Literature DB >> 23840756

Beilschmiedia turbinata: a newly recognized but dying species of Lauraceae from tropical Asia based on morphological and molecular data.

Bing Liu1, Yong Yang, Lei Xie, Gang Zeng, Keping Ma.   

Abstract

China took great efforts to reforestation, even turned the long-term forest loss into a net gain, but this cannot hide the loss of species diversity due to destruction of primary forests, habitat loss, invasion of alien species, and over exploitation. Here we provide such a case by recording a dying tree species of Lauraceae from the evergreen forests of SE Yunnan of China and adjoining Vietnam. We made field collections and observations for four consecutive years from 2009 to 2012. Phylogenetic analyses were conducted based on a combined dataset from nrITS and plastid trnL-trnF region, rpl16 intron, and psbA-trnH spacer. The results indicate that the Asiatic Beilschmiedia and Syndiclis are reciprocally monophyletic with Endiandra as a sister group, and both morphology and molecular phylogeny clearly suggest that the new species belongs to Beilschmiedia. Thus Beilschmiedia turbinata Bing Liu et Y. Yang is illustrated and described as new to science, color plates, line drawings, distribution map and comparison with related species are provided. This new species is similar to B. yunnanensis in the small and ferruginous-brown tomentose terminal buds, elliptic to oblong-lanceolate and alternate or subopposite leaves bearing the fine veinlet reticulation, but differs from the latter by the smaller flowers, the eglandular stamens of the third whorl, and the large turbinate furfuraceous fruits.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23840756      PMCID: PMC3695919          DOI: 10.1371/journal.pone.0067636

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Global biodiversity loss is a serious problem due to habitat loss, overexploitation, biological invasion, pollution, and global climate change according to the Millennium Ecosystem Assessment [1], and it is the case in China as well. Though China took great efforts in reforestation, and even turned the long-term forest loss into a net gain, the increased forest cover mainly consists of non-native tree crops but not regenerating natural forest [2]. The primary forest was continuously cut down and transformed into monoculture plantations of non-native economic trees [2]–[4]. After privatization of former collective forests since 2008, smallholders often cut natural forests for immediate income, then plant monoculture tree crops for long-term investment [2]. Because loss of native species diversity is masked under the increasing reforestation, it is more serious than what people thought [2], [5], especially in areas with high species richness, e.g. Yunnan of China. Southeast Yunnan of China, adjoining to Vietnam and Laos, preserves the northernmost tropical rainforests in Asia, and harbors extremely high diversity of plant species [6], with more than 7000 native species of flowering plants [7], and falls within one of the biodiversity hotspots in the world [8], but experienced a fast loss of species due to farming, logging, habitat loss, and vegetation destruction. Many species were thus eliminated from the earth before they were recognized and described. Here we describe a critically threatened tree species of Lauraceae from the evergreen forest of SE Yunnan of China based on field investigations in SE Yunnan and N Vietnam in the last four years and a detailed comparative study including morphology, anatomy, and molecular systematics analyses. The Lauraceae are typical elements of SE Asia, and are also well represented in SE Yunnan of China [9]–[10]. The pantropical genus Beilschmiedia Nees is one of the largest genera within the family, containing ca. 250 species worldwide [11]–[13], and includes common trees in tropical Asia [9]. In addition to old publications of Liou [14] and Kostermans [15], a few regional revisions on this genus have recently been completed, e.g. America [16], Borneo [17], Madagascar [13], and China [18]. It is difficult to distinguish Beilschmiedia from its close relatives due to overlapping characters [19]–[20], e.g. Potameia (Madagascar), Endiandra (mostly in Australia, three species in China), Syndiclis (mostly in China), Sinopora (Hong Kong), and Yasunia (S America), which together belong to the Beilschmiedia group [20]. The genus Beilschmiedia has been recognized based on a combination of characters: cymose-paniculate inflorescences with the lateral flowers of the cymes not strictly opposite but somewhat alternate [21], trimerous flowers bearing usually nine but sometimes six fertile stamens, anthers 2-celled, and small tepals rarely persistent at the base of fruits. None of these characters, however, can distinguish this genus from its close relatives [13], [20]. The minor venation pattern is a useful character to delimit Beilschmiedia species, and could be divided into two groups: fine type and coarse type [16]. Cuticular characters were sometimes used to determine generic ascription [19]–[20], [22], and indeed, leaf cuticular morphology is a good marker to define Syndiclis [22]. We tried several times to extract cuticles of our new species, but failed, because the epidermis of this new species is strongly thickened, in which it differs from all other known Asiatic species of the Beilschmiedia group [22]. Molecular phylogenetics based on DNA sequencing nowadays becomes a regular approach in plant systematics. In addition to the big phylogeny of the Lauraceae [23]–[24], a few molecular systematic studies were conducted on Lauraceae to discuss the generic relationships, e.g. Litsea complex [25]–[27], Neolitsea [26]–[28], Neocinnamomum [29]–[30], Actinodaphne [26]–[27], [31], and Persea group [32]–[33], but the Beilschmiedia group was poorly sampled. For the Beilschmiedia group in the Tropical East Asia (Beilschmiedia, Sinopora, Syndiclis, and Endiandra), it is difficult to separate Endiandra and Syndiclis from Beilschmiedia. This group is poorly represented in previous molecular phylogenetic studies of Lauraceae [23]–[24], [29]. To determine the generic ascription of our new species, we sampled twelve species of Asiatic Beilschmiedia, two Endiandra, and four Syndiclis, which is the most extensive sampling of the Beilschmiedia group thus far, no DNA analysis has been applied in Lauraceae to determine the taxonomic ascription of newly described species thus far. Both nuclear ribosomal ITS and chloroplast DNA fragments (trnL-trnF, rpl16 and psbA-trnH) were sequenced. This phylogenetic study is helpful to determine the taxonomic position of the newly recorded species in addition to morphological evidence.

