Literature DB >> 23936475

Isolation and characterization of the new mosaic filamentous phage VFJ Φ of Vibrio cholerae.

Qiuya Wang1, Biao Kan, Ruibai Wang.   

Abstract

Filamentous phages have distinguished roles in conferring many pathogenicity and survival related features to Gram-negative bacteria including the medically important Vibrio cholerae, which carries factors such as cholera toxin on phages. A novel filamentous phage, designated VFJΦ, was isolated in this study from an ampicillin and kanamycin-resistant O139 serogroup V. cholerae strain ICDC-4470. The genome of VFJΦ is 8555 nucleotides long, including 12 predicted open reading frames (ORFs), which are organized in a modular structure. VFJΦ was found to be a mosaic of two groups of V. cholerae phages. A large part of the genome is highly similar to that of the fs2 phage, and the remaining 700 bp is homologous to VEJ and VCYΦ. This 700 bp region gave VFJΦ several characteristics that are not found in fs2 and other filamentous phages. In its native host ICDC-4470 and newly-infected strain N16961, VFJΦ was found to exist as a plasmid but did not integrate into the host chromosome. It showed a relatively wide host range but did not infect the classical biotype O1 V. cholerae strains. After infection, the host strains exhibited obvious inhibition of both growth and flagellum formation and had acquired a low level of ampicillin resistance and a high level of kanamycin resistance. The antibiotic resistances were not directly conferred to the hosts by phage-encoded genes and were not related to penicillinase. The discovery of VFJΦ updates our understanding of filamentous phages as well as the evolution and classification of V. cholerae filamentous phage, and the study provides new information on the interaction between phages and their host bacteria.

Entities:  

Mesh:

Year:  2013        PMID: 23936475      PMCID: PMC3731265          DOI: 10.1371/journal.pone.0070934

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Inovirus, which members are commonly called filamentous bacteriophages, is a special phage genus. Unlike the closely related archetypal bacteriophages which have a typical head-tail morphology and linear double-stranded DNA and releases their progeny by lysing the host cell, filamentous bacteriophages are long, thin filaments which contain a circular single-stranded DNA genome and reproduce without killing the host and even take part in the host’s life cycle [1], [2]. Filamentous bacteriophages are widespread among Gram-negative bacteria and have two major types of life cycles, exclusive episomal replication and chromosomal integration combined with episomal replication, the latter of which has been observed for temperate phages [1]. Vibrio cholerae is the causative agent of cholera, a deadly diarrheal disease. Several filamentous phages have been previously identified in V. cholerae [3]–[8]. Based on the gene sequences of the replication protein, pIII-like receptor-binding coat proteins, and the Zot-like protein, these phages can be clustered into three distinct branches represented by the CTX phage, fs2 phage, and a group of five other phages, KSF-1, VGJ, VSK, VSKK, and fs1 [6]. Filamentous phages have provided many key phenotypes to their V. cholerae hosts, including virulence attributes. The most well-studied V. cholerae phage, CTXΦ, exists as a prophage in toxigenic V. cholerae and encodes the cholera toxin (CT); thus, it plays a crucial role in the pathogenicity of V. cholerae and its transfer between cells [9]–[13]. Phage 493 is conjectured to have played some role in the emergence of the O139 epidemic serotype of V. cholerae [5]. Phage fs2 can horizontally transfer its rstC gene to the classical strain and influence the assembly of fimbriae in an animal model [14]. Almost all of these phages have been proven to be integrated into the host chromosome [6], [9], [15], [16]. In this study, we isolated a novel plasmid, designated VFJΦ, from the V. cholerae O139 serogroup strain ICDC-4470 (Ampr, Kanr). The sequence of this plasmid was highly similar to that of phage fs2, except for a fragment of approximately 700 bp between the att site and the first open reading frame (ORF). Unlike the other V. cholerae phages mentioned above, VFJΦ is an episomally replicating phage and has distinct biological effects on its host. Thus, we present here the whole nucleotide sequence and genome structure of this new phage, as well as its host range and biological functions.

Materials and Methods

Strains, Plasmids, and Media

The bacterial strains and plasmids used in this study are presented in Table 1. All strains were grown in Luria-Bertani (LB) medium. Antibiotics were added, when necessary, at the following concentrations: ampicillin, 100 µg/ml, and kanamycin, 50 µg/ml. The presence of genes encoding CT, toxin-coregulated pili (TCP) and mannose-sensitive hemagglutinin (MSHA) pilus was ascertained using PCR assays (primers listed in Table 1).
Table 1

Bacterial strains, their susceptibilities to VFJΦ and primers used in this study.

