| Literature DB >> 23874697 |
Chan Li1, Hikaru Ito, Kyota Fujita, Hiroki Shiwaku, Yunlong Qi, Kazuhiko Tagawa, Takuya Tamura, Hitoshi Okazawa.
Abstract
PQBP1 is a nuclear-cytoplasmic shuttling protein that is engaged in RNA metabolism and transcription. In mouse embryonic brain, our previous in situ hybridization study revealed that PQBP1 mRNA was dominantly expressed in the periventricular zone region where neural stem progenitor cells (NSPCs) are located. Because the expression patterns in NSPCs are related to the symptoms of intellectual disability and microcephaly in PQBP1 gene-mutated patients, we investigated the transcriptional regulation of PQBP1 by NSPC-specific transcription factors. We selected 132 genome sequences that matched the consensus sequence for the binding of Sox2 and POU transcription factors upstream and downstream of the mouse PQBP1 gene. We then screened the binding affinity of these sequences to Sox2-Pax6 or Sox2-Brn2 with gel mobility shift assays and found 18 genome sequences that interacted with the NSPC-specific transcription factors. Some of these sequences had cis-regulatory activities in Luciferase assays and in utero electroporation into NSPCs. Furthermore we found decreased levels of expression of PQBP1 protein in NSPCs of heterozygous Sox2-knockout mice in vivo by immunohistochemistry and western blot analysis. Collectively, these results indicated that Sox2 regulated the transcription of PQBP1 in NSPCs.Entities:
Mesh:
Substances:
Year: 2013 PMID: 23874697 PMCID: PMC3713010 DOI: 10.1371/journal.pone.0068627
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Figure 1PQBP1 is expressed in the ventricular zone.
PQBP1 is expressed in the VZ of mouse embryonic brains at E15, which is the critical period for neuronal proliferation. Sagittal plane sections of the cerebral cortex were double-stained for PQBP1 and the following markers: Sox-2, for neural stem cells; RC2, specific for radial glia; Tuj-1, specific for differentiating immature neurons, and MAP2, to stain mature neurons. V, lateral ventricle; VZ, ventricular zone; S, cortical surface; IZ, intermediate zone; CP, cortical plate. Scale bar, 100 µm. The lower right panel shows the position of the magnified fields in the whole brain. Confocal microscopy (LSM510META, Carl Zeiss AG) with 10X lens was used to visualize the fluorescence.
Figure 2PQBP1 is expressed in neural stem progenitor cells (NSPC).
(A) Confocal microscopic analysis of VZ at E15 confirmed the colocalization of PQBP1 and Sox2 in the nuclei of NSPCs. Confocal microscopy (LSM510META, Carl Zeiss AG) with 40X water emersion lens was used to visualize the fluorescence. (B) NSPCs from E15 mouse were differentiated by plating them on dishes coated with polyethyleneimine or poly-L-lysine. The upper panels show the chronological expression of the differentiation markers. The lower panels show the downregulation of PQBP1 protein levels by the differentiation of NSPCs. The positive control is Drosophila Schneider cells that express PQBP1 and that do not show a band that is reactive to anti mammal beta-actin antibody. Digital images were captured by an Olympus IX71 microscope.
Figure 3Possible cis-elements upstream and downstream of the PQBP1 gene.
(A) Possible cis-elements were selected by their similarity to the consensus binding sequence of Sox2-Brn2 or Sox2-Pax6. The positions on the genome of the first nucleotide in candidate cis-element sequences are shown. The distance from the 5′-end nucleotide of the PQBP1 gene or from the 3′-end nucleotide of the PQBP1 gene are shown as – or +, respectively. (B) The schematic shows the sites of the candidate cis-elements in the genomic region surrounding the PQBP1 gene.