Materials and Methods

Ethics Statement

The field investigations were carried out in collective forests in Sumawan of China and Thanh Thuy of Vietnam, which are owned by the local village, but not protected area of state-owned land. The village head of Sumawan, Mr. Maorong Tian, gave us permissions to conduct the investigations and recommended two villagers as guides for us. Đào Thiêu assisted us collecting in Thanh Thuy of Vietnam.

Morphology and Anatomy

We surveyed three sites which cover the whole known distribution area of the new species. The voucher specimens, FAA-pickled materials, measurements, and photographs of vegetative and reproductive characters were obtained in the field. Anatomical observations of leaflet venation pattern and floral structure were taken under light microscope (Zeiss Axio Imager A1) in LSEB (State Key Laboratory of Systematic and Evolutionary Botany), IBCAS (Institute of Botany, the Chinese Academy of Sciences). Beilschmiedia yunnanensis Hu is close to the new species in morphology, and the two species were compared in detail.

Assessment of Conservation Status

We estimated the population size in the field, investigated the threat factors, and assessed the endangered category according to IUCN red list criterion [34]. The distribution map and calculation of EOO (extent of occurrence) were made by usingArgGIS ver. 9.3 [35].

Molecular Systematics

To determine the systematic position of our new species, thirty-two samples belonging to nineteen species of four genera (Beilschmiedia, Endiandra, Syndiclis, and Cryptocarya) were included in this study. All but the new one were recorded in Flora of China [18]. Leaf materials for DNA extraction were dried with silica gel. Vouchers of samples (Tab. 1) were deposited in the National Herbarium (PE), IBCAS. Cryptocarya calcicola H. W. Li is selected as the outgroup of Beilschmiedia, Endiandra, and Syndiclis. Due to lacking DNA samples and sequences in the Gene Bank, Beilschmiedia species outside China were not integrated into our analyses.
Table 1

Vouchers and accession numbers of sequences.