Strains and primersDescriptionYear of isolationLocation (province) ctxAB tcpA mshA Susceptibility to VFJΦ
V. cholerae strains
ICDC-4470O1391997Fujian+++/
VC4360non-O1/non-O1392010Xinjiang+2.2×10−6
VC4361non-O1/non-O1392010Xinjiang+5×10−7
VC4362non-O1/non-O1392008Sichuan+++6.6×10−7
O395O1, classical1964India+++NDa
569BO1, classical1948India+++ND
1119O1, classical1964Dacca+++ND
16017O1, classicalIndia+++ND
N16961O1, El Tor, Inaba1971Bangladesh+++1.71×10−6
VC2507O1, El Tor, Inaba1995Shandong++1.5×10−5
VC2065O1, El Tor, Inaba1984Shannxi+++ND
VC1820O1, El Tor, Inaba2001Xinjiang+++3.3×10−7
VC3246O1, El Tor, Ogawa1977Shandong++4.3×10−6
VC4421O1, El Tor, Ogawa1993Liaoning++4×10−6
40–42O1, El Tor, Ogawa1977Zhejiang++ND
VC126O1, El Tor, Ogawa2004LiaoningND
VC1718O1, El Tor, Ogawa1999Chongqing+++1.5×10−7
VC1707O1, El Tor, Ogawa2004Liaoning+++1.3×10−5
VC4395O1391994Zhejiang+++6.7×10−6
VC3772O1391993Xinjiang+++6.7×10−7
VC4074O1391994Xinjiang+2.5×10−6
VC4425O1391994Beijing+ND
Other strains
94-9-3 V. mimicus 1994Jiangsu+2.5×10−6
38257 V. mimicus +2.3×10−6
SX-4 V. vulnificus 2009Shanxi++1×10−6
CMCP6 V. vulnificus +4.1×10−6
VP803 V. parahaemolyticus 2012Zhejiang+ND
VP355 V. parahaemolyticus 2011Shanghai+ND
Shanghai18-96 V. metschnikovii 1996Shanghai+1.8×10−6
Shanghai8-90 V. metschnikovii 1990Shanghai+ND
93-9-3 V. fluvialis 1993Jiangsu+ND
Shanghai13090 V. furnissii 1990Shanghai+ND
Primers
VFJ-U TAAAGCAGCGTTAATCGTTGCCTC This study
VFJ-L CACATCCAACCAACAACGGTAGAG This study
CT-F-RT CTCTTCCCTCCAAGCTCTATGC This study
CT-R-RT TGGGGTGCTTGATGAACAATTAC This study
ctxB-L GATGAAGGATACCCTGAGGATTGC This study
rtxA-U ATGGCGTGGTCAGACGTGGTTCAC This study
vc1465-L TGTCATGATGGTCGGTTATGATGC This study
vc1461-U AGAAAACCCCGAGTGAAAGCGTGC This study
CT-U CTCAGACGGGATTTGTTAGGCACG This study
CT-L TCTATCTCTGTAGCCCCTATTACG This study
TCP-U AAAACCGGTCAAGAGGG This study
TCP-L CAAAAGCTACTGTGAATGG This study
msha400F AAGATGAAATCGGGTTG This study
msha400R TATCTGGCGACGCTTGC This study
msha-1 AGCGAAAGCGAATAGTGG This study
msha-4 GTGGTTACCACCGCAAAGG This study

ND, no Kanr colonies detected.

ND, no Kanr colonies detected.

Isolation of Phage VFJ

ICDC-4470 was grown in 200 ml of LB broth in a 500 ml flask with shaking (240 rpm) at 37°C overnight. After centrifugation, the supernatants were filtered through 0.22-µm pore size filters (Millipore). Approximately 20 µl of the filtered supernatant was plated onto solid LB to check for sterility, and the remainder was used to precipitate the phage particles by the addition of NaCl and polyethylene glycol to final concentrations of 3 and 5% (wt/vol), respectively. The mixture was incubated on ice for 2 hours and centrifuged at 12,000×g for 20 min. The phage-containing pellet was resuspended in 1 ml of SM buffer (100 mM NaCl, 8 mM http://cshprotocols.cshlp.org/lookup/doi/10.1101/pdb.caut510MgSO4, 50 mM Tris-Cl, 0.002% gelatin).

DNA Isolation and Manipulation

V. cholerae total DNA and genomic DNA of phage particles were prepared using a phenol-chloroform extraction method as described by Sambrook et al. [17]. Plasmid DNA was prepared using a QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). DNA restriction and modification enzymes were used according to the manufacturer’s instructions (Takara, Dalian, China). Southern blot analysis was performed using random primer DIG DNA Labeling and Detection Kit (Roche Molecular Biochemicals, Mannheim, Germany) and the whole VFJ plasmid labeled as the specific digoxigenin probe. The entire sequence of the VFJΦ genome was assembled by combining data obtained from the sequencing of cloned HincII enzyme digested fragments of the VFJ plasmid in the pUC19 vector and from subsequent direct sequencing of the purified genomic DNA of the phage by primer walking.