Probes for gel mobility shift assay.
| number | position | sequence | number2 | position2 | sequence2 |
| 1 | −47181 | AAAATAACCA | 64 | −5906 | ATATATGC |
| 2 | −47150 |
| 65 | −5556 | GTACTTGGTGA |
| 3 | −46738 | ACCTATAC | 66 | −4615 | GGAACTCCCTT |
| 4A | −45255 |
| 67 | −4274 | GCATATGC |
| 4B | −45255 | AGTCTCTGTAaaatTA | 68 | −3145 | TTTGTTTG |
| 4C | −45255 | TAAAATTA | 69 | −2866 |
|
| 5 | −44036 | TGTAGGTC | 70 | −989 | GAGATTTG |
| 6 | −43472 | AGGACTTA | 71 | −584 | GAGATTTG |
| 7 | −43333 | CAACCACCTCTaaatGCCT | 72 | −537 | GTTTGTTTTTTAAGGAACTG |
| 8 | −43242 | GCTGTAACAG | 73 | exon5 |
|
| 9 | −41447 |
| 74 | exon4 |
|
| 10 | −40291 | ACACACAC | 75 | intron2 | GCTCTGGGTA |
| 11 | −39839 | GTGGGGTACAAaaatGGCCC | 76 | intron2 | CAGGTATG |
| 12 | −39624 | AGTATGAG | 77 | intron2 | TATGTCTA |
| 13 | −38358 |
| 78 | +649 | TCTTTTGA |
| 14 | −37574 | GTCAGGAT | 79 | +1004 | TGATAGTA |
| 15 | −37310 | AGATCTTT | 80 | +1314 |
|
| 16A | −37221 |
| 81 | +1496 | AGAGTGCTGG |
| 16B | −37221 | GTAGCTTC | 82 | +3474 | ACTATTTA |
| 17 | −36441 | TTTAAAGA | 83 | +3836 | GTCCAAGT |
| 18 | −36047 | CTTAGAATTAG | 84 | +3965 | TATGAATC |
| 19 | −35915 | GAAGGAAA | 85 | +5137 | ACATATGCA |
| 20 | −35554 | CTCAGAGCTAG | 86 | +5270 |
|
| 21 | −33240 | CAGAATCA | 87 | +5773 | TTATGACTGTT |
| 22 | −32170 | TACATACAGCA | 88 | +7767 | TGTTTTGT |
| 23 | −32116 |
| 89 | +8049 |
|
| 24 | −31798 |
| 90 | +8719 |
|
| 25 | −31280 | CAGATAAC | 91 | +9294 |
|
| 26 | −28404 |
| 92 | +9492 | ATATAATAAT |
| 27 | −28297 |
| 93 | +10615 | ATAGAGGC |
| 28 | −27826 | AAAAAAGATTC | 94 | +11103 | ATCTGTAAAGG |
| 29 | −27562 | AAAAACTT | 95 | +11315 | GGTTTTCT |
| 30 | −27087 | TGTCTTCTCCC | 96 | +11695 | ACATAGACAC |
| 31 | −27021 |
| 97 | +13651 | TAGATGCT |
| 32 | −26881 | CGTTGCAC | 98 | +13814 | TTATGAAT |
| 33 | −25612 | ATAGTACA | 99 | +13985 | ATAT |
| 34 | −25489 |
| 100 | +14062 | CAACCAAAAA |
| 35 | −25268 | GTTTCTCTAATtaatAGACTTC | 101 | +15036 | TGCCTCCT |
| 36 | −24453 | TGCATACA | 102A | +15227 | GGATCCCCAC |
| 37 | −24113 | TTTCATGG | 102B | +15227 | AAAACAAA |
| 38 | −24002 | AGGTTTTGATG | 102C | +15227 | ATTTGGCG |
| 39 | −23970 | TTCAGGTT | 104 | +16271 | CACAATTTTTA |
| 40 | −23588 | TTTGTCAT | 105 | +16356 | ATTTTTTAAAA |
| 41 | −23280 | TTTGGAAA | 106 | +16665 | GCTTCCCTAG |
| 42 | −22875 | GCTTCAGC | 107 | +16934 | ACTAGTTTTC |
| 43 | −22646 | AGGAGTGC | 108 | +17613 | CATCTTATCGT |
| 44 | −21313 |
| 109 | +17782 | CTTTTTTT |
| 45 | −19662 | AAATGTGCTT | 110 | +19140 | TTTATTTA |
| 46 | −19653 | TTATTTCACA | 111 | +19986 | TTCAACCT |
| 47 | −19225 | CCACCATCTG | 112 | +21326 | TGTGTTCA |
| 48 | −18595 | ATGAAATGGCT | 113 | +22153 | ACTAAGTC |
| 49 | −18224 | CTCTCTGA | 114 | +22326 | TGATTTTTGCA |
| 50 | −18091 | TTTGTAAG | 115 | +22784 | CTGGCCAG |