SpeciesVoucherLocalityAccession no.
nrITS trnL-trnF rpl16 psbA-trnH
Beilschmiedia appendiculata (C.K. Allen) S.K. Lee et Y.T. Wei B. Liu 1504 Guangzhou, Guangdong, China. Cult.KC958643KC958611KC958675KC958707
B. fordii Dunn B. Liu 1080 Shangsi, Guangxi, ChinaKC958625KC958593KC958657KC958689
B. delicata S.K. Lee et Y.T. Wei B. Liu 1451 Gulin, Sichuan, ChinaKC958642KC958610KC958674KC958706
B. delicata S.K. Lee et Y.T. Wei F. Q. Liu s. n. Enshi, Hubei, ChinaKC958641KC958609KC958673KC958705
B. glauca var. glaucoides H.W. Li B. Liu 1323 Malipo, Yunnan, ChinaKC958638KC958606KC958670KC958702
B. kweichowensis Cheng B. Liu 1419 Libo, Guizhou, ChinaKC958631KC958599KC958663KC958695
B. laevis C.K. Allen B. Liu 1270 Guangzhou, Guangdong, China. Cult.KC958626KC958594KC958658KC958690
B. linocieroides H.W. Li B. Liu 1479 Jinping, Yunnan, ChinaKC958627KC958595KC958659KC958691
B. percoriacea C.K. Allen B. Liu 1254 Xishuangbanna, Yunnan, China. Cult.KC958628KC958596KC958660KC958692
B. purpurascens H.W. Li B. Liu 1321 Malipo, Yunnan, ChinaKC958629KC958597KC958661KC958693
B. purpurascens H.W. Li B. Liu 1443 Malipo, Yunnan, ChinaKC958630KC958598KC958662KC958694
B. robusta C.K. Allen B. Liu 1466 Maguan, Yunnan, ChinaKC958632KC958600KC958664KC958696
B. robusta C.K. Allen B. Liu 1481 Jinping, Yunnan, ChinaKC958633KC958601KC958665KC958697
B. robusta C.K. Allen B. Liu 1428 Malipo, Yunnan, ChinaKC958634KC958602KC958666KC958698
B. rufohirtella H.W. Li B. Liu 1302 Malipo, Yunnan, ChinaKC958635KC958603KC958667KC958699
B. rufohirtella H.W. Li B. Liu 1493 Xichou, Yunnan, ChinaKC958636KC958604KC958668KC958700
B. rufohirtella H.W. Li B. Liu 1430 Malipo, Yunnan, ChinaKC958637KC958605KC958669KC958701
B. turbinata Bing Liu et Y. Yang B. Liu 1442 Malipo, Yunnan, ChinaKC958639KC958607KC958671KC958703
B. turbinata Bing Liu et Y. Yang B. Liu 1185 Malipo, Yunnan, ChinaKC958640KC958608KC958672KC958704
B. yunnanensis Hu B. Liu 1473 Maguan, Yunnan, ChinaKC958644KC958612KC958676KC958708
B. yunnanensis Hu B. Liu 1484 Jinping, Yunnan, ChinaKC958645KC958613KC958677KC958709
B. yunnanensis Hu B. Liu 1439 Malipo, Yunnan, ChinaKC958646KC958614KC958678KC958710
B. yunnanensis Hu B. Liu 1474 Maguan, Yunnan, ChinaKC958647KC958615KC958679KC958711
Cryptocarya calcicola H.W. Li B. Liu 1457 Malipo, Yunnan, ChinaKC958656KC958624KC958688KC958720
Endiandra coriacea Merr. J. F. Ye s. n. Taizhong, Taiwan, China. Cult.KC958655KC958623KC958687KC958719
E. dolichocarpa S.K. Lee et Y.T. Wei B. Liu 1381 Jinping, Yunnan, ChinaKC958653KC958621KC958685KC958717
E. dolichocarpa S.K. Lee et Y.T. Wei B. Liu 1480 Jinping, Yunnan, ChinaKC958654KC958622KC958686KC958718
Syndiclis anlungensis H.W. Li B. Liu 1452 Anlong, Guizhou, ChinaKC958648KC958616KC958680KC958712
S. marlipoensis H.W. Li B. Liu 1282 Malipo, Yunnan, ChinaKC958649KC958617KC958681KC958713
S. marlipoensis H.W. Li B. Liu 1420 Malipo, Yunnan, ChinaKC958650KC958618KC958682KC958714
Syndiclis sp. B. Liu 1472 Maguan, Yunnan, ChinaKC958651KC958619KC958683KC958715
Syndiclis sp. B. Liu 1486 Pingbian, Yunnan, ChinaKC958652KC958620KC958684KC958716
Total DNA was extracted from silica-gel-dried leaves using Tiangen® extraction kits. Polymerase chain reaction amplification was accomplished using Prime Taq DNA Polymerase with annealing temperatures of 50°C. The ITS region was amplified with primer pair ITS4, ITS5 [36] and C26A, 18S [37]. The chloroplast trnL-trnF region was amplified using primers designed by Taberlet et al. [38]. For some special species, the sequences of Beilschmiedia and related genera were obtained by our own designed primers, and the suitable annealing temperature is 50°C. The rpl16 intron and psbA-trnH spacer were amplified using primers of Sang et al. [39] and Kelchner et al. [40], respectively. All the primers used in this study are listed in Tab. 2.
Table 2

Primers used for polymerase chain reaction amplification and sequencing.

PrimerSequence 5′-3′Reference
ITS 4 TCCTCCGCTTATTGATATGC White et al., 1990
ITS 5 GGAAGTAAAAGTCGTAACAAGG White et al., 1990
ITS C26A GTTTCTTTTCCTCCGCT Wen et al., 1996
ITS 18S AGGAGAAGTCGTAACAAG Wen et al., 1996
trnL-trnF f ATTTGAACTGGTGACACGAG Taberlet et al., 1991
trnL-trnF c CGAAATCGGTAGAGGCTACG Taberlet et al., 1991
trnL-trnF FC CTTAAACTCAGCGGGTGGTCC this study
trnL-trnF RA TAACAAGGTTTCCGTAGGTGAAC this study
rpl16 f71 GCTATGCTTAGTGTGTGACTCGTTG Kelchner, 1997
rpl16 r1516 CCCTTCATTCTTCCTCTATGTTG Kelchner, 1997
psbA 3F GTTATGCATGAACGTAATGCTC Sang et al., 1997
trnH 3R CGCGCATGGTGGATTCACAATCC Sang et al., 1997
Sequences were manually aligned using the Sequence Alignment Editor (Se-Al Carbon) v2.0 [41]. Bayesian inference (BI) and Maximum parsimony (MP) analyses based on the combined datasets of nuclear ribosomal ITS and chloroplast trnL-trnF, rpl16, psbA-trnH were carried out in MrBayes 3.1.2 [42] and PAUP 4.0 [43]. The poly-T and poly-A regions were removed from the sequences during analyses.