Electron Microscopy

Purified phage particles and V. cholerae cells were negatively stained with 2% (wt/vol) uranyl acetate and mounted on freshly prepared Formvar grids, which were examined with a Tecnai G2 Spirit transmission electron microscope (FEI, Hillsboro, OR, USA.).

Infection Assay

The receptor strains were inoculated into 5 ml LB broth, and incubated statically at 30°C for 24 h. Subsequently, aliquots (400 µl) of pure phage VFJΦ were mixed with 100 µl cultures of the receptor strain. The mixture was incubated for 3 h in 5 ml fresh LB broth to allow for infection. After dilution, the infected cultures were plated onto solid LB plates with or without kanamycin, and the proportions of total cells infected were calculated (number of colonies growing on kanamycin plates divided by the total number of colonies recovered). All of the N16961 colonies and some of the other infected strains growing on kanamycin plates were also ascertained using PCR assays with VFJΦ primers.

Quantitative Real-time PCR (qRT-PCR)

DNA isolated from the phage particles were 10-fold serially diluted and used as the template. The primer pairs VFJ-U with VFJ-L and CT-F-RT with CT-R-RT were used for the amplification and comparative quantitation of the copy numbers of VFJΦ and CTXΦ. The reactions were performed using the SYBR premix Ex Taq™ (TaKaRa).

Motility Test

Wild-type and infected strains were incubated in 3 ml of LB broth at 37°C overnight. Thereafter, 100 µl of culture was transferred into 5 ml of fresh LB broth and incubated until an OD600 of 0.6 was reached. Approximately 10 µl of culture was directly pierced into 0.3% LB swim agar plates using a pipette tip and cultured at 37°C for 24 h, and then the diameters of each colony was measured.

Penicillinase Production Test

The procedure described by Gots and modified by Haight and Finland [18] was used to test for penicillinase production of the strains infected by VFJΦ in this study. Briefly, the sensitive Escherichia coli strain DH5α was inoculated on the entire Mueller-Hinton agar surface, and the susceptibility testing discs of ampicillin (10 µg) were placed onto the centre. The test VFJΦ-infected strains and positive control strain DH5α-pUC18 (AmpR) were streaked from the susceptibility testing disc to the edge of the plate. After 16 to 18 h of incubation, the resulting zones of inhibition were observed.

Nucleotide Sequence Accession Number

The sequence of the VFJΦ genome has been deposited in GenBank (accession number KC357596). The ORFs were predicted by using the GeneMark software [19].

Results

Nucleotide Sequence and Genomic Organization

The genomic DNA, designated VFJ and obtained as a plasmid from strain ICDC-4470, migrated to a position corresponding to a size of approximately 8kb on an agarose gel (Fig. 1D) and could be digested into 2 kb and 6 kb fragments by the restriction enzyme HincII, indicating that the DNA was double stranded. The complete genome was 8555 nucleotides long, with a G+C content of 44.23 mol %, which deviates from that of the host V. cholerae (47.49 mol %). The ATG site of orf 698 was taken as the zero coordinate of the sequence. The sequence between nt 1 and 7765, corresponding to 90.8% of the whole genome, was 97% identical to the genomic sequence of the V. cholerae phage fs2. The sequence from nt 7301 to 8179 was 81% similar to that of vibrio phages ND1 fs-1, VCY, and VGJ, whereas the last 375 nucleotides exhibited no homology with other known sequences (Fig. 1A).
Figure 1

Circular diagram of the VFJ genome and predicted ORFs (A).

The non-identical region is marked with a grey box. Sequence alignment of the attP regions of VFJΦ and fs2 Φ (accession no. NC_001956) and schematic representation of adjacent areas (B). Electron microscopy image of VFJΦ precipitated from the ICDC-4470 culture supernatant (C).

Circular diagram of the VFJ genome and predicted ORFs (A).

