| Literature DB >> 23976967 |
Casey M Wright1, Michaela B Kirschner, Yuen Yee Cheng, Kenneth J O'Byrne, Steven G Gray, Karin Schelch, Mir Alireza Hoda, Sonja Klebe, Brian McCaughan, Nico van Zandwijk, Glen Reid.
Abstract
Malignant Pleural Mesothelioma (MPM) is an aggressive cancer that is often diagnosed at an advanced stage and is characterized by a long latency period (20-40 years between initial exposure and diagnosis) and prior exposure to asbestos. Currently accurate diagnosis of MPM is difficult due to the lack of sensitive biomarkers and despite minor improvements in treatment, median survival rates do not exceed 12 months. Accumulating evidence suggests that aberrant expression of long non-coding RNAs (lncRNAs) play an important functional role in cancer biology. LncRNAs are a class of recently discovered non-protein coding RNAs >200 nucleotides in length with a role in regulating transcription. Here we used NCode long noncoding microarrays to identify differentially expressed lncRNAs potentially involved in MPM pathogenesis. High priority candidate lncRNAs were selected on the basis of statistical (P<0.05) and biological significance (>3-fold difference). Expression levels of 9 candidate lncRNAs were technically validated using RT-qPCR, and biologically validated in three independent test sets: (1) 57 archived MPM tissues obtained from extrapleural pneumonectomy patients, (2) 15 cryopreserved MPM and 3 benign pleura, and (3) an extended panel of 10 MPM cell lines. RT-qPCR analysis demonstrated consistent up-regulation of these lncRNAs in independent datasets. ROC curve analysis showed that two candidates were able to separate benign pleura and MPM with high sensitivity and specificity, and were associated with nodal metastases and survival following induction chemotherapy. These results suggest that lncRNAs have potential to serve as biomarkers in MPM.Entities:
Mesh:
Substances:
Year: 2013 PMID: 23976967 PMCID: PMC3747266 DOI: 10.1371/journal.pone.0070940
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Subject Demographics of the two independent validation cohorts.
| COHORT 1# | COHORT 2* | ||
|
|
|
| |
|
| 14 | 3 | 57 |
|
| 60.1 (40–75) | 55.2 (39–68) | 58 (22–74) |
|
| |||
|
| 11 (78.5) | 3 (100) | 44 (77.2) |
|
| 3 (21.5) | 0 (0) | 13 (22.8) |
|
| |||
|
| 5 (35.7) | – | 43 (75.4) |
|
| 6 (42.9) | – | 14 (24.6) |
|
| 3 (21.4) | – | 0 (0) |
a*RNA extracted from FFPE for measurement of lncRNA expression; # RNA extracted from fresh-frozen tumour tissue, control tissue is benign pleura.
SYBR Green Primer Sequences used for microarray validation of the top 23 lncRNAs identified as being differentially expressed between MeT-5A mesothelial cells and MPM cell lines.
| NCode Probe ID | Target ID | Chromosomal Position (Hg18) | Forward Primer | Reverse Primer |
| IVGNh23506 | EF177379 | chr11:64949929-64949989 | actgtcgttgggatttagagtgt | cacaacagcatacccgagac |
| IVGNh32740 | AK130275 | chr2:113714740-113714800 | ggcagggttaagggaaaaag | cagctctggcagaaccactaa |
| IVGNh25923 | AF268386 | chr1:161022613-161022673 | acaggacacccgaatcaaaa | ttcaaataggctgggtatgagg |
| IVGNh35454 | NR_003584 | chr4:119420005-119420257 | acgatggatgatggaaacataa | tccccaactacgataagtcca |
| IVGNh12568 | AK129685 | chr19:13810366-13810426 | tttgtgaaacgggcagtct | cccagcagtgcaacattaaa |