Nomenclature

The electronic version of this article in Portable Document Format (PDF) in a work with an ISSN or ISBN will represent a published work according to the International Code of Nomenclature for algae, fungi, and plants, and hence the new names contained in the electronic publication of a PLOS ONE article are effectively published under that Code from the electronic edition alone, so there is no longer any need to provide printed copies. In addition, new names contained in this work have been submitted to IPNI, from where they will be made available to the Global Names Index. The IPNI LSIDs can be resolved and the associated information viewed through any standard web browser by appending the LSID contained in this publication to the prefix http://ipni.org/. The online version of this work is archived and available from the following digital repositories: PubMed Central, LOCKSS.

Results

Description of the New Species

Beilschmiedia turbinate

Bing Liu & Y. Yang sp. nov. Figs. 1, 2 77128395-1.
Figure 1

Illustrations of Beilschmiedia turbinata Bing Liu & Y. Yang showing morphological details.

A, seedling; B, Flowering branch; C, flower; D, flower (front part removed); E, the first whorl perianth lobe; F, the second whorl perianth lobe; G. the first whorl stamen (adaxial view); H, the second whorl stamen (adaxial view); I, the third whorl stamen (abaxial view); J, the fourth whorl staminode (abaxial view); K, pistil showing the pubescent ovary; L, terminal bud; M, venation pattern (abaxial view); N, fruiting branch in the second year; O, a young fruit in the first year (Drawn by Y. B. Sun, A from Bing Liu 1184, B–M from Bing Liu 1442, N–O from Bing Liu 1185, PE).

Figure 2

Morphology of Beilschmiedia turbinata Bing Liu et Y. Yang.

A, trunk (showing brownish gray bark); B–C, the pubescent terminal bud; D, flowering branch; E, inflorescence; F, flower (showing the trimerosity and the pubescent tepals, the included 2-celled stamens with the outer two whorls introrse and adnate to tepals but the third whorl getting close and adnate to the pistil); G, seedling (showing the alternative leaves on the new sprout); H, a young fruit in the first year bearing a conspicuously thickened pedicel; I, a large, ferruginous-furfuraceous turbinate, mature fruit.

Illustrations of Beilschmiedia turbinata Bing Liu & Y. Yang showing morphological details.

A, seedling; B, Flowering branch; C, flower; D, flower (front part removed); E, the first whorl perianth lobe; F, the second whorl perianth lobe; G. the first whorl stamen (adaxial view); H, the second whorl stamen (adaxial view); I, the third whorl stamen (abaxial view); J, the fourth whorl staminode (abaxial view); K, pistil showing the pubescent ovary; L, terminal bud; M, venation pattern (abaxial view); N, fruiting branch in the second year; O, a young fruit in the first year (Drawn by Y. B. Sun, A from Bing Liu 1184, B–M from Bing Liu 1442, N–O from Bing Liu 1185, PE).

Morphology of Beilschmiedia turbinata Bing Liu et Y. Yang.

A, trunk (showing brownish gray bark); B–C, the pubescent terminal bud; D, flowering branch; E, inflorescence; F, flower (showing the trimerosity and the pubescent tepals, the included 2-celled stamens with the outer two whorls introrse and adnate to tepals but the third whorl getting close and adnate to the pistil); G, seedling (showing the alternative leaves on the new sprout); H, a young fruit in the first year bearing a conspicuously thickened pedicel; I, a large, ferruginous-furfuraceous turbinate, mature fruit.

Type

China. Yunnan Province: Malipo County, Tianbao, Sumawan, Long. 104.84 E, Lat. 22.98 N, 24 Sept 2011, flowering, Bing Liu 1442 (holotype, PE).

Diagnosis

Haec species nova ramulis juvenilibus, gemmis terminalibus foliisque juvenilibus dense fulvo-tomentosis, glandulis staminium ordinis III absentibus, fructibus turbinatis et ferrugineo-furfuraceis, valde magnis, ad 7.2 cm longis, 4.6 cm in diametro inter alia distinguenda.

