Literature DB >> 23861905

Post-integration silencing of piggyBac transposable elements in Aedes aegypti.

Azhahianambi Palavesam1, Caroline Esnault, David A O'Brochta.   

Abstract

The piggyBac transposon, originating in the genome of the Lepidoptera Trichoplusia ni, has a broad host range, making it useful for the development of a number of transposon-based functional genomic technologies including gene vectors, enhancer-, gene- and protein-traps. While capable of being used as a vector for the creation of transgenic insects and insect cell lines, piggyBac has very limited mobility once integrated into the genome of the yellow fever mosquito, Aedes aegypti. A transgenic Aedes aegypti cell line (AagPB8) was created containing three integrated piggyBac elements and the remobilization potential of the elements was tested. The integrated piggyBac elements in AagPB8 were transpositionally silent in the presence of functional transposase, which was shown to be capable of catalyzing the movement of plasmid-borne piggyBac elements in the same cells. The structural integrity of one of the integrated elements along with the quality of element-flanking DNA, which is known to influence transposition rates, were tested in D. melanogaster. The element was found to be structurally intact, capable of transposition and excision in the soma and germ-line of Drosophila melanogaster, and in a DNA sequence context highly conducive to element movement in Drosophila melanogaster. These data show that transpositional silencing of integrated piggyBac elements in the genome of Aedes aegypti appears to be a function of higher scale genome organization or perhaps epigenetic factors, and not due to structural defects or suboptimal integration sites.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23861905      PMCID: PMC3701635          DOI: 10.1371/journal.pone.0068454

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

DNA transposons are abundant and influential residents of many genomes and have been harnessed as gene vectors and functional genomics tools because their high mobility and simple structures permit them to be easily modified and manipulated [1], [2]. The long evolutionary history of DNA transposons in eukaryotic genomes has lead to the existence of numerous means by which the elements and their hosts’ genomes modulate and regulate their activity [3], [4], [5]. Understanding the various modes of DNA transposon regulation is important for understanding the dynamics and evolution of these elements within genomes and for being able to fully exploit the potential of these elements to be used as functional genomics tools. The piggyBac element is a DNA transposon isolated originally from the genome of the moth Trichoplusia ni but has since been found in a range of other insect and non-insect species [6], [7], [8], [9], [10], [11], [12]. Like a number of other eukaryotic DNA transposons, piggyBac can transpose under some conditions in a host-independent manner making it an excellent platform upon which to build gene vectors and other functional genomics tools [13], [14], [15], [16], [17]. piggyBac has been used as a gene vector for the creation of growing number of transgenic insects of a wide range of species and in a few of those species more sophisticated piggyBac-based forward genetics and functional genomics tools have also been successfully developed [18]. For example, in Drosophila melanogaster, Tribolium castaneum, Bombyx mori and Ceratitis capitata, piggyBac has been an effective tool for transposon mutagenesis and enhancer/promoter trapping because it can be readily remobilized once it has integrated into the genome [16], [19], [20], [21], [22], [23]. Recently, it has been shown to have the same potential in the mosquito Anopheles stephensi [24]. In the mosquito Aedes aegypti the post-integration behavior of piggyBac is somewhat different in that integrated elements cannot be remobilized [25]. Sethuraman et al. (2007) attempted to remobilize five piggyBac elements located in different regions of the genome by providing piggyBac transposase from integrated piggyBac-expressing transgenes. Somatic and germ-line mobility of piggyBac were undetectable [25]. This post-integration silencing of piggyBac in Ae. aegypti is significant because it severely restricts the application of piggyBac-based genomics tools in this important vector of human pathogens. In addition, it could also reflect the existence of a systemic system for responding to the presence of new transposons within the genome of Ae. aegypti that has not been seen in D. melanogaster, T. castaneum, C. capitata or An. stephensi and is therefore of fundamental interest in understanding the dynamics of transposons [26]. While integrated piggyBac elements in the genome of D. melanogaster remobilize frequently enough for them to be valuable genomics tools in this species, piggyBac remobilization activity is highly variable among integrated elements and dependent, in part, upon the elements’ positions within the genome [27]. Esnault et al. (2011) saw a range of somatic and germ-line remobilization frequencies spanning two or three orders of magnitude for identical piggyBac elements and most of the observed variance could be attributed to the positions of the elements within the genome. They also showed, by moving elements with variable amounts of flanking chromosomal DNA to new genomic locations and measuring again the elements’ mobility, that less than a kilobase of flanking chromosomal DNA was responsible for determining the remobilization activity of an element [27]. Elements could be moved to different locations within the genome and retain their original remobilzation activities as long as approximately one kilobase of the original integration sites were included. Thus, there are intrinsic properties of the local flanking DNA that greatly impact piggyBac transposition activity either directly or indirectly. Here we report that post-integration silencing of piggyBac mobility occurs in Ae. aegypti cells in vitro, that silencing occurs in the presence of functional transposase and that when silent elements are removed from the genome with approximately one kilobase of flanking chromosomal DNA and inserted into the genome of D. melanogaster they are fully active. Based on these data, it appears that the piggyBac elements analyzed in this study were silent only under some conditions, i.e. the genome of D. melanogaster provides DNA sequence contexts conducive to transposition whereas Ae. aegypti does not. The local neighborhood effects reported by Esnault et al (2011) appear to be due indirectly to intrinsic properties of local chromosomal DNA and the results reported here suggest that these effects may be species-specific. Alternatively, transpositional silencing of piggyBac may be due to larger scale features of the genome, epigenetic factors or systemic regulatory factors.

Materials and Methods

Plasmids

pBac:Act5cHyg:ie1EGFP

This 12 kb plasmid contains a functional piggyBac gene vector containing a hygromycin-resistance gene and the gene for the Enhanced Green Fluorescent Protein (EGFP) (Figure 1). It was constructed by subcloning a 4.5 kb fragment, DmAct5c:hph:SV40, containing the D. melanogaster Actin5C promoter regulating the expression of a hygromycin phosphotransferase gene and terminated by the 3′ UTR of SV40 from pHermes:hph:tk [28] into the SacII site of pK[BIGα] [29]. pK[BIGα] is a piggyBac vector with the EGFP gene under the control of baculovirus hr4-ie1 promoter.
Figure 1

Plasmids used in this study.

