Transgenic agricultural crops with increased nutritive value present prospects for contributing to public health. However, their acceptance is poor in many countries due to the perception that genetic modification may cause unintended effects on expression of native genes in the host plant. Here, we tested effects of soybean ferritin transgene (SoyFer1, M64337) on transcript and protein levels of endogenous genes in maize. Results showed that the transgene was successfully introduced and expressed in the maize seed endosperm. mRNA abundance of seven tested iron homeostasis genes and seed storage protein genes differed significantly between seed samples positive and negative for the transgene. The PCR negative samples had higher zein and total protein content compared to the positive samples. However, PCR positive samples had significantly higher concentrations of calcium, magnesium, and iron. We have shown that the soybean ferritin transgene affected the expression of native iron homeostasis genes in the maize plant. These results underscore the importance of taking a holistic approach to the evaluation of transgenic events in target plants, comparing the transgenic plant to the untransformed controls.
Transgenic agricultural crops with increased nutritive value present prospects for contributing to public health. However, their acceptance is poor in many countries due to the perception that genetic modification may cause unintended effects on expression of native genes in the host plant. Here, we tested effects of soybeanferritin transgene (SoyFer1, M64337) on transcript and protein levels of endogenous genes in maize. Results showed that the transgene was successfully introduced and expressed in the maize seed endosperm. mRNA abundance of seven tested iron homeostasis genes and seed storage protein genes differed significantly between seed samples positive and negative for the transgene. The PCR negative samples had higher zein and total protein content compared to the positive samples. However, PCR positive samples had significantly higher concentrations of calcium, magnesium, and iron. We have shown that the soybeanferritin transgene affected the expression of native iron homeostasis genes in the maize plant. These results underscore the importance of taking a holistic approach to the evaluation of transgenic events in target plants, comparing the transgenic plant to the untransformed controls.
Genetic engineering has been used to improve the performance and nutritional qualities of many economically important crops world-wide. Maize (Zea mays) is no exception and since it is a major source of dietary calorie intake in many countries, a lot of research focusing on its nutritional enhancement has been done. With most of the world's population dependent on cereal crops as basal sources of their diet (Minihane and Rimbach, 2002), it is imperative that these crops contain adequate levels of nutrients required for good health.Iron is one of the major micronutrients required in the human body. However, cereals are very poor sources of iron as it is not readily bioavailable. This is to a large extent due to the presence of phytates that bind with dietary iron, making it unavailable for absorption (Hallberg et al., 1989; Minihane and Rimbach, 2002). Cereal grains contain 0.2–2.8 mg/100 g of iron (Glahn et al., 2002) but less than 2% is absorbed in the human gut. Therefore, increasing the quantity and bioavailability of iron in cereals presents one way to fight anemia-related problems, especially in populations where cereals are a major staple crop. This could be achieved through classical breeding or by genetic engineering. However, traditional breeding is limited by inadequate genetic variation for iron content and bioavailability in the natural maize populations.Genetic manipulation through over expression of ferritin genes from different sources as a means to increase the amount of iron in plants has been successful (Goto et al., 1999; Drakakaki et al., 2000, 2005; Lucca et al., 2001, 2002; Vasconcelos et al., 2003; Qu et al., 2005; Aluru et al., 2011; Borg et al., 2012). While these results are promising from the nutritional perspective, only one of these studies examined gene expression and transcription profiles of native genes in ferritin-transformed plants compared to non-transformed plants. As such, the impact of foreign genes on expression and transcription of native genes remains relatively uncharacterized in this system. In Arabidopsis, El Ouakfaoui and Miki (2005) reported a small number of genes differing in expression levels between T-DNA-insertion mutants and their non-transformed counterparts. On the other hand, Baudo et al. (2006) compared changes in mRNA levels of conventionally generated and genetically modified wheat lines expressing glutenin with the traditional