The non-identical region is marked with a grey box. Sequence alignment of the attP regions of VFJΦ and fs2 Φ (accession no. NC_001956) and schematic representation of adjacent areas (B). Electron microscopy image of VFJΦ precipitated from the ICDC-4470 culture supernatant (C). Overall, 12 ORFs were predicted in the VFJ genome by ORF prediction and BLAST searching (Fig. 1A, Table 2), among which 9 ORFs were located in the region observed to be highly homologous to the fs2 phage. Three phage structural proteins of VFJΦ, pV, pIX, and pVIII, encoded by orf 104, orf 38-2, and orf 73, respectively, were 100% similar to those of fs2. However, the homologies of pVII and pIV were both lower than 90%. Four residues at the C terminus of pVII, encoded by orf 38, were completely different from the equivalent residues in fs2. The pIV protein, corresponding to orf 442, was 58 amino acids shorter than that of fs2 due to the deletion of a single T nucleotide at 7301 and the presence of a stop codon at 7302. Usually, the structure of a virion filament tube consists of thousands of copies of pVIII in a helical arrangement. Two pairs of proteins, pVII-pIX and pIII-pVI, make up the two ends of the filament. The pVII-pIX proteins are incorporated into the virion at the initiation step of assembly and are the first to be extruded from the cell. The pIII and pVI proteins are required for the structural stability of the virion and for the termination of assembly. PIII also mediates the entry of the phage into the host cell. In addition, proteins pI, pIV and pXI form a transport complex spanning the inner and outer membranes. Thus, the differences in the structural proteins between VFJΦ and fs2 were observed primarily in the head cap and transporter.
Table 2

Putative ORFs in the VFJ phage genome and their homologs.

VFJPosition of transcriptionNucleotides(bp)Description* Homologous proteinMatchingbases (bp)Similarity of proteins (%)
orf 6981–20972097Replication proteinorf 716 of fs2205794
orf 1042150–2464315Gene V (ssDNA-binding protein)orf 104 of fs2305100
orf 382475–2591117Gene VII (minor coat protein)orf 39 of fs211182
orf 38–22588–2704117Gene IX protein (minor coat protein)orf 38 of fs2116100
orf 732729–2950222Gene VIII protein (major coat protein)orf 73 of fs2222100
orf 4993028–45271500Receptor bindingorf 498 of fs2148897
orf 1244534–4905372Gene VI proteinorf 116 of fs234991
orf 3614910–59951086Gene I protein (phage morphogenesis)orf 361 of fs2105097
orf 4425976–73041329Gene IV protein (phage morphogenesis)orf 500 of fs2131286
orf 1357719–7312408Putative transcription regulatorputative transcription regulator protein of VEJ phi32589
orf 1548107–7643465Regulatory proteinshypothetical protein of VCY-phi38479
orf 1138215–1342Translation regulationhypothetical protein VV1_0070 of V. vulnificus CMCP614857

Putative function based on that of the homologous protein.

Putative function based on that of the homologous protein. In the region that was non-homologous to fs2, three ORFs were identified. Orf 135 and orf 154 were found to be homologous to the regulatory proteins of two other V. cholerae filamentous phages, VEJ and VCYΦ, respectively. The last ORF, orf 113, was found to be homologous to a hypothetical protein of Vibrio vulnificus, CMCP6, which contains an ASCH domain [20] and may be associated with translational regulation. The promoter region of the first ORF, orf 698, also lies in this complete nonhomologous region, although the proteins produced by orf 698 of VFJ and fs2 have up to 94% similarity.

Purification and Determination of Copy Number of VFJΦ Relative to CTXΦ

We precipitated phage particles from cell-free culture supernatants of ICDC-4470 without any inducer and could detect filamentous phage structures by electron microscopy that were approximately 1.4 µm in length and 7 nm in width (Fig. 1). After full digestion with DNAse and RNAse, the nucleic acids were extracted from the purified phage particles and amplified with primers designed based on the VFJ plasmid. The extracted nucleic acid could not be cut by HincII but was sensitive to treatment with S1 nucleases, indicating that the nucleic acid was single-stranded DNA. All of the sequences of the PCR products amplified from the phage nucleic acid were the same as those amplified from the plasmid. Moreover, precipitates from the cell-free culture supernatants of ICDC-4470 could infect other strains, including DH5α and N16961, and VFJΦ could be re-extracted from these recipients as a plasmid. Based on these results, we concluded that the VFJ plasmid is the replication form of the phage. ICDC-4470 was positive for the ctx gene; therefore, it could also release CTXΦ. By using qRT-PCR, the relative copy numbers of VFJΦ and CTXΦ released by ICDC-4470 in the culture supernatant without any inducer were compared (Fig. 2). Large differences were observed in the copy numbers of the two phages, with the copy number of VFJΦ being approximately 105 times that of CTXΦ.
Figure 2

qRT-PCR graph showing relative copy numbers of VFJΦ and CTXΦ.

DNA was extracted from the pellets of cell-free cultures of ICDC-4470, 10-fold serially diluted, and amplified using VFJ- and CTX- specific primers.G.

qRT-PCR graph showing relative copy numbers of VFJΦ and CTXΦ.