All plasmids are described in Material and Methods. Large arrowheads represent the terminal sequences of piggyBac. Act5C, promoter from D. melanogaster gene Actin5C; Hygromycin coding region for bacterial gene hygromycin B phosphotransferase; ie1, promoter from the baculovirus gene immediate early 1; AmpR, bacterial gene beta-lactamase; hsp70, promoter from D. melanogaster gene hsp70; PB-transposase, coding region for piggyBac transposase; DsRed, coding region for Discosoma sp. gene red fluorescent protein; pUb, promoter from D. melanogaster gene pUbi-p63e; KanR, bacterial gene Neomycin phosphotransferase II; gDNA, refers to Aedes aegypti genomic DNA flanking the 5′ and 3 ends of piggyBac elements integrated in the genome of cell line AagPB8 (in pCL1w+) and in transgenic line 40D (in p40Dw+; [25]); mini-white, the D. melanogaster gene w attB, the bacterial attachment site for phage ΦC31.

Plasmids used in this study.

All plasmids are described in Material and Methods. Large arrowheads represent the terminal sequences of piggyBac. Act5C, promoter from D. melanogaster gene Actin5C; Hygromycin coding region for bacterial gene hygromycin B phosphotransferase; ie1, promoter from the baculovirus gene immediate early 1; AmpR, bacterial gene beta-lactamase; hsp70, promoter from D. melanogaster gene hsp70; PB-transposase, coding region for piggyBac transposase; DsRed, coding region for Discosoma sp. gene red fluorescent protein; pUb, promoter from D. melanogaster gene pUbi-p63e; KanR, bacterial gene Neomycin phosphotransferase II; gDNA, refers to Aedes aegypti genomic DNA flanking the 5′ and 3 ends of piggyBac elements integrated in the genome of cell line AagPB8 (in pCL1w+) and in transgenic line 40D (in p40Dw+; [25]); mini-white, the D. melanogaster gene w attB, the bacterial attachment site for phage ΦC31.

pHspPBtpase:PubDsRed

This 9.1 kb plasmid contains the piggyBac transposase gene under the control of the hsp70 promoter from D. melanogaster and the fluorescent protein gene, DsRed, under the promoter control of the promoter from the D. melanogaster polyubiquitin (pUb) gene (Figure 1). This plasmid was constructed by inserting a 3.1 kb fragment from pXL-BacII-PubDsRed [30] containing polyubiquitin:DsRed into the EcoRI site of pBac/hsΔsst which contains the piggyBac transposase gene under the control of D. melanogaster hsp70 promoter [31].

pCL1w+,p40Dw+

These are plasmids that contain identical piggyBac elements consisting of approximately 1 kb and 0.6 kb of the 5′ and 3′ terminal sequences, respectively, flanking the D. melanogaster mini-white gene along with approximately 1 kb of genomic DNA from their original integration sites in the genome of Ae. aegypti. pCL1w+ contains the piggyBac element from integration site 1110A in the transgenic cell line AagPB8 (see below) and has 1 kb and 500 bp Ae. aegypti genomic DNA flanking the 5′ and 3′ ends of piggyBac, respectively (Figure 1). p40Dw+ contains the piggyBac element from the transgenic Ae. aegypti line 40D (see below) and has 1 kb Ae. aegypti genomic DNA flanking the 5′ and 3′ ends of piggyBac (Figure 1). The piggyBac elements in the plasmids described above were amplified by PCR from Ae. aegypti genomic DNA using piggyBac element-specific primers and Ae. aegypti genomic DNA specific primers. The reaction conditions for the PCR were: 1X Phusion Buffer (Finnzymes, Woburn, Massachusetts, USA), 0.2 mM of each dNTP, 0.1 µM forward primer and 0.1 µM reverse primer, 1 Unit Phusion DNA polymerase (Finnzymes, Woburn, Massachusetts, USA) and 10 ng of genomic DNA. MJ Research Thermo cycler was used to amplify the DNA under the following cycling conditions: 3 min at 98°C; 5 cycles of 15 sec at 98°C, 30 sec at 62°C, 5 min at 72°C; 35 cycles of 15 sec at 98°C, 30 sec at 68°C, 5 min at 72°C; 10 min at 72°C. The PCR fragments containing the 5′ terminal sequences of piggyBac and flanking genomic DNA had AscI and PacI restriction sites within the piggyBac-specific primers. These PCR fragments were ligated into pCR-Blunt II TOPO vectors as per the recommendations of the manufacturer (Invitrogen, USA). The PCR fragments of the 3′ terminal sequences of piggyBac with genomic DNA had PacI and AscI restriction sites in the piggyBac-specific primers and genomic DNA-specific primers, respectively. Following digestion with PacI and AscI these fragments were ligated into the PacI and AscI sites of the plasmids containing the 5′ terminal sequences of piggyBac, resulting in the creation of plasmids with functional piggyBac elements flanked by varying length of Ae. aegypti genomic DNA. The Drosophila mini-white gene was amplified from a plasmid PB [21] with primers containing PacI restriction sites, digested with PacI and ligated into the PacI sites of the previous cloning step. This resulted in plasmids with piggyBac vectors carrying the mini-white gene flanked by various lengths of Ae. aegypti genomic DNA with a unique AscI site in the plasmid backbone. The φC31 attB site was amplified from the plasmid pUASTattB [32] using PCR under the following conditions: 1X ThermoPol buffer (New England Biolabs, USA), 0.4 mM of each dNTP, 0.1 µM attBF primer and 0.1 µM attBR primer, 1u Taq polymerase (New England Biolabs, USA) and 5 ng of pUASTattB. The cycling conditions for the PCR reactions were: 5 min at 95°C; 25 cycles of 30 sec at 95°C, 30 sec at 56°C, 30 sec at 72°C; 5 min at 72°C. The resulting 300 bp fragment with AscI sites at both ends was ligated into a pCR 2.1-TOPO vector (Invitrogen). The 300 bp fragment containing the φC31 attB site was removed with AscI and ligated into the AscI site of the plasmids containing piggyBac-mini-white elements flanked by genomic DNA.

