enterotoxigenic Escherichia coli strains isolated from piglets in Spain.

Authors:  J I Garabal; F Vázquez; J Blanco; M Blanco; E A González
Journal:  Vet Microbiol       Date:  1997-03       Impact factor: 3.293

5.  A complementation analysis of the restriction and modification of DNA in Escherichia coli.

Authors:  H W Boyer; D Roulland-Dussoix
Journal:  J Mol Biol       Date:  1969-05-14       Impact factor: 5.469

6.  Plasmid content and localisation of the STaI (STaP) gene in enterotoxigenic Escherichia coli with a non-radioactive polynucleotide gene probe.

Authors:  A Bertin
Journal:  J Med Microbiol       Date:  1992-08       Impact factor: 2.472

7.  Antimicrobial resistance and virulence genes of Escherichia coli isolates from swine in Ontario.

Authors:  Patrick Boerlin; Rebeccah Travis; Carlton L Gyles; Richard Reid-Smith; Nicol Janecko; Heather Lim; Vivian Nicholson; Scott A McEwen; Robert Friendship; Marie Archambault
Journal:  Appl Environ Microbiol       Date:  2005-11       Impact factor: 4.792

8.  Prevalence of serogroups and virulence factors of Escherichia coli strains isolated from pigs with postweaning diarrhoea in eastern China.

Authors:  Xiang Chen; Song Gao; Xinan Jiao; Xiu Fan Liu
Journal:  Vet Microbiol       Date:  2004-10-05       Impact factor: 3.293

9.  Prevalence of virulence genes in Escherichia coli strains recently isolated from young pigs with diarrhea in the US.

Authors:  Weiping Zhang; Mojun Zhao; Laura Ruesch; Abi Omot; David Francis
Journal:  Vet Microbiol       Date:  2007-02-23       Impact factor: 3.293

10.  Detection of genes for fimbrial antigens and enterotoxins associated with Escherichia coli serogroups isolated from pigs with diarrhea.

Authors:  J Harel; H Lapointe; A Fallara; L A Lortie; M Bigras-Poulin; S Larivière; J M Fairbrother
Journal:  J Clin Microbiol       Date:  1991-04       Impact factor: 5.948

View more
  8 in total

Review 1.  Resistance to ETEC F4/F18-mediated piglet diarrhoea: opening the gene black box.

Authors:  Rebeka Sinha; Nihar Ranjan Sahoo; Kush Shrivastava; Pushpendra Kumar; Salauddin Qureshi; Ujjwal Kumar De; Amit Kumar; Gandham Venkata Papa Pydi Siva Ravi Kumar; Bharat Bhushan
Journal:  Trop Anim Health Prod       Date:  2019-05-24       Impact factor: 1.559

2.  High prevalence of F4+ and F18+ Escherichia coli in Cuban piggeries as determined by serological survey.

Authors:  Pedro Yoelvys de la Fé Rodríguez; Annelies Coddens; Emanuele Del Fava; José Cortiñas Abrahantes; Ziv Shkedy; Luis O Maroto Martin; Eduardo Cruz Muñoz; Luc Duchateau; Eric Cox; Bruno Maria Goddeeris
Journal:  Trop Anim Health Prod       Date:  2011-01-14       Impact factor: 1.559

3.  Virulence profiles of enterotoxigenic, shiga toxin and enteroaggregative Escherichia coli in South African pigs.

Authors:  Ramadimetja Prescilla Mohlatlole; Evelyn Madoroba; Farai Catherine Muchadeyi; Michael Chimonyo; Arnold Tapera Kanengoni; Edgar Farai Dzomba
Journal:  Trop Anim Health Prod       Date:  2013-02-17       Impact factor: 1.559

4.  A tripartite fusion, FaeG-FedF-LT(192)A2:B, of enterotoxigenic Escherichia coli (ETEC) elicits antibodies that neutralize cholera toxin, inhibit adherence of K88 (F4) and F18 fimbriae, and protect pigs against K88ac/heat-labile toxin infection.

Authors:  Xiaosai Ruan; Mei Liu; Thomas A Casey; Weiping Zhang
Journal:  Clin Vaccine Immunol       Date:  2011-08-03

5.  Microbiome analysis reveals the abundance of bacterial pathogens in Rousettus leschenaultii guano.

Authors:  Sunil Banskar; Shrikant S Bhute; Mangesh V Suryavanshi; Sachin Punekar; Yogesh S Shouche
Journal:  Sci Rep       Date:  2016-11-15       Impact factor: 4.379

6.  Piglet colibacillosis diagnosis based on multiplex polymerase chain reaction and immunohistochemistry of paraffin-embedded tissues.

Authors:  Cíntia De Lorenzo; Caroline P de Andrade; Verônica S L Machado; Matheus V Bianchi; Veronica M Rolim; Raquel A S Cruz; David Driemeier
Journal:  J Vet Sci       Date:  2018-01-31       Impact factor: 1.672

7.  Prevalence of the paa gene (porcine attaching and effacing associated) in porcine enteropathogenic Escherichia coli (PEPEC) associated with postweaning diarrhea in south Brazil.

Authors:  Marilda C Vidotto; Elaine C T Florian; Mario A Ono
Journal:  Braz J Microbiol       Date:  2013-10-30       Impact factor: 2.476

Review 8.  Pig vaccination strategies based on enterotoxigenic Escherichia coli toxins.

Authors:  J Daniel Dubreuil
Journal:  Braz J Microbiol       Date:  2021-07-10       Impact factor: 2.476

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.