DNA was extracted from the pellets of cell-free cultures of ICDC-4470, 10-fold serially diluted, and amplified using VFJ- and CTX- specific primers.G.

Integration of VFJΦ

The VFJ genome contains a 20 bp att-like sequence (attP) (Fig. 1B), with only four base pairs that differ with respect to fs2 in the central region. The attP sequence is located at the junction of the fragments that are identical and non-identical to the fs2 phage. To determine if VFJΦ integrates into the host chromosome, the genomic DNA of ICDC-4470 and that of NI6961-VFJ were extracted and blotted with a digoxigenin-labeled VFJ probe. The results indicated that the patterns for ICDC-4470, N16961-VFJ, and the plasmid control were exactly the same (Fig. 3). The theoretical pattern that should appear if VFJΦ had integrated into the host chromosome was not observed. Additionally, the RS regions flanked by the CTX core element (VC1456-VC1461, coding ctxAB, ace, zot and cep genes) are hot integration sites for V. cholerae phages, such as fs2. Using the primer pairs ctxB-Lwith rtxA-U and vc1465-L with vc1461-U, the two flanking regions were amplified and sequenced. However, there were still no signs that VFJΦ had integrated. Therefore, it can be concluded that under normal culture conditions, in its native host strain ICDC-4470 and newly infected strain N16961-VFJ, VFJΦ exists only in the form of a plasmid without chromosomal integration.
Figure 3

Southern hybridization analysis of the integration of the VFJ phage into host chromosomes.

Genomic DNA of ICDC-4470 and control VFJ plasmid DNA were digested with BamHI, EcoRI (no cut site in VFJ), NdeI (only one cut site), and HindIII (two cut sites). Lanes 1, 3, 5 and 7 correspond to ICDC-4470 DNA digested with HindIII, NdeI, EcoRI, and BamHI, while lanes 2, 4, 6 and 8 correspond to plasmid DNA digested with the same respective enzymes. The genomic DNA of N16961-VFJ and wild-type N16961 not infected by VFJ were also digested by HindIII and hybridized (lanes 9 and 10, respectively).

Southern hybridization analysis of the integration of the VFJ phage into host chromosomes.

Genomic DNA of ICDC-4470 and control VFJ plasmid DNA were digested with BamHI, EcoRI (no cut site in VFJ), NdeI (only one cut site), and HindIII (two cut sites). Lanes 1, 3, 5 and 7 correspond to ICDC-4470 DNA digested with HindIII, NdeI, EcoRI, and BamHI, while lanes 2, 4, 6 and 8 correspond to plasmid DNA digested with the same respective enzymes. The genomic DNA of N16961-VFJ and wild-type N16961 not infected by VFJ were also digested by HindIII and hybridized (lanes 9 and 10, respectively).

Host Range

The VFJ phage could infect all of the tested non-O1/non-O139 V. cholerae strains (3 of 3), V. mimicus strains (2 of 2), and V. vulnificus strains (2 of 2) (Table 1). Most of the O1 El Tor biotype (7 of 10) and O139 serogroup V. cholerae strains (3 of 4) and the V. metschnikovii strains (1 of 2) were also sensitive, and the susceptibility did not differ substantially among them. In contrast, the four O1 classical biotype V. cholerae strains, two V. parahaemolyticus strains and two V. fluvialis strains that were tested could not be infected by VFJΦ. The susceptibility of V. cholerae strains to VFJΦ were highly similar to that of the fs2 phage, for which above 70% of the El tor biotype and O139 serogroup strains could be infected by fs2Φ, whereas the proportion of the classical biotype strains that could be infected were lower than 8% [21].

Impact of VFJΦ Infection on Host Cell

Strain ICDC-4470, the native host of VFJΦ, is ampicillin- and kanamycin- resistant. After infection of VFJΦ, the recipient strains, including E. coli DH5α, V. cholerae strains, and all of the other tested Vibrio strains, also obtained low-level ampicillin resistance and high-level kanamycin resistance. The infected strains could tolerate 50 mg/ml ampicillin and 100 mg/ml kanamycin but could not grow in medium containing 100 mg/ml ampicillin. All of the kanamycin-resistant colonies were VFJ positive in PCR assays. The host spectrum of resistance to other antibiotics did not change by the infection with VFJΦ. In the microbiological assay of penicillinase, streaking of VFJΦ-infected DH5α on the plate did not affect the zone of inhibition of the indicator strain DH5α; meanwhile, the positive control strain DH5α-pUC18, which carries the Amp gene, made the zone of inhibition almost completely disappear (Fig. 4). This result clearly revealed that the ampicillin resistance caused by VFJΦ infection was not related to penicillinase.
Figure 4

Microbiological assay of penicillinase production of the VFJΦ-infected E. coli strain DH5α.