Insect Strains

Drosophila melanogaster lines were obtained from the Bloomington Drosophila Stock Center at Indiana University and maintained at 25°C on a standard cornmeal/yeast-based diet. The following lines were used in this study:

Canton-S: Wild-type

w1118

A homozygous recessive spontaneous loss-of-function mutation in the white gene resulting in white eyes containing less than 1% of normal pigmentation levels.

w1118; CyO, P0…2/wgSp-1

Multiple copies of a P-element containing the piggyBac transposase open reading frame under the regulatory control of the strong constitutive promoter from the D. melanogaster tubulin gene on the CyO balancer chromosome.

w1118; CyO, P0…2/wgSp-1; TM6BTbSb

Same as above with a 3rd chromosome balancer.

P{ry+t7.2 = hsp70-flp}1, y1 w*; M{3xP3-RFP.attP}ZH-86Fb; M{vas-int.B}ZH-102D

Contains a φC31 attP site on the right arm of chromosome 3 and the φC31intgrase gene under the regulatory control of the promoter from the vasa gene on chromosome 4 [32].

CL1w+

P{ry+t7.2 = hsp70-flp}1, y1 w*; M{3xP3-RFP.attP}ZH-86Fb; M{vas-int.B}ZH-102D with an integrated copy of the plasmid pCL1w+.

40Dw+

P{ry+t7.2 = hsp70-flp}1, y1 w*; M{3xP3-RFP.attP}ZH-86Fb; M{vas-int.B}ZH-102D with an integrated copy of the plasmid p40Dw+.

PBacw+

P{ry+t7.2 = hsp70-flp}1, y1 w*; M{3xP3-RFP.attP}ZH-86Fb; M{vas-int.B}ZH-102D with an integrated copy of the plasmid PB{RB} [21], [27].

A.a.40D

The transgenic Ae. aegypti line, 40D, contains a single piggyBac element with the cinnabar gene from D. melanogaster inserted into the genome of the kh strain [25]. Ae. aegypti were reared under standard laboratory conditions as described [33].

Ae. aegypti Cell Lines

Aag-2

An embryonic cell line maintained in Eagle’s Minimal Essential Medium (MEM) supplemented with MEM Non-Essential Amino Acids Solution, MEM vitamin solution, L-glutamine, and the antibiotics penicillin and streptomycin and 5% fetal bovine serum all cell culture reagents from Gibco®, Life Technologies) at 28°C in a 5% CO2 atmosphere [34], [35]. Cells were sub-cultured weekly at a 1∶5 dilution.

AagPB8

These are Aag-2 cells that contain 3 copies of an integrated piggyBac vector containing a hygromycin resistance gene under the regulatory control of the promoter from the cytoplasmic actin gene, Act5C, from D. melanogaster and EGFP under the regulatory control of the baculovirus immediate early 1 (ie1) promoter (Figure 2). To create this cell line an equal volume of Lipofectin® Transfection Reagent (Invitrogen) and a mixture of pBac:Act5cHyg:ie1EGFP and pBac/hsΔsst in Opti-MEM™ (Invitrogen, USA) was prepared such that the final concentration of each plasmid was 20 µg/ml and 10 µg/ml, respectively. One hundred microliters of this transfection mixture was added to the 900 µl of a suspension of Aag-2 cells in Eagle’s MEM (106 cells/ml) lacking fetal calf serum, penicillin and streptomycin, and incubated in a 6-well cell-culture plate at 25°C, 5% CO2 for 12 hrs. After 12 hrs, the medium was replaced with Eagle’s MEM with 5% fetal calf serum and antibiotics penicillin and streptomycin and cells were heat-shocked at 37°C for 1 hr and then incubated for 2 weeks at 25°C, 5% CO2. The cells were split 1∶2 using Eagle’s MEM containing 5% fetal calf serum, penicillin, streptomycin and hygromycin B (50 µg/ml; Gibco®, Life Technologies). Hygromycin-resistant colonies appeared 4 weeks after selection with hygromycin B. Sixteen hygromycin-resistant monolayer colonies were individually picked and transferred to a well of a 96-well flat-bottom plate and allowed to grow. As cells overgrew the surface of the well they were transferred to progressively larger well and finally into a 25 ml cell-culture flask (Corning). Of the original 16 colonies, two (AagPB5 and AagPB8) were successfully amplified and established as a permanent cell line. AagPB8 was used for all experiments in this study.
Figure 2

Cell line AagPB8.

A) AagPB8 cells are Aag-2 cells containing 3 copies of an integrated piggyBac vector with a hygromycin-resistance gene under the regulatory control of the promoter from the cytoplasmic actin gene, Act5C, from D. melanogaster and EGFP under the regulatory control of the baculovirus immediate early1 (ie1) promoter. Cells appear green because they were imaged under conditions allowing detection of fluorescence of EGFP. These cells were used for all experiments in this study. B) AagPB8 cells were transfected with piggyBac-expressing plasmids, pHspPBtpase:PubDsRed. The cells were heat shocked at 37°C for 1 hr 12 hrs post transfection and viewed using a florescence microscope to confirm the expression of EGFP (from the integrated piggyBac elements) and DsRed (from the transfected transposase-expressing plasmid or the negative control plasmid lacking transposase). Transfected cells expressing DsRed 12 hrs post heat shock are indicated with white arrows. The cells shown were sorted by FACS and used to assess transposition activity of piggyBac as described in the Material and Methods.

Cell line AagPB8.