| 51 | −17489 | GTCCGGCT | 116 | +24844 | AAGGCCAGAC |
| 52 | −17354 | GGGGCAGC | 117 | +25042 | GAAAA |
| 53 | −17305 | TGCTTGTG | 118 | +25259 | GACAAGGGTC |
| 54 | −15364 |
| 119 | +27750 | CCGATCGC |
| 55 | −15227 |
| 120 | +27794 | TCCACACTCTA |
| 56 | −13834 | ACACTTAT | 121 | +28016 | GTGCTCAA |
| 57 | −11697 | CCTAAGATTCT | 122 | +31108 | GAAAAGGA |
| 58 | −11280 | TGAGATGGAGG | 123 | +34572 | AGTGCTAT |
| 59 | −10829 | AGCTTTTA | 124 | +36539 | CTTATGCTTC |
| 60 | −10819 |
| 125 | +40627 |
|
| 61 | −10748 | TAAATTTTTC | 126 | +42316 | AATGTTGTCA |
| 62 | −9300 | TTTAA | 127 | +45211 | TTTTGTTT |
| 63 | −9205 | AGAAATCCTC | 128 | +46440 | AATATCAGTGTAATG |
The sequences of oligonucleotide probes used for gel mobility assay are listed. Consensus sequences of transcriptional factors are indicated with bold letters. Each consensus sequences are presented in table 2. Sox2 (capital, italic), Brn2 (miniscule), Pax6 (capital), Oct6 (miniscule, italic). The number and position correspond to the information in Fig 3.
Consensus sequence and spacing.
| protein | consensus binding motif | heterodimer | spacing(N) |
| Sox2 |
| ||
| Brn2 |
| Sox2/Brn2 | 1≤N≤11 |
| Pax6 |
| Sox2/Pax6 | 2≤N≤9 |
| 0ct6 |
| Sox2/Oct6 | 2≤N≤10 |
The consensus sequence and spacing are listed for each transcriptional factor. “Capital”, “miniscule”, “italic” corresponded to the information in Table 1.
Figure 4Screening of cis-elements by a gel mobility shift assay with the Brn2 or Pax6 DNA-binding domain (DBD).
The left panel shows a representative gel mobility shift of the Sox2-Brn2 or Sox2-Pax6 consensus probe by Brn2-DBD or Pax6-DBD. A NF-κB consensus probe was used as a negative control. The probe sequences were the following: Sox2-Brn2: GGGTAGTGTGGACAAAAGGCAATAATTAGCATGAGAATC, Sox2-Pax6: GGGAAATATTCATTGTTGTTGCTCACCTACCATGGA, and NF-κB: GGGAGTTGAGGGGACTTTCCCAGGC. The right graphs show the radioactivity in the expected area of the gel shift of Brn2-DBD or Pax6-DBD (surrounded by red line). The values indicate the fold increase of the band intensity when the intensity of the positive control was set as 1.0.
Figure 5Screening of cis-elements by a gel mobility shift assay with Sox2-Brn2 or Sox2-Pax6 full-length protein heterodimer.
The left panel shows a representative gel mobility shift of Sox2-Brn2 or Sox2-Pax6 consensus probes by the heterodimer of Sox2-Brn2 or Sox2-Pax6 full-length proteins. A supershift of the band with anti-Brn2 or -Pax6 antibody is also shown in the 3rd lane. The probe sequences were the following: Sox2-Brn2: GGGTAGTGTGGACAAAAGGCAATAATTAGCATGAGAATC andSox2-Pax6: GGGAAATATTCATTGTTGTTGCTCACCTACCATGGA. The right graphs show the radioactivity in the expected area of the gel shift of Sox2-Brn2 or Sox2-Pax6 full-length proteins. The threshold is the average signal intensity plus 1× standard deviation.