+indicates the positive control strain DH5α with pUC18 plasmid which carries the amp gene and can produce penicillinase.

Microbiological assay of penicillinase production of the VFJΦ-infected E. coli strain DH5α.

+indicates the positive control strain DH5α with pUC18 plasmid which carries the amp gene and can produce penicillinase. The second impact of VFJΦ infection on host cells was obvious growth inhibition, which was observed for two biotypes of the O1 serogroup and the O139 serogroup strains (Fig. 5). The colonies of these infected strains on LB agar cultured overnight were very small, and did not obviously grow when cultured in liquid LB broth during the initial ten hours, except for strain VC-4395-VFJ, which grew more rapidly than the other strains. However, the growth rate of the natural VFJ host strain ICDC-4470 was comparable to that of the other wild-type V. cholerae strains, and growth inhibition was not observed for the E. coli strain DH5α. The purified VFJ phage formed no turbid plaques when spotted on sensitive strains, and thus the inhibition was not the consequence of phage release and cell lysis. Additionally, on soft swim agar, ICDC-4470, VFJΦ-infected N16961 and 4395 strains could not form diffuser rings, indicating that these bacteria had lost mobility (Fig. 6A–D). Electron microscopy also revealed that the wild-type N16961 strain had a very long sheath-covered monotrichous flagellum, whereas the VFJ-infected strain lost this structure (Fig. 6E).
Figure 5

Growth curves of E. coli strain DH5α and three types of V. cholerae strains before and after infection by the VFJ phage.

Figure 6

Motility experiments on swim plates (0.3% soft agar) and electron microscopy images showing the change in the flagella between the wild-type strain and the VFJ-infected strain.

A. Strain ICDC-4470; B. VC4395 and VC4395-VFJ; C. N16961 and N16961-VFJ; and D. DH5α and DH5α-VFJ. E. Electron microscopy images of N16961 (right) and N16961-VFJ (left).

Motility experiments on swim plates (0.3% soft agar) and electron microscopy images showing the change in the flagella between the wild-type strain and the VFJ-infected strain.

A. Strain ICDC-4470; B. VC4395 and VC4395-VFJ; C. N16961 and N16961-VFJ; and D. DH5α and DH5α-VFJ. E. Electron microscopy images of N16961 (right) and N16961-VFJ (left).