A) AagPB8 cells are Aag-2 cells containing 3 copies of an integrated piggyBac vector with a hygromycin-resistance gene under the regulatory control of the promoter from the cytoplasmic actin gene, Act5C, from D. melanogaster and EGFP under the regulatory control of the baculovirus immediate early1 (ie1) promoter. Cells appear green because they were imaged under conditions allowing detection of fluorescence of EGFP. These cells were used for all experiments in this study. B) AagPB8 cells were transfected with piggyBac-expressing plasmids, pHspPBtpase:PubDsRed. The cells were heat shocked at 37°C for 1 hr 12 hrs post transfection and viewed using a florescence microscope to confirm the expression of EGFP (from the integrated piggyBac elements) and DsRed (from the transfected transposase-expressing plasmid or the negative control plasmid lacking transposase). Transfected cells expressing DsRed 12 hrs post heat shock are indicated with white arrows. The cells shown were sorted by FACS and used to assess transposition activity of piggyBac as described in the Material and Methods.

piggyBac Excision Assay in vitro

A plasmid-based piggyBac excision assay was performed as described previously but with minor modifications [36] and consisted of introducing a piggyBac-containing plasmid (piggyBac donor plasmid) and a plasmid that has a constitutively active copy of the piggyBac transposase gene (piggyBac helper plasmid) (Figure 3A). A mixture of these plasmids was introduced into cells and the plasmids subsequently recovered. Donor plasmids are analyzed by PCR for loss of the piggyBac element (excision). Specifically, one million AagPB8 cells were seeded into each well of a six-well cell culture plate 24 hr before transfection. One microgram each of the donor (pBac:3×P3 EGFP) [37] and helper plasmid (pHspPBtpase:pUbDsRed) were transfected into cells using of Lipofectin® Transfection Reagent (Invitrogen). After 12 hrs the cells were heat-shocked at 37°C for 1 hr. Cells were collected and plasmids were recovered from the cells at 72 hrs post-transfection using QIAprep Spin Miniprep Kit (Qiagen). Isolated plasmids were used as templates in two PCRs designed to detect the presence of intact donor plasmids and donor plasmids with from which piggyBac had excised. The presence of donor plasmids was confirmed by PCR using primers that would anneal to all donor plasmids and yield a fragment 751 bp in length (using primers 494donorFWD: TTTGCCGGATCAAGAGCTAC; 494donorREV: GCATTAATGAATCGGCCAAC) (Figure 3A). Donor plasmids that lost piggyBac by excision were detected by PCR using primers flanking the piggyBac integration site. In this PCR reaction intact donor plasmids yielded no products and plasmids lacking piggyBac yielded 540 bp fragments (using primers 494excisionFWD: CTTTATGCTTCCGGCTCGTA; 494excisionREV: ACGCGTATTAACGCAGAGTG) (Figure 3A). The PCR reactions included an initial denaturation step of 95°C for 2 min, followed by 40 cycles 95°C for 15 s, 54°C for 30 s and 72°C for 1 min with an elongation step at 72°C for 5 min. The PCR products were resolved and detected by agarose gel electrophoresis.
Figure 3

Plasmid-based piggyBac excision assay.

A) Diagrammatic representation of the piggyBac-containing plasmid, piggyBac 3×P3EGFP used in the excision assay described in the Material and Methods (donor plasmid), and the same plasmid following precise excision of the piggyBac element (excision plasmid). The piggyBac-containing donor plasmid, piggyBac 3×P3EGFP, and piggyBac transposase expressing helper plasmid, pHspPBtpase:PubDsRed, were co-transfected into AagPB8 cells. Transfected cells were heat-shocked after 12 hrs and collected after 72 hrs. DNA was extracted and used as a template for PCR. Primers 1 and 2 (shown as labeled short half-arrows) were specific to the donor-plasmid backbone (494donorFWD, 494donorREV) and yield a 751 bp product (grey line) in the presence of the donor and excision plasmids. Primers 3 and 4 (494excisionFWD, 494excisionREV and shown as labeled short half-arrows) are specific to the plasmid DNA flanking the piggyBac element, however under the conditions of this experiment PCR products were only detected if donor plasmids missing the piggyBac element through excision were present, yielding a 540 bp PCR product (grey line). The 5′ and 3′ terminal piggyBac sequences are represented by arrows (5′PB, 3′PB). The duplicated TTAA target sequence into which piggyBac integrated is shown as a black diamond and the 3×P3EGFP transgene within the piggyBac element is shown as a black rectangle. The normally circular plasmids are represented as linear molecules. B) The PCR results from two piggyBac excision assays in AagPB8 cells. Lanes 1 and 2: from cells transfected with donor and pHspPBtpase:PubDsRed (2 independent transfections). Lane 3: from cells transfected with donor and control plasmids (pBluescript SKII+). Lane 4 and 5: positive controls for detecting excision events. The DNA used as a template in these reactions was a purified excision plasmid recovered from a previous excision assay (2 independent transfections). Lane 6: negative control for detecting excision events. DNA used as a template in this reaction came from cells transfected with donor plasmid only, without the transposase helper plasmid. Two PCR reactions were performed on each sample using primer combinations indicated above the lanes numbers. Primers 1+2 (same primers referred to in panel A) detected the presence of donor and excision plasmids and yielded a 751 bp reaction product (white arrow). Primers 3+4 (same primers referred to in panel A) yielded a 540 bp reaction product (white arrow) only when the piggyBac element in the donor plasmid had excised. Only the 540 and 751 bp bands are specific reaction products.

Plasmid-based piggyBac excision assay.

A) Diagrammatic representation of the piggyBac-containing plasmid, piggyBac 3×P3EGFP used in the excision assay described in the Material and Methods (donor plasmid), and the same plasmid following precise excision of the piggyBac element (excision plasmid). The piggyBac-containing donor plasmid, piggyBac 3×P3EGFP, and piggyBac transposase expressing helper plasmid, pHspPBtpase:PubDsRed, were co-transfected into AagPB8 cells. Transfected cells were heat-shocked after 12 hrs and collected after 72 hrs. DNA was extracted and used as a template for PCR. Primers 1 and 2 (shown as labeled short half-arrows) were specific to the donor-plasmid backbone (494donorFWD, 494donorREV) and yield a 751 bp product (grey line) in the presence of the donor and excision plasmids. Primers 3 and 4 (494excisionFWD, 494excisionREV and shown as labeled short half-arrows) are specific to the plasmid DNA flanking the piggyBac element, however under the conditions of this experiment PCR products were only detected if donor plasmids missing the piggyBac element through excision were present, yielding a 540 bp PCR product (grey line). The 5′ and 3′ terminal piggyBac sequences are represented by arrows (5′PB, 3′PB). The duplicated TTAA target sequence into which piggyBac integrated is shown as a black diamond and the 3×P3EGFP transgene within the piggyBac element is shown as a black rectangle. The normally circular plasmids are represented as linear molecules. B) The PCR results from two piggyBac excision assays in AagPB8 cells. Lanes 1 and 2: from cells transfected with donor and pHspPBtpase:PubDsRed (2 independent transfections). Lane 3: from cells transfected with donor and control plasmids (pBluescript SKII+). Lane 4 and 5: positive controls for detecting excision events. The DNA used as a template in these reactions was a purified excision plasmid recovered from a previous excision assay (2 independent transfections). Lane 6: negative control for detecting excision events. DNA used as a template in this reaction came from cells transfected with donor plasmid only, without the transposase helper plasmid. Two PCR reactions were performed on each sample using primer combinations indicated above the lanes numbers. Primers 1+2 (same primers referred to in panel A) detected the presence of donor and excision plasmids and yielded a 751 bp reaction product (white arrow). Primers 3+4 (same primers referred to in panel A) yielded a 540 bp reaction product (white arrow) only when the piggyBac element in the donor plasmid had excised. Only the 540 and 751 bp bands are specific reaction products.