wheat lines using 9K cDNA microarray technique and they concluded that breeding through conventional means causes more variation in expression levels than using genetic engineering.Introduction of genes involved in iron storage is likely to alter the regulation of expression and transcription of native genes for iron storage or those genes required for other iron homeostasis processes. In transgenic tobacco expressing soybean ferretin, for example (Van Wuytswinkel et al., 1999; Vansuyt et al., 2003) physiological and biochemical changes were observed that mirrored iron-deficient plants, possibly due to sequestration of iron in ferritin. Knowledge of the transgene effect on expression of native genes in the host genome is required in order to predict unintended effects of these foreign genes on the levels and stability of the native genes. If event evaluation and selection is focused on identifying presence of superior transgene phenotypes, it is possible that internal changes in expression levels of other genes within the host genome as a result of transformation will be overlooked.In maize, the 27 kDa zein promoter has been used to regulate endosperm specific expression in transgenic cereal crops and indeed, the same promoter was used in this study to drive the expression of the soybeanferritin gene to the maize seed endosperm. Since maize contains endogenous zein storage proteins, it would be interesting to examine the effect of the introduced transgene driven by the zein promoter on expression and transcription of other endogenous genes involved in iron sequestering and storage as well as endogenous zein protein genes in the maize seed endosperm, since the zeins have been reported to share promoter regions (Kodrzycki et al., 1989). Our main objective was therefore to over express the soybeanferritin gene in maize seed endosperm and study the transgene effects on the transcript and expression levels of selected endogenous maize genes in roots, leaves and seed endosperm.
Materials and methods
Construct development and transformation
The soybeanferritin construct (pMNK01) is the same construct used in Aluru et al. (2011) and consisted of the super gamma zein promoter sequence (979 bp) (Aluru et al., 2008) for endosperm-specific expression, the soybeanferritin coding sequence (753 bp) with a plastid transit peptide to direct protein accumulation to the amyloplast (Lescure et al., 1991), and the Tvsp terminator sequence (515 bp) from the soybean vegetative storage protein gene (Aluru et al., 2008). The construct was developed using the polymerase chain reaction (PCR)-based cloning and it is illustrated in Figure 1. Plasmid delivery into maize HiII line (A188 × B73) (Armstrong et al., 1991) was done by the Iowa State University Plant Transformation Facility according to Frame et al. (2000). The plasmid construct pMKN01 was co-bombarded with pBAR184 (Frame et al., 2000), which has the maize ubiquitin promoter that drives the expression of the Streptomyces hygroscopicus gene for the bialophos resistance to enable selection of successful transformation events. Successful transformations were confirmed in biolophos-resistant calli by PCR, using primer pairs specific for the soybeanferritin gene [5′GCCATGGCTCTTGCTCCATCC3′ (forward primer) and 5′CAAAGTGCCAAACACCGTGACCC3′ (reverse primer)]. The plantlets regenerated were transferred to the greenhouse, grown to maturity and the seeds were harvested and separated by ear. A total of eight transformation events were harvested after bombardment and selection at the callus level.
Figure 1
Organization of the soybean ferritin transformation construct. The construct consisted of the super gamma zein promoter, the soybean ferritin coding sequence and the Tvsp terminator from soybean vegetative storage protein gene. The corresponding sizes for each construct component are indicated in brackets below the construct component name. The ATG and TAG indicate the start and stop sites, respectively, while NcoI and SacI represent the enzyme restriction sites flanking the soybean ferritin sequence with the plastid transit peptide. The forward and the reverse primer directions are indicated by arrows pointing in opposite directions.
Organization of the soybeanferritin transformation construct. The construct consisted of the super gamma zein promoter, the soybeanferritin coding sequence and the Tvsp terminator from soybean vegetative storage protein gene. The corresponding sizes for each construct component are indicated in brackets below the construct component name. The ATG and TAG indicate the start and stop sites, respectively, while NcoI and SacI represent the enzyme restriction sites flanking the soybeanferritin sequence with the plastid transit peptide. The forward and the reverse primer directions are indicated by arrows pointing in opposite directions.