Description

Trees, up to 25 m tall, to 1 m in DBH (diameter at breast height). Bark brownish gray. Branchlets 1.6–2 mm in diam., grayish brown, lenticellate, green, ferruginous-brown pubescent when young and blackish brown when dry. Terminal buds small type, 4–5 mm long, densely ferruginous-brown tomentose. Leaves alternate or subopposite; leaf blade broadly lanceolate, elliptic to elliptic-lanceolate, 7–12(−16)×2.2–4.2(−6) cm, base broadly cuneate to obtuse, often oblique, apex caudate-acuminate, midrib elevated on both surfaces, lateral veins 4–6(−7) pairs, immersed on upper surface but elevated on lower surface, minor veins slender, connected into fine type of minor venation pattern, covered with dense ferruginous pubescence on both surfaces when young, but glabrescent soon; petiole 1.4–2 cm long, densely ferruginous tomentose when young. Inflorescences paniculate; panicles terminal or axillary, 4.5–8×3–5.5 cm, few flowered; rachises slightly robust, sparsely ferruginous tomentose; bracts ovate, 2–3 mm long, caducous; flowers yellowish green, ca. 1.5 mm in length, 3 mm in diam.; pedicels 2–2.5 mm, sparsely tomentose; perianth lobes 6, ovate or broadly ovate, 1.2×1 mm, pubescent on both surfaces. Fertile stamens nine in three whorls, eglandular, subequal, ca. 1 mm long, filaments short but present and densely pubescent; anthers 2-celled, cells of the first and second whorls of stamens introrse, and those of the third whorl extrorse, the tip of anthers glabrous; staminodes of fourth series long-triangular and pubescent, ca. 0.6 mm long; pistils pyriform, pubescent, style short, ca. 0.3 mm. Each infrutescence usually bearing one single mature fruit; fruits maturing in two years. Young fruits of the first year ovoid, 2.5–3×1.5–1.8 cm. Mature fruits large and turbinate, 5.4–7.2×3.8–4.6 cm, apex obtuse, base attenuate, densely ferruginous-furfuraceous, having 16–20 irregular longitudinal ridges; fruiting pedicles conspicuously thickened and robust, 1.3–1.8 cm in diam. Young seedlings up to 40 cm in height, leaves alternate on the new sprout, the cotyledons retained for one or two years.

Distribution

This species was only found in the border of China (Malipo County of Yunnan Province) and Vietnam (Vi Xuyen County of Ha Giang Province) (Fig. 3).
Figure 3

Geographical occurrences of Beilschmiedia turbinata Bing Liu et Y. Yong and B. yunnanensis Hu.

Triangles represent B. turbinata, and circles refer to B. yunnanensis.

Geographical occurrences of Beilschmiedia turbinata Bing Liu et Y. Yong and B. yunnanensis Hu.

Triangles represent B. turbinata, and circles refer to B. yunnanensis.

Habit & Ecology

The species inhabits limestone soils of primary forests on hills with altitudinal ranges from 1000 to 1200 m. Associated tree species include Beilschmiedia purpurascens H.W. Li, B. delicata S.K. Lee et Y. T. Wei, Cinnamomum saxatile H.W. Li, Actinodaphne obovata (Nees) Blume, Litsea yunnanensis Y.C. Yang et P.H. Huang, Lindera gracilipes H.W. Li, Cryptocarya sp., Caryodaphnopsis sp., Cyclobalanopsis spp., Lithocarpus sp., Garcinia sp., Syzygium austroyunnanense H.T. Chang et R.H. Miao, Aglaia testicularis C.Y. Wu, Amoora sp., Pittosporum sp., and Ostodes katharinae Pax. It blooms from September to October, and fruiting season is from October to November; it takes two years for fruits to get mature.

Conservation

There is only one population with ca. 30 adult trees across the boundary of China and Vietnam. These mature individual trees are dispersed in the evergreen broad-leaved forest of ca. 20 km2 (EOO). The trees were cut down for construction leading to the population decline. Moreover, increasing human economic activities, e.g. the surrounding reclamation of farmlands, construction of border roads, and rubber plantations, are resulting in the fragmentation of the population, and threatening the existence of the new species and its living habitat. Our field observation found dozens of seedlings nearby the parent trees, but no young sapling exists. Alien species (e.g. Chromolaena odorata (L.) R. M. King et H. Rob. and Crassocephalum rubens (Jacq.) S. Moore) are also found nearby. Consequently, we here tentatively consider the new species to be “Critically Endangered” (CR Blab (v)+D), according to IUCN red list category and criterion [34].

Etymology

The specific epithet “turbinate” of this new species is from its turbinate shape of fruits.

Additional specimens examined

China. Yunnan Province: Malipo County, Tianbao, Sumawan, Long. 104.84 E, Lat. 22.98 N, 15 Nov 2010, fruits, Bing Liu 1185 (PE); Vietnam. Ha Giang Province: Vi Xuyen County, Thanh Thuy, Long. 104.86 E, Lat. 22.98 N, 15 Nov 2010, seedling, Bing Liu 1184 (PE).

Systematics

Partition homogeneity test between nrITS and chloroplast sequences was carried out using PAUP and the P value is 0.07. Therefore, we combined them into one dataset, representing 2618 characters, including 163 characters that were parsimony-uninformative and 135 characters that were parsimony-informative. Analyses of nrITS, trnL-trnF, rpl16, psbA-trnH and combined regions were carried out using MP (heuristic search) and the results are shown in Tab. 3, and the Bayesian consensus tree based on combined sequence data is shown in Fig. 4.
Table 3

Summary of parsimony analyses and data properties for nuclear ribosomal internal transcribed spacer (nrITS), chloroplast trnL-trnF, rpl16, psbA-trnH, and combined regions.