piggyBac Transposition Assay in vitro

AagPB8 cells were seeded at the concentration of 106 cells/well into six-well cell culture plates. One microgram of pHspPBtpase:PubDsRed was transfected into cells using Lipofectin® Transfection Reagent (Invitrogen). As a negative control, an equal number of cells were transfected with one microgram of pXLBacIIPubDsRed, which does not contain piggyBac transposase. After 12 hrs, the cells were heat shocked at 37°C for 1 hr and at 24 hrs after transfection the cells were viewed using a florescence microscope to confirm the expression of EGFP (from the integrated piggyBac elements) and DsRed (from the transfected transposase-expressing plasmid or the negative control plasmid lacking transposase). Transfection efficiency was approximately 10%. The cells were incubated at 25°C at 5% CO2 for an additional 72 hrs. The cells were collected, washed in Phosphate Buffered Saline (PBS; Gibco®, Life Technologies), pH 7.4 and resuspended in PBS. Cells expressing EGFP and DsRed were sorted using a FACSAria™ cell sorter (BD bioscience). One thousand cells and 2×104 cells were collected for whole genome amplification and genomic DNA isolation, respectively. Whole genome amplifications were performed on cell lysates using the Illustra GenomiPhi V2 DNA Amplification Kit according to the manufacturers recommendations (GE Healthcare). Genomic DNA was isolated using a DNeasy kit (Qiagen) after growing the initial 2×104 cell for a week in Eagle’s MEM. Transposable element display was performed (see below) using amplified genomic DNA and genomic DNA as templates to test for the presence of piggyBac elements integrated in new locations within some of the recovered DNA.

Transposable Element Display

This PCR-based integration site analysis method was performed as described by Sethuraman et al. (2007) with few modifications [25]. This genotyping method determines the number and location of piggyBac transposable elements within a genome based on the pattern of PCR fragments. Genomic DNA (25 ng) was digested with MspI (New England Biolabs) according to the manufacturers recommendations. Sixty pmoles of MspI adapters (consisting of a dimer of oligonucleotides MspIa 5′GAC GAT GAG TCC TGA G 3′ and MspIb 5′CGC TCA GGA CTCAT 3′) were ligated to digested genomic DNA in the presence of MspI overnight after which the reaction was diluted 4X with 0.1X TrisEDTA buffer (1 mM Tris HCL, pH 7.5, 0.1 mM EDTA). PCR (Pre-selective PCR) was performed using 5 µl of the diluted restriction/ligation reaction as template with primers MspIa and piggyL1 (5′TAT GAG TTA AAT CTT AAA AGT CAC G 3′) to display fragments containing the left inverted terminal repeat (ITR). The PCR reaction conditions were a denaturation step of at 95°C for 3 min followed by 25 cycles of 15 s at 95°C, 30 s at 54°C and 1 min at 72°C with a 5 min final elongation at 72°C. The pre-selective PCR products were diluted 20 times with 0.1X TrisEDTA buffer and 5 µl was used as a template in a PCR (Selective PCR) using primers MspI and Cy5-labelled piggyL5 Cy5 (5′ AGC AAT ATT TCA AGA ATG CAT GC 3′) to display fragments specifically containing the left inverted repeat. The selective PCR reaction conditions included an initial denaturation step of 95°C for 3 min, followed by 5 cycles of touchdown PCR consisting of a denaturation step of 95°C for 15 s followed by annealing for 30 s at a 59°C and an extension step of 1 min at 72°C, with the annealing temperature being reduced by one degree on each of five successive cycles. This was followed by 25 cycles of 95°C for 15 s, 54°C for 30 s and 72°C for 1 min final elongation step at 72°C for 5 mins. The selective PCR products were resolved on a 6% polyacrylamide gel under denaturing condition (6M urea). The gel was dried on 3 MM paper and viewed on a Storm 860 optical scanner (Molecular Dynamics) using the excitation wavelength of 635 nm. DNA bands of interest were excised from the gel, re-amplified using selective PCR protocol and unlabeled primers, purified using QIAquick Gel Extraction Kit (Qiagen) and sequenced.

Creating Transgenic Drosophila Melanogaster

Two transgenic lines of D. melanogaster were created essentially as described by Esnault et al. (2011) [27]. Preblastoderm embryos of P{ry+t7.2 = hsp70-flp}1, y1 w*; M{3×P3-RFP.attP}ZH-86 Fb; M{vas-int.B}ZH-102D [32] were injected with pCL1w and p40Dw at 0.25 mg/ml and individual adults arising from these embryos were out-crossed to w1118 flies of the opposite sex. Red-eyed transgenic progeny of these crosses were used to establish homozygous lines (CL1w+ and 40Dw+).

Genetic Analysis of piggyBac Activity

Somatic mosaicism assay

Males from the lines CL1w+, 40Dw+ and PBacw+ were crossed en mass with virgin females from the line w1118; CyO, P0…2/wgSp-1, which express piggyBac transposase. Curly-winged, red-eyed progeny were examined for the presence of clones of ommatidia with no pigmentation (indicates piggyBac excision) or with different grades of pigmentation more or less than the parental line (arising from piggyBac transposition and different levels of mini-white gene expression as a result of “position effects” [38]). Activity was expressed as the proportion of curly-winged, red-eyed progeny with eye-color mosaicism.