Results of gel mobility shift assay.
| probe No. | BD-Brn2 | Sox2/Brn2 | BD-Pax6 | Sox2/Pax6 | BD-Oct6 | probe No. | BD-Brn2 | Sox2/Brn2 | BD-Pax6 | Sox2/Pax6 | BD-Oct6 |
| 1 | − | − | − | − | − | 64 | + | + | + | + | + |
| 2 | − | − | − | − | − | 65 | + | − | + | − | + |
| 3 | − | − | − | − | − | 66 | − | − | + | − | + |
|
|
|
| − |
|
| 67 | − | − | − | − | − |
|
|
|
| − | − |
| 68 | + | − | + | − | + |
|
|
|
| − | − |
| 69 | − | − | − | − | + |
| 5 | + | − | − | − | − | 70 | − | − | − | − | + |
| 6 | + | − | − | − | + | 71 | + | − | + | − | + |
| 7 | − | − | − | − | − | 72 | + | − | + | − | + |
| 8 | − | − | − | − | − | 73 | − | − | − | − | − |
| 9 | − | − | − | − | − | 74 | − | − | − | − | − |
| 10 | + | − | − | − | − | 75 | + | − | + | − | + |
| 11 | − | − | − | − | − | 76 | + | − | + | − | + |
| 12 | + | − | − | − | − | 77 | − | − | − | − | − |
| 13 | − | − | − | − | − | 78 | − | + | − | + | + |
| 14 | − | − | − | − | − | 79 | − | − | − | − | − |
| 15 | − | − | − | − | − | 80 | − | − | − | − | + |
|
|
|
| − |
|
| 81 | − | − | − | − | − |
|
|
|
| − |
|
| 82 | − | − | − | − | + |
| 17 | + | − | − | − | + |
| − |
|
|
|
|
| 18 | − | − | + | − | + |
| − |
|
|
| − |
| 19 | − | − | − | − | − | 85 | − | − | + | − | − |
| 20 | − | − | − | − | − | 86 | − | − | − | − | − |
| 21 | − | − | − | − | − | 87 | + | − | + | − | + |
| 22 | − | − | − | − | − | 88 | − | − | − | + | − |
| 23 | − | − | − | − | − |
| − |
|
|
| − |
| 24 | − | − | − | − | − | 90 | + | − | + | − | + |
| 25 | − | − | − | − | − | 91 | − | + | + | − | + |
| 26 | + | − | − | − | + | 92 | + | − | + | − | + |
| 27 | − | − | − | − | − | 93 | − | − | − | − | − |
| 28 | − | − | − | − | − | 94 | + | − | + | − | + |
| 29 | − | − | − | − | + | 95 | − | − | + | − | + |
| 30 | + | − | − | − | + | 96 | − | − | − | − | − |
| 31 | − | + | − | + | − |
|
|
|
|
|
|
| 32 | + | − | + | − | + | 98 | + | − | − | − | + |
| 33 | + | − | + | − | + | 99 | + | − | + | − | + |
| 34 | − | − | + | − | − | 100 | − | − | + | − | + |
| 35 | + | − | + | − | + | 101 | + | − | − | − | + |
| 36 | + | − | + | − | + | 102a | − | + | − | − | − |
| 37 | − | − | − | − | − | 102b | − | − | − | − | − |
| 38 | − | − | − | − | + | 102c | + | − | + | − | + |
| 39 | + | − | + | − | + | 104 | + | − | + | − | + |
| 40 | + | − | + | − | + | 105 | + | − | + | − | + |
| 41 | - | − | + | − | + | 106 | − | − | − | − | − |
| 42 | − | − | + | − | − | 107 | − | − | − | − | − |
| 43 | − | − | − | − | − | 108 | + | − | + | − | + |
| 44 | − | − | − | − | − | 109 | − | − | − | − | − |
|
| − |
|
|
|
| 110 | − | − | − | − | + |
|
| − |
|
|
|
| 111 | + | − | − | − | + |
| 47 | − | − | − | − | + | 112 | + | − | − | − | + |
| 48 | − | − | + | − | − | 113 | − | − | − | − | − |
| 49 | − | + | − | + | − | 114 | − | − | − | − | − |
| 50 | − | − | − | − | − | 115 | − | − | − | − | − |
| 51 | − | − | + | − | − | 116 | − | − | − | − | − |
| 52 | − | − | − | - | − | 117 | − | + | − | − | − |
| 53 | − | − | − | − | − | 118 | − | + | − | + | − |
| 54 | − | − | − | − | + | 119 | − | − | − | − | − |
| 55 | − | − | − | − | + | 120 | − | − | − | + | + |
| 56 | + | − | + | − | + |
|
|
|
|
|
|
| 57 | − | − | + | − | + | 122 | + | − | − | + | + |
| 58 | − | − | − | − | + | 123 | − | − | − | − | − |
| 59 | + | − | + | − | + | 124 | − | − | − | − | − |
|
|
|
|
| − |
| 125 | + | − | − | + | + |
| 61 | − | − | + | − | + |
|
|
|
|
|
|
|
|
|
|
| − |
|
|
|
|
|
|
|
| 63 | − | − | + | − | + |
| − |
|
|
| − |
The results in the gel mobility shift assay are summarized. The positive result is indicated with “+”. The negative result is indicated with “-“. The bold characters indicate “double positive” probe with which both DNA-binding domain (BD-Brn2 or BD-Pax6) and Sox2 heterodimers (Sox2/Brn2 or Sox2/Pax6) interact. The “probe No.” corresponds to Fig. 3.