DNA regionITS trnL-trnF rpl16 psbA-trnH combined
Length of sequences [bp] 600–642597–614775–803463–5022496–2547
Length of alingment [bp] 6686267745082618
Variable sites (%) 70 (10.48)35 (5.59)36 (4.65)22 (4.34)163 (6.22)
Parsimony-informative sites (%) 78 (11.68)36 (5.75)6 (0.78)15 (2.95)135 (5.16)
Consistency index (CI) 0.75770.68471.00000.92680.7466
Retention index (RI) 0.84760.61961.00000.94830.7910
Rescaled consistency index (RC) 0.64230.42421.00000.87890.5906
Figure 4

Bayesian consensus of 18001 trees based on combined sequence data of nrITS and trnL-trnF, rpl16, psbA-trnH analysis.

Bayesian posterior probability values greater than 0.9 (left) and bootstrap support value greater than 50 (right) are shown on the branches. The different types of terminal buds are illustrated on the right.

Bayesian consensus of 18001 trees based on combined sequence data of nrITS and trnL-trnF, rpl16, psbA-trnH analysis.

Bayesian posterior probability values greater than 0.9 (left) and bootstrap support value greater than 50 (right) are shown on the branches. The different types of terminal buds are illustrated on the right. The result indicates that Syndiclis and Beilschmiedia are reciprocally monophyletic with the monophyletic Endiandra as outgroup, and Beilschmiedia turbinata clearly belongs to Beilschmiedia, though the position of the species is not well resolved within the genus (Fig. 4). In addition, this new species has typical Beilschmiedia morphology such as the trimerous flowers, nine fertile stamens in three whorls, fruits lacking persistent perianth lobes. This suggests that the new species is a Beilschmiedia but markedly differs from Syndiclis and Endiandra. Beilschmiedia turbinata shows great similarities to B. yunnanensis in morphology, but it is not conclusive whether B. turbinata and B. yunnanensis are basal to other Beilschmiedia species or not due to the low bootstrap value (<50%).

Discussion

Morphological Comparison

Beilschmiedia turbinata possesses a unique set of morphological characters, e.g. the small type of terminal buds densely pubescent, elliptic to lanceolate elliptic leaves having fine veinlet reticulations, the trimerous flowers bearing nine eglandular fertile stamens in three whorls, and the large ferruginous-furfuraceous turbinate fruits. This new species is similar to B. yunnanensis in the small type and ferruginous-brown tomentose terminal buds, alternate or subopposite elliptic to oblong-lanceolate leaves, the elevated midrib, and the fine veinlet reticulation (Fig. 5), but differs from the latter by the smaller flowers (3 mm in diam. in the new species vs. up to 8 mm in B. yunnanensis), the eglandular stamens of the third whorl (vs. each of the three fertile stamens of the third whorl bearing two sagittate glands in B. yunnanensis), and the ovoid to turbinate, large, 5.4–7.2×3.8–4.6 cm, and densely ferruginous-furfuraceous (vs. ellipsoid to globose or subglobose, smaller, 2–4×1.5–2.7 cm in B. yunnanensis) (Fig. 5).
Figure 5

Comparison between Beilschmiedia turbinata Bing Liu et Y. Yang and B. yunnanensis Hu.

A–E, B. turbinata Bing Liu & Y. Yang. A, leaf blade; B, the small type terminal bud bearing ferruginous-brown pubescence; C, leaf upper surface showing fine vein reticulation; D, flower (front part removed showing: a, the third whorl subsessile fertile stamen; b, the fourth whorl staminode ); E, the large, ferruginous-furfuraceous turbinate fruits. F–J, B. yunnanensis Hu. F, leaf blade; G, the small type terminal bud bearing brownish pubescence; H, leaf upper surface showing fine vein reticulation; I, flower (front part removed showing: c, the third whorl stalked and glandular fertile stamen; d, the sagittate gland at the base of the third whorl stamen; e, the fourth whorl staminode); J, the smaller ellipsoid fruits.

Comparison between Beilschmiedia turbinata Bing Liu et Y. Yang and B. yunnanensis Hu.