Discussion

A number of V. cholerae filamentous phages have been reported. Because of their mosaic structures, phylogenetic analyses to assess the evolutionary relatedness and divergence among the phages have been performed at the level of individual genes, rather than the whole genomes [6], [22]. Based on the sequences of three essential genes encoding the replication protein, Zot-like protein and pIII-like protein that are distributed in three genomic regions, the V. cholerae phages can be divided into three branches: CTXΦ, fs2Φ, and a group of five other phages [6]. Understandably, CTXΦ is a distinct branch which uses TCP as receptor. However, phage fs2 also has diverged from other phages in all three phylogenetic trees even though it uses the same receptor MSHA pili as KSF-1, fs1, VSK, VSKK, and VGJ phages. Based on this phylogenetic method, VFJΦ should be grouped with fs2 since the similarities of all three VFJΦ genes to those of fs2 were above 94%. It is worth noting that downstream of the att site of the VFJ genome, the sequences are highly similar to those of VEJ and VCYΦ, which were isolated recently and found to be highly similar to VGJ group phages [7], [23]. Therefore, VFJΦ is a mosaic of these two groups of V. cholerae phages. In addition, orf 342 was the only ORF that did not match any other phage proteins and had the lowest similarity at the protein level, with 57% homology to a hypothetical protein of V. vulnificus, suggesting that recombination may have occurred more than once in the VFJΦ genome. Generally, the genomes of filamentous phages are organized in a modular structure in which functionally related genes are grouped. In the best-studied members of the Inovirus genus, at least three functional modules are generally characterized: replication, structural and assembly modules [9]. The putative ORFs of VFJΦ are also organized in this manner. The replication module is composed of orf 698. The putative structural and assembly modules consist of orf 104 to orf 422, which encode the capsid proteins of the filamentous phage and the proteins required for viral particle packaging and secretion. However, after the attP site, the sequence of VFJ is completely different from that of fs2. In this region, fs2 carries the rstC gene and a large non-coding sequence. The rstC gene is the most notable feature of the fs2 genome and confers important biological function to this phage, namely the capacities to horizontally transfer the rstC gene and to affect the assembly of fimbriae in vivo [14]. The large non-coding sequence contains stem-loop structures and is suspected to correspond to the intergenic (IG) region of coliphages [21]. In contrast to fs2, VFJ does not carry the rstC gene in this region. Instead, VFJ contains a three-gene regulatory module, and as is typical for regular genes, orfs 408 and 465 are transcribed in the opposite direction of the other genes. This structure does not match that of episomally replicating filamentous phages, which replicate unabated after infecting the host cell, and their genomes do not encode regulatory proteins. This regulatory module is common in chromosomally integrated filamentous phages, which tightly control their gene expression and replication and encode transcriptional regulators to inhibit the transcription of the replication protein and virion genes [1], [24]. Under the culture condition without inducer, we did not detect chromosomal integration of VFJΦ in its native host strain ICDC-4470 and newly infected strain N16961-VFJ. There are two possible explanations for this outcome, one of which is that the mutant att-like sequence prevents integration. Besides the four base pairs in the central region of the 20 bp att site, the complete downstream flanking region of the att site of VFJΦ differs with respect to fs2. Therefore, VFJΦ is precluded from integrating into the host chromosome precisely as tha same manner as fs2. The regulatory module of the VFJΦ genome is a relic of its chromosomally integrated ancestor phage. The other possible explanation is that VFJΦ can integrate into certain V. cholera genomes or even that it can integrate into ICDC-4470 under specific conditions at which time its replicatory module may play a role in strictly controlling replication and gene expression. The infected hosts of filamentous phages typically remain viable, and phages are continuously assembled and extruded from the cell in a concerted process. In addition, phage infection does not usually have a serious effect on cell growth; neither the CTXΦ phage of V. cholerae, which produces less than one phage particle per cell per hour, nor Ff phages, which produce hundreds of particles per cell per hour, substantially affecting the growth of the host [9]. It is notable that the bacterial strains infected with VFJΦ exhibited substantial growth inhibition. In contrast to CTXΦ, VFJΦ produced a high number of progeny. It is possible that the replication and release of this large number of phages required most of the energy of the host bacterium, thereby inhibiting the replication and growth of the host. Nonetheless, the E. coli strain DH5α infected with this phage grew normally, and the natural host of VFJΦ, ICDC-4470, also did not exhibit growth inhibition. In addition, the growth of one of the other tested strains was only partially inhibited, suggesting that the growth inhibition mechanism is species-specific and that an unknown mechanism exists that can relieve this growth inhibition. VFJΦ also suppressed flagellum formation in the host. The flagellum is necessary for mobility and is known to contribute to virulence [25], [26]. All of the VFJ-infected strains, including its natural host, had no flagella and could not swim. Compared with the growth inhibition, flagella inhibition did not seem to be strain-specific. The inhibition of growth and flagellum formation also did not always occur simultaneously in one infected strain, implicating that the involvement of different mechanisms. Another novel finding of this study is that along with the phage infection, the recipient strain acquired antibiotic resistance. Specifically, the VFJ phage could mediate the horizontal transfer of antibiotic resistance. More interesting is the observation that the transferred resistance was limited to two antibiotics, ampicillin and kanamycin. All of the predicted ORFs of VFJΦ have defined homologies, and none of them has been reported to be related with antibiotic resistance. Therefore, the antibiotic resistances are unlikely to be directly provided by the phage genes. Microbiological assays confirmed that these resulting drug-resistant VFJΦ strains did not produce penicillinase. Bacteriophages infect by delivering their genetic material into cells and mature by packaging the genome in capsids for release. The procedures are mediated by a DNA channel called “portal protein” [27], [28], which is a the transport complex formed by the proteins pI, pIV and pXI of filamentous phage. During viral maturation, the protein complex displays extraordinary structural plasticity and undergoes dramatic conformational changes [28]. We hypothesize that the ampicillin and kanamycin resistance obtained by the VFJΦ infected strains may be relate to this type of channel or involve phage infection-induced changes to some of the membrane structures, such as drug resistance pumps or efflux systems. In conclusion, we have identified and characterized a novel mosaic filamentous phage of V. cholerae, VFJΦ, with a wide host range and varied effects on host cells. The discovery of this phage has provided new insights into the classification and evolution of V. cholerae phages and their interaction with host bacteria.
  27 in total

1.  Heuristic approach to deriving models for gene finding.

Authors:  J Besemer; M Borodovsky
Journal:  Nucleic Acids Res       Date:  1999-10-01       Impact factor: 16.971

2.  Imbroglios of viral taxonomy: genetic exchange and failings of phenetic approaches.

Authors:  Jeffrey G Lawrence; Graham F Hatfull; Roger W Hendrix
Journal:  J Bacteriol       Date:  2002-09       Impact factor: 3.490

3.  Modified Gots test for penicillinase production.

Authors:  T H HAIGHT; M FINLAND
Journal:  Am J Clin Pathol       Date:  1952-08       Impact factor: 2.493

4.  Coordinated regulation of virulence by quorum sensing and motility pathways during the initial stages of Vibrio cholerae infection.