| IVGNh16972 | BC031859 | chr16:4551527-4551587 | tgctttttagaagccttcatcc | ggatgggcagataccagga |
| IVGNh30904 | AX746718 | chr17:55867220-55867280 | aatgcaatagaaaaagaaaaactcg | gggacaaccgaagaaagttg |
| IVGNh38714 | AK054908 | chr9:138740661-138741350 | ctggacgtctgctcactgg | agtccatcacaggcgaagtc |
| IVGNh37463 | BX648695 | chr7:124447674-124508032 | agctttgtctcgtggagtctg | tgtgtaacaagttgcattaaaatcct |
| IVGNh13194 | AK130977 | chr20:34612610-34612670 | tcagtcccaaacacattctcac | atgggtggccagactgag |
| IVGNh23633 | G30815 | chr7:30435183-30435243 | gcctgattccatattctgtgc | cccaatgacggtagatgagg |
| IVGNh01065 | AF056184 | chr4:49207176-49207237 | tacgctgcacaactggaagt | ccgttgaaggactcaaacaga |
| IVGNh11100 | AK126075 | chr18:41272277-41281247 | caatcacttgagtgaacttgagagt | gtgctggacacccagtcag |
| IVGNh33458 | AX746738 | chr20:30702313-30702509 | cctttacaaaaactggaatgctg | ctcgctgagcctttgagg |
| IVGNh21169 | BX648304 | chr9:130706223-130706283 | caagttttaaatgcctgtgtcaa | agaaaggtggcccatcatc |
| IVGNh12928 | AK130470 | chr9:14215472-14215532 | gcacaagctcaatcattgct | tgcagtgagcccagatcc |
| IVGNh11385 | AK126582 | chr19:63770592-63770652 | cagctctgagcaggtagatgtg | gagtggggttcccctatgtc |
| IVGNh08061 | AK094765 | chr21:33318726-33319167 | agtattttcagtgtcgtctttgtga | cggggaagagattagggact |
| IVGNh24779 | U17623 | chr21:38693604-38693665 | catgggggattgagttcct | ggaaccacttctagcaatacagg |
| IVGNh29716 | BC121819 | chr15:72560296-72560492 | ctcaagtgccgccaaact | agccatctgtgtccatagca |
| IVGNh17420 | BC035363 | chr8:144866936-144867206 | ccataactgcactgccacac | caaggaggcgtgtcctca |
| IVGNh17438 | BC035497 | chr1:45543009-45543069 | tgcagtctctctctttgtgacc | gctctgacctggcactctgt |
| IVGNh09032 | AK097452 | chr15:78513886-78515514 | ctcgtaagatgttgagacttcacc | tgacaaagccagagaagagaga |
Figure 1RT-qPCR validation reveals significant lncRNA expression differences in MPM cell lines and fresh-frozen tissue.
Levels of lncRNA expression were normalised to 18S and relative expression levels compared to the average level in the control samples for MPM tissues and MeT-5A for cell lines using the 2−ΔΔCq method. (a) Unsupervised cluster analysis of the top 44 lncRNAs found to be differentially expressed between MeT-5A and MPM (H226, H28, MSTO, MM05) cell lines using NCode Long Noncoding RNA microarrays. All cell lines were profiled in duplicate. Red = regions over-expressed, Blue = regions under-expressed. (b) Nine candidate lncRNAs were technically validated in MPM cell lines using RT-qPCR. For RT-qPCR, lncRNA expression levels were normalised to 18S and are expressed relative to MeT-5A. (c) NR_003548 and BX648695 were significantly elevated in MPM tissues compared to benign pleura. Turkey box plots have median values represented by the line within the boxes, and the 25th and 75th percentiles represented by the upper and lower lines of the box. (d) 7 candidate lncRNAs were biologically validated in an extended panel of 10MPM cell lines. All candidates demonstrated consistent up-regulation of expression. MPM – Malignant Pleural Mesothelioma, lncRNA – long noncoding RNA, Ctrl – Benign Pleura, * statistically significant at P<0.05 (two-tailed t-test).
List of significantly differentially expressed long noncoding RNAs identified from NCode Microarray analysis using statistical (P<0.05) and biological criteria (>3-fold).