Greenhouse and field production of transgenic inbred lines
Plants regenerated from the transformed callus were crossed to the Zea mays L. inbred B73 to produce F1 seeds. The F1 plants were backcrossed to B73 to produce BC1F1 seeds for the second generation. The BC2F1 and BC3F1 generation seeds were produced by backcrossing the BC1F1 and BC2F1 generation plants to B73 in subsequent third and fourth generations, respectively. Thus, the genomic composition of all the seeds planted for analysis was 93.75% B73 by pedigree, with the remainder being from A188. The selection of which plants to advance to the next generation was done based on presence and expression of the soybeanferritin transgene in individual seeds. The first two generations were grown in a greenhouse, while the third and fourth generations were grown in the field at the Iowa State University's transgenic nursery at Woodruff farm near Ames, Iowa.
Field plot design for production of maize plant tissues
Tissues used in zein and mineral analyses were produced in the field in 2009 while those for DNA detection, western blots and mRNA transcript analyses were produced in the field in 2010. Each transformation event was randomly assigned to a plot. A plot consisted of four rows. The first three rows contained PCR positive seeds planted ear to row from three different ears within the same transformation event. The fourth row contained a bulk of PCR negative seeds from the same three ears.
Ferritin DNA detection in transformed maize seed endosperms
Four transformation events (P344-2-4-1, P344-4-1-6, P344-5-2-1 and P344-6-6-1) were selected and used in this analysis. PCR was used to test for presence of soybeanferritin DNA in individual seeds. Test samples were obtained using a non-destructive method where a 10 mg sample of the endosperm was drilled from each of the seeds. DNA was extracted from each sample using the phenol-chloroform manual extraction method. The extraction buffer consisted of 200 mM Tris-HCl (PH 7.5), 250 mM NaCl, 25 mM EDTA, and 0.5% SDS, all in water. The PCR reaction was performed with the EconoTaq plus Green 2x master mix (Lucigen Corporation, Middleton, WI) following the manufacturer's instructions. The primers used were designed to amplify a 753 bp soybeanferritin fragment and these were 5′GCCATGGCTCTTGCTCCATCC3′ (forward primer) and 5′CAAAGTGCCAAACACCGTGACCC3′ (reverse primer). The PCR reaction cycle consisted of initial denaturation for 2 min at 95°C, denaturation for 30 s at 95°C, annealing for 30 s at 57°C and extension for 1 min at 72°C for a total of 35 cycles. The PCR products were run on an 1% agarose gel containing ethidium bromide which was photographed under UV light.
Comparison of soybean ferritin protein in transgenic maize seeds positive or negative for the soybean ferritin DNA
Western blot analysis was carried out to determine the expression of the soybeanferritin transgene in maize seed endosperm. Mature transgenic seeds were dried and a 10 mg sample was drilled from individual seeds and collected into a 1.5 ml tube. The remaining portion of each of the seeds was kept separate. DNA was extracted from the samples and PCR performed as described in the previous section. The PCR positive and negative samples were noted and their seeds separated. An endosperm sample was drilled from the saved portion of the seed and used for protein extraction and detection. Total protein was extracted with 100 μl of extraction buffer (200 mM Tris-HCl pH 8.0, 100 mM NaCl, 400 mM sucrose, 10 mM EDTA, 14 mM 2-mercaptaethanol and 0.05% Tween-20) for a 10 mg sample of the endosperm powder. 20 μl of total protein were analyzed by electrophoresis using sodium dodecyl sulphate (Laemmli, 1970) on a 12% polyacrylamide gel. After the run was completed, the proteins were transferred to a nitrocellulose membrane for 2 h using a biorad transblot apparatus according to the manufacturer's directions. Polyclonal antibodies for the soybeanferritin gene were raised in rabbit against soybeanferritin peptide (PQVSLARQNYADEC) produced by GenScript Company, Piscataway, NJ. Protein detection was performed using standard western blot analysis protocols (Anti-rabbit-AP secondary antibody with AP conjugate substrate, Biorad Laboratories, Hercules, CA) following the manufacturer's instructions. The blot was probed with 1:300 and 1:3000 dilutions of the primary and secondary antibodies, respectively.