A–E, B. turbinata Bing Liu & Y. Yang. A, leaf blade; B, the small type terminal bud bearing ferruginous-brown pubescence; C, leaf upper surface showing fine vein reticulation; D, flower (front part removed showing: a, the third whorl subsessile fertile stamen; b, the fourth whorl staminode ); E, the large, ferruginous-furfuraceous turbinate fruits. F–J, B. yunnanensis Hu. F, leaf blade; G, the small type terminal bud bearing brownish pubescence; H, leaf upper surface showing fine vein reticulation; I, flower (front part removed showing: c, the third whorl stalked and glandular fertile stamen; d, the sagittate gland at the base of the third whorl stamen; e, the fourth whorl staminode); J, the smaller ellipsoid fruits. Beilschmiedia turbinata also shares similar characters with B. dictyoneura Kosterm. from Borneo in having eglandular stamens [17], but they are easily distinguished: B. dictyoneura bears glabrous twigs and leaves, larger terminal buds, and smaller fruits, 1.5 cm×1 cm [17]. A few species from Southeast Asia also bear large fruits, e.g. Beilschmiedia macrocarpa A. Chev. ex H. Liou from S Vietnam, with the ovoid fruits up to 6.2 cm [14]; it differs from B. turbinata by its large terminal buds (vs. small terminal buds) and coarse veinlet reticulation (vs. fine veinlet reticulation). Beilschmiedia gigantocarpa Kosterm. from Sulawesi, B. glauciphylla Kosterm., B. gynotrochioides Kosterm. and B. kinabaluensis Kosterm. from Borneo, all bear fruits larger than 5 cm in diam. [17], [44]. Beilschmiedia turbinata can be easily distinguished from them by the turbinate shape of fruits vs. spindle-shaped shape of fruits in B. glauciphylla and B. gynotrochioides, globose to subglobose shape of fruits in B. gigantocarpa and B. kinabaluensis.

Phylogenetic and Morphological Implications

Beilschmiedia is mixed with allied genera (e.g. Potameia and Endiandra) according to previous studies [24], [29]. Sampling in these studies is poor, there are only six species of Beilschmiedia, two of Potameia, and one of Endiandra in Chanderbali et al. [24], seven species of Beilschmiedia, one of Potameia, and three of Endiandra in Rohwer & Rudolph [29], and these samplings are common in lacking Asiatic species. We sampled nineteen Asiatic species of the group (mostly from Yunnan) with the highest sampling density of the Beilschmiedia group so far. Our new phylogenetic analysis suggested that the new species belongs to the genus Beilschmiedia. Morphology of the terminal buds is useful in classification of the genus Beilschmiedia [16]–[18], [45]–[46]. Hooker [44] even divided Beilschmiedia into two sections mainly by the type of terminal buds: Sect. I, leaves opposite or alternate, terminal buds very small, pubesent or tomentose, not enclosed in coriaceous scales; Sect. II, leaves usually opposite, terminal buds enclosed in large glabrous coriaceous scales. According to the phylogenetic tree of this study, species bearing large type of terminal buds do constitute a well-supported clade (Fig. 4), and are considered to be derived from the species of small type. Beilschmiedia yunnanensis and B. turbinata, occupying the basal position of this genus, both have the small type terminal bud. Worldwide sampling of the Beilschmiedia group is necessary to test and verify whether this character is useful for subgeneric classification or not.

Conservation Significance

Conservation status of B. turbinata warrants our attention. The new species is an endangered species and listed as CR, which is attributed to population decline, habitat loss, and alien species invasions because of increasing human activities in the area. Large trees of the species were cut down for construction. Expansion of farmlands and rubber plantations results in deforestation, and of course, habitat loss and fragmentation of population of the species. Road building causes fragmentation of population of the new species. Alien species invasions had potential impacts on both seed germination and growth of seedlings, and young seedlings might be difficult to grow up because of the lean soils and pressure of competition from both native and alien species. These factors are also major threats of regional biodiversity in Tropical Asia [5], [9]. Yunnan Province is located in the SW China, harbors more than half the total species in China, and is the province with the highest floristic richness [47]. Within Yunnan Province, the southeastern and southern regions are the most important and abundant center of plant diversity. More than 7000 species of flowering plants are native to the Southeast Yunnan alone [7], and over 4000 species are reported from southern Yunnan [48]. However, Yunnan remains an active area for plant taxonomic studies, there are 55 publications every year related to “new species”+“Yunnan”+“plant” during 2000 and 2012 according to ISI website searching. The floristic inventory of Yunnan is far from being completed, and description of new species may not catch up with the extinction of local plants due to over exploitation, habitat loss, and invasion of alien species. The local governments have made great efforts to develop cash crops in the tropical areas, especially in southern Yunnan and lowlands of southeast Yunnan. Plantations occupy a large area previously occupied by old-growth primary forests, leading to deforestation and environmental destruction much more serious than several decades ago. Wang [49] took part in the China-Russia joint expedition to southern Yunnan in 1950’s, and revisited the same area in 1990’s. According to his observation in the air and on-the-spot investigation, both appearance and composition of the forests in southern Yunnan had greatly changed within the 40 years. The canopy color of the forest was dark green with very thick forests in 1950’s, but was changed into light green with many open places in 1990’s. Many of the primary forests with abundant species were cut down and transformed into economic monoculture forests (e.g. rubber), and the local biodiversity in south Yunnan was precipitously reduced. Transformation of forest structure has negative effects not only on plant species, but also on insects [3]. The rubber plantations are less than 5 kilometers away from the forest where our new species was collected. Local villagers are unaware of protection, but still utilize the timbers by logging the large trees and substituting the forests with economic trees. The rapid economic development mode at the price of destruction of native vegetation was called into questions and even caused a lot of criticism [2], [49]–[50]. Vegetation shifts caused by human disturbance have led to changes of floristic components and severe species loss [4]. Beilschmiedia turbinata, probably once a more widespread species, but became a dying species in SE Yunnan, sounds the alarm again that conservation of the primary forests is urgent. Nyssa yunnanensis W.Q. Yin ex H.N. Qin & Phengklai of Nyssaceae also experienced a similar process [51]. As a result, conservation of primary vegetation and endangered species of this biodiversity hot spot is quite worrying, conservation action is necessary. This finding furthers that botanical investigations are urgently needed before the primary forests are cut down and replaced by economic crops, e.g. rubber, eucalyptus, and banana.
  9 in total