Germ-line activity

Males from the lines CL1w+,40Dw+ and PBacw+ were crossed en mass with virgin females from the line w1118; CyO, P0…2/wgSp-1; TM6BTbSb. Curly-winged, red-eyed, Sb progeny were crossed to w1118. w progeny were scored as germ-line transposition events while w, Sb progeny were scored as germ-line excision events.

Results and Discussion

Aedes aegypti Cell Line with Integrated piggyBac Elements – AagPB8

The cell line Aag-2 was co-transfected with the plasmids pBac:Act5cHyg:ie1EGFP and pHspPBtpase:PubDsRed and cells resistant to hygromycin B were selected. Foci of resistant cells were collected and subcultured to established hygromycin-resistant, EGFP-expressing cell lines (Figure 2). Cell line AagPB8 was used for all experiments and contains two integrated copies of pBac:Act5cHyg:ie1EGFP resulting from canonical cut-and-paste transposition of piggyBac and a third element associated with the integration of a copy of the plasmid pBac:Act5cHyg:ie1EGFP (Table 1). These data show that pHspPBtpase:PubDsRed, used as a source of piggyBac transposase in these cell line transfection experiments produces functional piggyBac transposase and that Aag-2 cells support piggyBac transposition.
Table 1

Location of piggyBac integration sites in AegPB8.

ElementIntegration sitePosition* Location
CL1 ACTATAAAGCTTGTTTCAGTTTAACAAACTGTTGTTCTACTACT supercont1.1100:32414intergenic
CL2 TTTGTAGTCTTTTAAAGCTTTTAAAGAAATAAAGAAGGATTCGC supercont1.160:2043689intron

Position of underlined nucleotide shown based on Aedes aegypti genome version 66.1 (AegL1)

Position of underlined nucleotide shown based on Aedes aegypti genome version 66.1 (AegL1)

Mobility of Plasmid-borne piggyBac Elements in AagPB8

To test the ability of cell line AagPB8 to support piggyBac movement, plasmid-based piggyBac excision assays were performed. The plasmids pBac3×P3EGFP (donor) and pHspPBtpase:PubDsRed (helper) were co-transfected into AagPB8 cells and subsequently recovered. Using PCR primers that permit the detection of all donor plasmids (priming sites located within the plasmid backbone) and donor plasmids that had lost piggyBac through excision (priming sites immediately flanking piggyBac), PCR reactions were performed using DNA recovered from transfected cells (Figure 3A). In the presence of piggyBac transposase-expressing helper plasmids, donor plasmids that had lost piggyBac through excision were detected (Figure 3B). Excision products were not detected when the transposase-expressing helper plasmids were absent from the initial transfection mixture (Figure 3B). These data show that the cell line AagPB8, with three integrated piggyBac elements can support piggyBac movement of piggyBac elements located on plasmids.

Immobility of Integrated piggyBac Elements in AagPB8

Having confirmed that functional piggyBac transposase could be produced in cell line AagPB8 through transfection with pHspPBtpase:PubDsRed we measured the mobility of the chromosomally integrated piggyBac elements. Transposable element display is a sensitive method for detecting the presence of transposable elements in different positions within a genome. By starting with a genome in which the position of transposable elements of interest are known one can use transposable element display to detect the movement of transposable elements by comparing the position of the transposable elements at the beginning and end of an experiment. Transposable element display can be used not only to detect the movement of transposable elements in the germ line but also within somatic tissue. For example, Guimond et al (2003) were able to show extensive somatic activity of Hermes elements in transgenic Drosophila melanogaster [39]. We used a similar approach to test for piggyBac movement in the cell line AagPB8. In this case AagPB8 cells were transfected with the helper plasmid pHspPBtpase:PubDsRed and cells expressing EGFP and DsRed were collected and cultured (Figure 2). After cell sorting the cells expressing EGFP and DsRed were permitted to grow for 5–8 days after which time they were collected and their genomic DNA used in a transposable element display reaction. Based on TE display, no piggyBac elements in new locations were detected indicating that the chromosomally integrated piggyBac elements in AagPB8 were transpositionally silent (Figure 4). Therefore, integrated piggyBac elements in AagPB8 behave much differently in the presence of functional piggyBac transposase than do piggyBac elements in the same cells present on plasmids. Chromosomally integrated elements are unresponsive to functional transposase while plasmid-borne elements are mobile. These observations are consistent with those of Sethuraman et al (2007) who reported the transpositional silencing of integrated piggyBac elements in transgenic Aedes aegypti [25].
Figure 4

piggyBac transposable element display results using DNA isolated from cell line AagPB8.

Lanes 1 are the results using DNA as a template isolated from cell line AagPB8 and shows evidence of the 5′ end of one of the two piggyBac elements that had integrated by canonical cut-and-paste transposition –80 bp band. The 5′ end of the second piggyBac element that integrated by canonical cut-and-paste transposition is not visible. This element can be detected when the 3′ ends of integrated piggyBac elements are visualized using transposable element display (not shown). The band at 250 bp is the piggyBac element associated with a copy of the integrated plasmid pBac:Act5cHyg:ie1EGFP. The sample was loaded into two adjacent lanes. Lanes 2 are the results using DNA as a template isolated from non-transgenic Aag-2 cells and this serves as a negative control for this assay since there are no piggyBac elements in Ae. aegypti. The sample was loaded into two adjacent lanes. Lanes 3 are the results using DNA as a template from AagPB8 cells 72 hours after being transfected with piggyBac-transposase-expressing pHspPBtpase:PubDsRed. The sample was loaded into two adjacent lanes. There was no evidence of piggyBac elements in other positions in the genome in Lane 3 as would be expected if piggyBac transposase mobilized the integrated piggyBac elements in AagPB8 cells. The asterisk indicated the position of a non-specific TE display band present in all samples. The positions of molecular weight markers 80 bp and 250 bp in length are shown.

piggyBac transposable element display results using DNA isolated from cell line AagPB8.