The list of “double positive” probes.
| double positive probes selected for Luc assay : (Bold in | |||||
| 4a | 4b | 4c | 16a | 16b | 45 |
| 46 | 60 | 62 | 64 | 83 | 84 |
| 89 | 97 | 121 | 126 | 127 | 128 |
The double positive probes in Table 3 are listed. They were employed for luciferase assay (Fig. 6).
Figure 6Screening of cis-elements by luciferase assay.
(A) The double-positive cis-elements (Table 1) were subcloned into a reporter plasmid (pGreenFire1-mCMV), and their transcriptional activity was tested by cotransfection with effecter plasmids (Sox2+Pax6 or Sox2+Brn2) into P19 cells. Fold activation was calculated in comparison to the activity of the negative control reporter plasmid possessing a nonsense sequence as the cis-element. We simultaneously tested positive controls (PC) and negative controls (NC) that possess Sox2-Pax6 or Sox2-Brn2 consensus and mutated elements, respectively. Red and yellow bars represent transcriptional activity of PC and NC, respectively. (B) The transcriptional activity of the cis-element (P16A) in neural stem/progenitor cells in vivo was examined by in utero electroporation of the reporter plasmid. Electroporation was performed on E14 and sampling was done on E15. The positive control reporter plasmid, pGreenFire1-PC (Sox2+Pax6)-mCMV, possesses a Sox2-Pax6 consensus sequence. pGreenFire1-16A-mCMV was generated by inserting the 16A oligpnucleotides:GTGAACCCTTTCAGATTTAGTGACGTAGCTTCACAAAGTGATTAA into pGreenFire1-mCMV. Confocal microscopy (LSM510META, CarlZeiss AG) with 40X water emersion lens was used to visualize the fluorescence. Green fluorescent protein signals were detected in NSPCs, even though the DsRed signals were weaker than the positive control, indicating that 16A possessed strong enhancer activity in vivo.
Figure 7Sox2 regulates PQBP1 expression in vivo.
(A) Western blot of primary-cultured neural stem progenitor cells from two Sox2+/− mice and two littermate mice (WT) (E14). Sox2 and PQBP1 proteins were both reduced. (B) Ratios of western blot signal intensities (Sox2/internal control and PQBP1/internal control) were quantified. Asterisk indicates statistical differences (N = 6, p<0.05 by Student’s t-test). (C) Immunohistochemistry of Sox2 and PQBP1 in Sox2+/− and littermate (WT) mice (E18). Digital images were captured by an Olympus IX71 microscope. (D) Quantification of the intensity of Sox2 and PQBP1 immunostain signals from ventricular surface to cortical surface. Cortex at E18 were divided into 10 square areas from ventricular surface (0%) to cortical surface (100%) as shown in Figure 7C. The total signals were acquired in each square, background signals (mean signals in ventricles, N = 5) were subtracted from them, and the mean and SD values were calculated (N = 5). Asterisks indicate statistical differences (p<0.01 by Student’s t-test).