1.  Biodiversity hotspots for conservation priorities.

Authors:  N Myers; R A Mittermeier; C G Mittermeier; G A da Fonseca; J Kent
Journal:  Nature       Date:  2000-02-24       Impact factor: 49.962

2.  MRBAYES: Bayesian inference of phylogenetic trees.

Authors:  J P Huelsenbeck; F Ronquist
Journal:  Bioinformatics       Date:  2001-08       Impact factor: 6.937

3.  China's new forests aren't as green as they seem.

Authors:  Jianchu Xu
Journal:  Nature       Date:  2011-09-21       Impact factor: 49.962

4.  Phylogeny of Litsea and related genera (Laureae-Lauraceae) based on analysis of rpb2 gene sequences.

Authors:  Izu A Fijridiyanto; Noriaki Murakami
Journal:  J Plant Res       Date:  2009-02-15       Impact factor: 2.629

5.  Universal primers for amplification of three non-coding regions of chloroplast DNA.

Authors:  P Taberlet; L Gielly; G Pautou; J Bouvet
Journal:  Plant Mol Biol       Date:  1991-11       Impact factor: 4.076

6.  Chloroplast DNA phylogeny, reticulate evolution, and biogeography of Paeonia (Paeoniaceae).

Authors:  T Sang; D Crawford; T Stuessy
Journal:  Am J Bot       Date:  1997-08       Impact factor: 3.844

7.  Molecular phylogenetic analysis of the Persea group (Lauraceae) and its biogeographic implications on the evolution of tropical and subtropical Amphi-Pacific disjunctions.

Authors:  Lang Li; Jie Li; Jens G Rohwer; Henk van der Werff; Zhi-Hua Wang; Hsi-Wen Li
Journal:  Am J Bot       Date:  2011-08-22       Impact factor: 3.844

8.  Molecular evolution and phylogenetic utility of the chloroplast rpl16 intron in Chusquea and the Bambusoideae (Poaceae).

Authors:  S A Kelchner; L G Clark
Journal:  Mol Phylogenet Evol       Date:  1997-12       Impact factor: 4.286

9.  Phylogeny and biogeography of Panax L. (the ginseng genus, araliaceae): inferences from ITS sequences of nuclear ribosomal DNA.

Authors:  J Wen; E A Zimmer
Journal:  Mol Phylogenet Evol       Date:  1996-10       Impact factor: 4.286

  9 in total
  3 in total

1.  Enhanced Cd-Accumulation in Typha latifolia by Interaction with Pseudomonas rhodesiae GRC140 under Axenic Hydroponic Conditions.

Authors:  Gisela Adelina Rolón-Cárdenas; Joana Guadalupe Martínez-Martínez; Jackeline Lizzeta Arvizu-Gómez; Ruth Elena Soria-Guerra; Ma Catalina Alfaro-De la Torre; Fulgencio Alatorre-Cobos; Jesús Rubio-Santiago; Regina de Montserrat González-Balderas; Candy Carranza-Álvarez; José Roberto Macías-Pérez; Liseth Rubí Aldaba-Muruato; Alejandro Hernández-Morales
Journal:  Plants (Basel)       Date:  2022-05-29

2.  Floral structure and ontogeny of Syndiclis (Lauraceae).

Authors:  Gang Zeng; Bing Liu; David K Ferguson; Jens G Rohwer; Yong Yang
Journal:  PLoS One       Date:  2017-10-13       Impact factor: 3.240

3.  Cryptocarya kaengkrachanensis, a new species of Lauraceae from Kaeng Krachan National Park, southwest Thailand.

Authors:  Meng Zhang; Tetsukazu Yahara; Shuichiro Tagane; Sukid Rueangruea; Somran Suddee; Etsuko Moritsuka; Yoshihisa Suyama
Journal:  PhytoKeys       Date:  2020-03-04       Impact factor: 1.635

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.