| MICROARRAY ANALYSIS | TECHNICAL VALIDATION – CELL LINES1 | BIOLOGICAL VALIDATION SET 1- DUBLIN TUMOUR SET | |||||||||
| ProbeName | Target ID | Subclassification | P-value | Direction of Expression | Absolute Fold Change | Absolute Fold-change # | Direction of Expression | P-value | Absolute Fold-change # | Direction of Expression | P-value |
| IVGNh01065 | AF056184 | Intergenic | 0.036 | up | 8.517 | ND | ND | ND | - | - | - |
| IVGNh25923 | AF268386 | Intergenic | 0.036 | up | 5.917 | 18.20 | up | 2.17 | up | ||
| IVGNh38714 | AK054908 | 3′UTR, Bidirectional | 0.022 | up | 3.470 | 9.66 | up | ND | ND | ||
| IVGNh08061 | AK094765 | Intergenic | 0.022 | up | 3.814 | 36.00 | down | - | - | - | |
| IVGNh09032 | AK097452 | Cis – antisense | 0.022 | up | 3.302 | ND | ND | ND | - | - | - |
| IVGNh11100 | AK126075 | Intergenic | 0.036 | up | 3.381 | ND | ND | ND | - | - | - |
| IVGNh11385 | AK126582 | Intergenic | 0.022 | up | 3.222 | 18.70 | down | - | - | - | |
| IVGNh12568 | AK129685 | Intergenic | 0.022 | up | 3.299 | 3.70 | up | ND | ND | ||
| IVGNh32740 | AK130275 | Bidirectional, cis-antisense | 0.036 | up | 8.704 | 17.50 | up | 3.3 | up | ||
| IVGNh12928 | AK130470 | Intergenic | 0.022 | up | 4.040 | ND | ND | ND | - | - | - |
| IVGNh13194 | AK130977 | Intergenic | 0.048 | down | 5.207 | 1.60 | down | ||||
| IVGNh30904 | AX746718 | Intergenic | 0.022 | down | 3.373 | 4.60 | down | ND | ND | ||
| IVGNh16127 | BC017840 | Intergenic | 0.022 | up | 7.729 | Record not found | - | - | - | ||
| IVGNh16972 | BC031859 | Cis – antisense | 0.022 | up | 3.831 | 2.41 | down | - | - | - | |
| IVGNh17420 | BC035363 | Bidirectional | 0.022 | down | 3.222 | - | - | - | |||
| IVGNh17438 | BC035497 | Intergenic | 0.022 | up | 3.126 | ND | ND | ND | - | - | - |
| IVGNh29716 | BC121819 | Intergenic, Bidirectional | 0.022 | up | 3.103 | 2.00 | down | - | - | - | |
| IVGNh21169 | BX648304 | Intergenic | 0.022 | up | 3.043 | - | - | - | |||
| IVGNh37463 | BX648695 | Intergenic, Bidirectional | 0.036 | up | 3.125 | 3.28 | up | 3.2 | up | ||
| IVGNh33458 | C20orf203 | Intergenic, | 0.022 | up | 3.380 | ||||||
| IVGNh30174 | CR617556 | Intergenic | 0.022 | down | 3.072 | Record Removed from NCBI | - | - | - | - | - |
| IVGNh23506 | EF177379 | 3′UTR | 0.022 | up | 3.408 | 8.45 | up | 2.8 | up | ||
| IVGNh23633 | G30815 | Intergenic | 0.022 | up | 4.350 | ND | ND | ND | - | - | - |
| IVGNh38595 | NR_002449 (SNORA65) | Intronic, Promoter associated | 0.022 | up | 5.453 | NP | - | - | - | - | - |
| IVGNh25978 | NR_002746 | Intergenic, Birectional | 0.022 | up | 3.589 | NP | - | - | - | - | - |
| IVGNh37000 | NR_003075.1 | Intergenic | 0.048 | up | 3.459 | NP | - | - | - | - | - |
| IVGNh35454 | NR_003584 | Intergenic | 0.022 | up | 5.322 | 71.30 | up | 5 | up | ||
| IVGNh29372 | SNORD116-12 | Intergenic | 0.048 | up | 3.212 | NP | - | - | - | - | - |
| IVGNh29374 | SNORD116-23 | Intergenic | 0.036 | up | 3.135 | NP | - | - | - | - | - |
| IVGNh24779 | U17623 | Intergenic | 0.022 | up | 3.291 | 6.15 | down | - | - | - | - |
| IVGNh24857 | U52835 | Intergenic | 0.022 | up | 3.544 | NP | - | - | - | - | - |
| IVGNh33847 | uc002zjh | Intergenic | 0.048 | down | 5.422 | NP | - | - | - | - | - |
#NP – no primers could be designed, ND – Not detected; – not followed up biologically due to lack of technical replication or original primers not designed, Fold changes for cell lines are expressed relative to MeT-5A.
Figure 2Class prediction profiling using the six biologically validated lncRNAs demonstrates high sensitivity in predicting MPM class in the NCode Microarray data (data not shown) and cryopreserved MPM and benign pleural tissue.
(a) Supervised cluster analysis shows that this predictor demonstrated overexpression (red areas) in MPM tumours compared to benign pleura. Roc curve analysis shows that (b) NR_003584 and (c) BX648695 can clearly separate benign tumour and MPM tissue with a high degree of accuracy. (d) AK054908 lncRNA expression is associated with hilar lymph node metastasis. (e) Higher EF177379 expression is associated with longer survival.