Authors:  Amy M Tsou; Erin M Frey; Ansel Hsiao; Zhi Liu; Jun Zhu
Journal:  Commun Integr Biol       Date:  2008

5.  Integration of the DNA of a novel filamentous bacteriophage VSK from Vibrio cholerae 0139 into the host chromosomal DNA.

Authors:  S Kar; R K Ghosh; A N Ghosh; A Ghosh
Journal:  FEMS Microbiol Lett       Date:  1996-11-15       Impact factor: 2.742

6.  Molecular analysis of a filamentous phage (fsl) of Vibrio cholerae O139.

Authors:  Y Honma; M Ikema; C Toma; M Ehara; M Iwanaga
Journal:  Biochim Biophys Acta       Date:  1997-12-31

Review 7.  Filamentous phages linked to virulence of Vibrio cholerae.

Authors:  Brigid M Davis; Matthew K Waldor
Journal:  Curr Opin Microbiol       Date:  2003-02       Impact factor: 7.934

Review 8.  The intracellular voyage of cholera toxin: going retro.

Authors:  Wayne I Lencer; Billy Tsai
Journal:  Trends Biochem Sci       Date:  2003-12       Impact factor: 13.807

9.  Structural and functional importance of outer membrane proteins in Vibrio cholerae flagellum.

Authors:  Wasimul Bari; Kang-Mu Lee; Sang Sun Yoon
Journal:  J Microbiol       Date:  2012-08-25       Impact factor: 3.422

10.  Filamentous vibriophage fs2 encoding the rstC gene integrates into the same chromosomal region as the CTX phage [corrected].

Authors:  Dong Tu Nguyen; Binh Minh Nguyen; Huy Hoang Tran; Tuan Cuong Ngo; Thanh Huong Le; Hoai Thu Nguyen; M John Albert; Mamoru Iwami; Masahiko Ehara
Journal:  FEMS Microbiol Lett       Date:  2008-05-23       Impact factor: 2.742

View more
  8 in total

1.  Correlation between viral production and carbon mineralization under nitrate-reducing conditions in aquifer sediment.

Authors:  Donald Pan; Rachel Watson; Dake Wang; Zheng Huan Tan; Daniel D Snow; Karrie A Weber
Journal:  ISME J       Date:  2014-03-27       Impact factor: 10.302

Review 2.  Filamentous phages: masters of a microbial sharing economy.

Authors:  Iain D Hay; Trevor Lithgow
Journal:  EMBO Rep       Date:  2019-04-05       Impact factor: 8.807

Review 3.  Mutualistic interplay between bacteriophages and bacteria in the human gut.

Authors:  Andrey N Shkoporov; Christopher J Turkington; Colin Hill
Journal:  Nat Rev Microbiol       Date:  2022-06-30       Impact factor: 60.633

4.  Pf Filamentous Phage Requires UvrD for Replication in Pseudomonas aeruginosa.

Authors:  Eriel Martínez; Javier Campos-Gómez
Journal:  mSphere       Date:  2016-02-10       Impact factor: 4.389

5.  Beyond Cholera: Characterization of zot-Encoding Filamentous Phages in the Marine Fish Pathogen Vibrio anguillarum.

Authors:  Jesper Juel Mauritzen; Daniel Castillo; Demeng Tan; Sine Lo Svenningsen; Mathias Middelboe
Journal:  Viruses       Date:  2020-07-06       Impact factor: 5.048

Review 6.  Bacteriophage and Bacterial Susceptibility, Resistance, and Tolerance to Antibiotics.

Authors:  Qingquan Chen; Tejas Dharmaraj; Pamela C Cai; Elizabeth B Burgener; Naomi L Haddock; Andy J Spakowitz; Paul L Bollyky
Journal:  Pharmaceutics       Date:  2022-07-07       Impact factor: 6.525

7.  Filamentous Pseudomonas Phage Pf4 in the Context of Therapy-Inducibility, Infectivity, Lysogenic Conversion, and Potential Application.

Authors:  Damir Gavric; Petar Knezevic
Journal:  Viruses       Date:  2022-06-10       Impact factor: 5.818

8.  Widespread distribution of prophage-encoded virulence factors in marine Vibrio communities.

Authors:  Daniel Castillo; Kathryn Kauffman; Fatima Hussain; Panos Kalatzis; Nanna Rørbo; Martin F Polz; Mathias Middelboe
Journal:  Sci Rep       Date:  2018-07-02       Impact factor: 4.379

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.