Lanes 1 are the results using DNA as a template isolated from cell line AagPB8 and shows evidence of the 5′ end of one of the two piggyBac elements that had integrated by canonical cut-and-paste transposition –80 bp band. The 5′ end of the second piggyBac element that integrated by canonical cut-and-paste transposition is not visible. This element can be detected when the 3′ ends of integrated piggyBac elements are visualized using transposable element display (not shown). The band at 250 bp is the piggyBac element associated with a copy of the integrated plasmid pBac:Act5cHyg:ie1EGFP. The sample was loaded into two adjacent lanes. Lanes 2 are the results using DNA as a template isolated from non-transgenic Aag-2 cells and this serves as a negative control for this assay since there are no piggyBac elements in Ae. aegypti. The sample was loaded into two adjacent lanes. Lanes 3 are the results using DNA as a template from AagPB8 cells 72 hours after being transfected with piggyBac-transposase-expressing pHspPBtpase:PubDsRed. The sample was loaded into two adjacent lanes. There was no evidence of piggyBac elements in other positions in the genome in Lane 3 as would be expected if piggyBac transposase mobilized the integrated piggyBac elements in AagPB8 cells. The asterisk indicated the position of a non-specific TE display band present in all samples. The positions of molecular weight markers 80 bp and 250 bp in length are shown. Two methods were used to assess piggyBac mobility, one based on movement of elements from plasmids and the other on the movement of element within genomes, and this raises the question as to whether differences in the sensitivity of these assays account for the differences in the observations reported. The plasmid assay gains it sensitivity from the large number of plasmids that can be introduced into cells. The intra-genomic mobility assay in combination with transposable element display gains its sensitivity from the ability to culture cells after introducing a source of transposase and amplifying the number of genomes with a piggyBac element in a new position. While both methods of assessing mobility would appear to be sensitive their relative sensitivities cannot be known and it should be considered a caveat when considering the conclusions reached here.

Transpositionally Silent piggyBac Elements from AagPB8 can Transpose in D. melanogaster

Esnault et al (2011) found that local chromosomal DNA sequences immediately flanking integrated piggyBac elements in D. melanogaster account for almost all of the variance in element mobility observed among identical piggyBac elements integrated in different positions and exposed to a fixed source of piggyBac transposase [27]. Esnault et al (2011) could remove integrated piggyBac elements along with varying amounts of flanking DNA and re-integrate the elements and flanking DNA using site specific recombination into new positions within the genome of D. melanogaster [27]. As long as the elements retained approximately 1 kilobase of their original flanking genomic DNA they had the same remobilization activity as they did in their original position. Here we removed the piggyBac element CL1 from cell line AagPB8 and element 40D from Sethuraman et al’s (2007) transgenic Aedes aegypti line 40D, which was also shown to be completely stable in the presence of piggyBac transposase [25]. These elements were removed along with approximately 1 kb of flanking DNA and re-integrated into the same position within the genome of D. melanogaster using site specific recombination, as described by Esnault (2011) where their remobilization potential was measured in both the germ-line and soma as described [27]. The piggyBac elements CL1 from cell line AagPB8 and 40D from transgenic line 40D were highly active in both the soma and the germ line of transgenic D. melanogaster, in the presence of a constant source of transposase (Table 2). Ninety-six percent of D. melanogaster heterozygous for element CL1w+ and piggyBac transposase had eye-color mosaicism, indicating the frequent excision and transposition of the CL1w+ element. Similarly, 80% of D. melanogaster heterozygous for element 40Dw+ and piggyBac transposase had eye-color mosaicism. These rates of somatic piggyBac movement were higher than the control element PBbacw+ (78%) measured in this experiment and reported initially by Esnault et al (2011) at approximately 80%. piggyBac elements CL1w+ and 40Dw+ were also active in the germ-line of D. melanogaster. Germ line transposition and excision of CL1w+ was measured at 23% and 86%, respectively (Table 2). Transposition and excision of element 40Dw+ was observed in 4% and 16% of the germ-lines tested, while the control element, PBacw+, transposed and excised in 5% and 54% of the germ lines tested, respectively.
Table 2

Mobility of piggyBac elements with original Aedes aegypti flanking genomic DNA in Drosophila melanogaster.

PBbacw+a 40Dw+b CL1w+c
Somatic Mosaics d 0.78 (0.04)0.80 (0.02)0.96 (0.06)
Crosses 333
Progeny/Cross e 133 (21)134 (22)94 (25)
Germ-line Germ-lines 487354
Excisions f 26 (54.2)12 (16.4)49 (86.0)
Transpositions g 9 (5.3)3 (4.1)13 (22.8)

piggyBac from pPBac3×P3 EGFP with 1 kb of plasmid DNA flanking each terminal inverted repeat.

piggyBac from transgenic Aedes aegypti line 40D with 1 kb of flanking genomic DNA.

piggyBac element CL1 from Aedes aegypti cell-line AagPB8 with 1 kb of flanking genomic DNA.

mean frequency of eye-mosaicism among progeny (standard deviation).

mean number of progeny scored per cross (standard deviation).

number of germ-lines yielding at least one excision event (percent).

number of germ-lines yielding at least on transposition event (percent).

piggyBac from pPBac3×P3 EGFP with 1 kb of plasmid DNA flanking each terminal inverted repeat. piggyBac from transgenic Aedes aegypti line 40D with 1 kb of flanking genomic DNA. piggyBac element CL1 from Aedes aegypti cell-line AagPB8 with 1 kb of flanking genomic DNA. mean frequency of eye-mosaicism among progeny (standard deviation). mean number of progeny scored per cross (standard deviation). number of germ-lines yielding at least one excision event (percent). number of germ-lines yielding at least on transposition event (percent). The piggyBac element CL1 in cell line AagPB8, and the piggyBac element in transgenic Aedes aegypti line 40D are both fully functional elements in chromosomal DNA contexts highly favorable for piggyBac excision and transposition, at least in D. melanogaster. The results reported here indicate that transpositional silencing of piggyBac elements upon integration into the genome of Aedes aegypti is a consequence of an unknown feature of the target site or chromosome, since we show here that 1) the integrated elements are structurally intact by demonstrating their mobility in D. melanogaster, 2) they are flanked by chromosomal DNA sequences that are conducive to element movement, 3) plasmid borne elements are active in the same cellular environment, and 4) functional transposase was provided in these experiments. The basis for transpositional silencing of piggyBac is unknown and the experiments reported here, while not identifying the causal factors associated with silencing have suggested the involvement of higher scale genetic or epigenetic factors. These factors seem to affect the movement of any foreign transposable element introduced into the genome of Ae. aegypti and while perhaps reflecting an adaptive response to large transposable element movements earlier in the evolutionary history of the species, it currently impedes the development of powerful transposon-based functional genomics technologies.
  37 in total

