| Literature DB >> 23947441 |
Stephen E Hamby1, Pablo Reviriego, David N Cooper, Meena Upadhyaya, Nadia Chuzhanova.
Abstract
Neurofibromatosis type 1 (NF1), a neuroectodermal disorder, is caused by germline mutations in the NF1 gene. NF1 affects approximately 1/3,000 individuals worldwide, with about 50% of cases representing de novo mutations. Although the NF1 gene was identified in 1990, the underlying gene mutations still remain undetected in a small but obdurate minority of NF1 patients. We postulated that in these patients, hitherto undetected pathogenic mutations might occur in regulatory elements far upstream of the NF1 gene. In an attempt to identify such remotely acting regulatory elements, we reasoned that some of them might reside within DNA sequences that (1) have the potential to interact at distance with the NF1 gene and (2) lie within a histone H3K27ac-enriched region, a characteristic of active enhancers. Combining Hi-C data, obtained by means of the chromosome conformation capture technique, with data on the location and level of histone H3K27ac enrichment upstream of the NF1 gene, we predicted in silico the presence of two remotely acting regulatory regions, located, respectively, approximately 600 kb and approximately 42 kb upstream of the NF1 gene. These regions were then sequenced in 47 NF1 patients in whom no mutations had been found in either the NF1 or SPRED1 gene regions. Five patients were found to harbour DNA sequence variants in the distal H3K27ac-enriched region. Although these variants are of uncertain pathological significance and still remain to be functionally characterized, this approach promises to be of general utility for the detection of mutations underlying other inherited disorders that may be caused by mutations in remotely acting regulatory elements.Entities:
Mesh:
Substances:
Year: 2013 PMID: 23947441 PMCID: PMC3750751 DOI: 10.1186/1479-7364-7-18
Source DB: PubMed Journal: Hum Genomics ISSN: 1473-9542 Impact factor: 4.639
Figure 1Schematic of the occurrence and level of H3K27ac enrichment within interacting and NF1-containing DNA fragments. The level of enrichment is shown by the height of the curves (not to scale).
List of primers used to amplify and sequence DNA regions A (28,846,790–28,847,790) and B (29,378,421–29,379,750)
| chr17_28846841_1F | GCAAACATAGGAAGTGGCTTAC |
| chr17_28846841_2F | GAGGGGAGAAGTGTCTGTGTG |
| chr17_28846841_3F | TTTTCCCATTTAGAGATAAGTCAGTG |
| chr17_28846841_1R | TTCTGAGGTGCAGTCTTTTAGG |
| chr17_28846841_2R | GGTTACAACAAACAAGTGGAGAATG |
| chr17_28846841_3R | TACTTAGGGTGACAAGGCAAG |
| chr17_29387421_1F | TCTCCCTATGATGTCCAGGC |
| chr17_29387421_2F | TGCAGCAATAGGTGACTAAAACAC |
| chr17_29387421_3F | AGGTCCAAATGCAGGTGTG |
| chr17_29387421_4F | TCTGGAAGCTCTGCTTGG |
| chr17_29387421_1R | AATTGTTGGCATGAAAACTGG |
| chr17_29387421_2R | AGATGTGTACCCTGCGGAAG |
| chr17_29387421_3R | ACGAAGAGATGTGGTTTCCC |
| chr17_29387421_4R | AACATCCCCTTCCAATTTCC |