1.  Germline transformation of the malaria vector, Anopheles gambiae, with the piggyBac transposable element.

Authors:  G L Grossman; C S Rafferty; J R Clayton; T K Stevens; O Mukabayire; M Q Benedict
Journal:  Insect Mol Biol       Date:  2001-12       Impact factor: 3.585

2.  Patterns of Hermes transposition in Drosophila melanogaster.

Authors:  N Guimond; D K Bideshi; A C Pinkerton; P W Atkinson; D A O'Brochta
Journal:  Mol Genet Genomics       Date:  2003-01-25       Impact factor: 3.291

3.  Intrinsic characteristics of neighboring DNA modulate transposable element activity in Drosophila melanogaster.

Authors:  Caroline Esnault; Azhahianambi Palavesam; Kristina Pilitt; David A O'Brochta
Journal:  Genetics       Date:  2010-10-13       Impact factor: 4.562

4.  PiggyBac transposon-mediated gene transfer in human cells.

Authors:  Matthew H Wilson; Craig J Coates; Alfred L George
Journal:  Mol Ther       Date:  2007-01       Impact factor: 11.454

Review 5.  piRNAs, transposon silencing, and germline genome integrity.

Authors:  Julio Castañeda; Pavol Genzor; Alex Bortvin
Journal:  Mutat Res       Date:  2011-05-11       Impact factor: 2.433

6.  Excision of the piggyBac transposable element in vitro is a precise event that is enhanced by the expression of its encoded transposase.

Authors:  T A Elick; C A Bauser; M J Fraser
Journal:  Genetica       Date:  1996-07       Impact factor: 1.082

7.  Post-integration behavior of a Mos1 mariner gene vector in Aedes aegypti.

Authors:  Raymond Wilson; Jamison Orsetti; Andrew D Klocko; Channa Aluvihare; Edward Peckham; Peter W Atkinson; Michael J Lehane; David A O'Brochta
Journal:  Insect Biochem Mol Biol       Date:  2003-09       Impact factor: 4.714

8.  The expanding universe of transposon technologies for gene and cell engineering.

Authors:  Zoltán Ivics; Zsuzsanna Izsvák
Journal:  Mob DNA       Date:  2010-12-07

9.  The mosquito Aedes aegypti has a large genome size and high transposable element load but contains a low proportion of transposon-specific piRNAs.

Authors:  Peter Arensburger; Robert H Hice; Jennifer A Wright; Nancy L Craig; Peter W Atkinson
Journal:  BMC Genomics       Date:  2011-12-15       Impact factor: 3.969

10.  piggyBac is an effective tool for functional analysis of the Plasmodium falciparum genome.

Authors:  Bharath Balu; Chitra Chauhan; Steven P Maher; Douglas A Shoue; Jessica C Kissinger; Malcolm J Fraser; John H Adams
Journal:  BMC Microbiol       Date:  2009-05-07       Impact factor: 3.605

View more
  8 in total

1.  The sex locus is tightly linked to factors conferring sex-specific lethal effects in the mosquito Aedes aegypti.

Authors:  E Krzywinska; V Kokoza; M Morris; E de la Casa-Esperon; A S Raikhel; J Krzywinski
Journal:  Heredity (Edinb)       Date:  2016-08-03       Impact factor: 3.821

Review 2.  Control of Mosquito-Borne Infectious Diseases: Sex and Gene Drive.

Authors:  Zach N Adelman; Zhijian Tu
Journal:  Trends Parasitol       Date:  2016-02-17

3.  Sequencing and de novo assembly of the transcriptome of the glassy-winged sharpshooter (Homalodisca vitripennis).

Authors:  Raja Sekhar Nandety; Shizuo G Kamita; Bruce D Hammock; Bryce W Falk
Journal:  PLoS One       Date:  2013-12-10       Impact factor: 3.240

4.  The piggyBac-Based Gene Delivery System Can Confer Successful Production of Cloned Porcine Blastocysts with Multigene Constructs.

Authors:  Masahiro Sato; Kosuke Maeda; Miyu Koriyama; Emi Inada; Issei Saitoh; Hiromi Miura; Masato Ohtsuka; Shingo Nakamura; Takayuki Sakurai; Satoshi Watanabe; Kazuchika Miyoshi
Journal:  Int J Mol Sci       Date:  2016-08-30       Impact factor: 5.923

5.  Intravenous Delivery of piggyBac Transposons as a Useful Tool for Liver-Specific Gene-Switching.

Authors:  Shingo Nakamura; Masayuki Ishihara; Satoshi Watanabe; Naoko Ando; Masato Ohtsuka; Masahiro Sato
Journal:  Int J Mol Sci       Date:  2018-11-02       Impact factor: 5.923

6.  The hAT-family transposable element, hopper, from Bactrocera dorsalis is a functional vector for insect germline transformation.

Authors:  Alfred M Handler; Marc F Schetelig
Journal:  BMC Genet       Date:  2020-12-18       Impact factor: 2.797

Review 7.  Neuroprotective therapies in glaucoma: II. Genetic nanotechnology tools.

Authors:  Nafiseh Nafissi; Marianna Foldvari
Journal:  Front Neurosci       Date:  2015-10-14       Impact factor: 4.677

8.  nanos-Driven expression of piggyBac transposase induces mobilization of a synthetic autonomous transposon in the malaria vector mosquito, Anopheles stephensi.

Authors:  Vanessa M Macias; Alyssa J Jimenez; Bianca Burini-Kojin; David Pledger; Nijole Jasinskiene; Celine Hien Phong; Karen Chu; Aniko Fazekas; Kelcie Martin; Osvaldo Marinotti; Anthony A James
Journal:  Insect Biochem Mol Biol       Date:  2017-07-01       Impact factor: 4.714

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.