Comparison of transcript levels of maize endogenous genes in maize plant tissues positive or negative for the soybean ferritin transgene
The aim of this experiment was to compare mRNA transcripts of endogenous maize genes in roots, leaves and seed endosperms using a quantitative polymerase chain reaction (qPCR) method. The presence or absence of the soybeanferritin transgene in maize plants was first determined by PCR using primers specific for the transgene (see previous sections). Transcript levels of PCR positive plants were compared to those of PCR negative plants in maize roots, leaves and seed endosperm tissues. Maize plants in BC2F1 and BC3F1 generations segregating for the soybeanferritin transgene were grown in the field in 2009 and 2010, respectively. The first leaf and root samples were collected from individual plants 1 month after planting (MAP) and at 18 days after pollination (DAP), leaf, root, and seed endosperm samples were collected. The 1 MAP and 18 DAP data collection points were included in the analysis in order to capture differences in mRNA transcript levels of endogenous maize genes before and after onset of soybeanferritin transgene expression, respectively. Leaf and root samples were collected from one plant in each PCR positive row and three plants from each PCR negative row for a total of six plants per transformation event for each of the four events (P344-2-4-1, P344-4-1-6, P344-5-2-1, and P344-6-6-1). Similarly, twenty immature seed endosperms were collected from each of the three ferritin PCR positive and negative ears from six plants for each of the four transformation events. Each endosperm sample was divided into two portions, one for DNA analysis in order to identify positive and negative endosperms and the second for mRNA analysis. Tissues were immediately frozen in liquid nitrogen while in the field and upon arrival in the laboratory, they were stored at −80°C until processing. DNA was extracted from each of the endosperms and subjected to PCR analysis for soybeanferritin transgene detection. Soybeanferritin positive and negative seeds were identified and mRNA was extracted from the saved endosperms using the PolyATract mRNA Isolation System kit (Promega Madison, WI). Likewise, mRNA was extracted from the root and leaf tissues using the same method as above. Quantitative PCR analysis was performed with the Brilliant II SYBR Green QRT-PCR Master Mix kit (Stratagene, Santa Clara, CA).
Genes used for the analysis
A complete list of genes and tissues in which these genes were tested in addition to the primer information for each gene is presented in Table 1. Among the selected genes were the zeins, the major group of seed storage proteins genes in the maize seed endosperm. These included 27 kDa γ and 16 kDa γ-zeins, 15 kDa β-zein, 19 kDa and 22 kDa α-zeins, and 18 kDa δ zein. Also, genes involved in the iron homeostasis pathway (Maizeferritin, maizeferredoxin-1, Zea mays 4 iron—4 sulphur ferredoxin (ferredoxin), maizenicotianamine amino transferase 1 (ZmNAAT1), maize yellow stripe 1 (ZmYS1), maizenicotianamine synthase 1 (ZmNAS1), maizenicotianamine synthase 2 (ZmNAS2) and maizenicotianamine synthase 3 (ZmNAS3) were included in this study. These genes were chosen for this study because they are known to respond to or be involved with determining iron homeostasis and are well-characterized in maize. The reference gene used for normalization was the 18S ribosomal RNA.
Table 1
Details on gene, primer information, and maize plant tissue in which the gene was tested in the QPCR experiment.
Gene name
Accession no.
Maize plant tissue tested
Sequence (5′–3′)
Product (bp)
References
27kDa γ-zein
EU976420
Seed endosperm
CCACCATGCCACTACCCTAC ACTGATGCCTCAGGAACTCG
166
Alexandrov et al., 2009
16kDa γ-zein
AF371262
Seed endosperm
TGGAGAACTCGACACCATGA GGTGGTTGAGTGGGGTATTG
201
Woo et al., 2001
15kDa β-zein
AF371264
Seed endosperm
TCAGTAGTAGGGCGGAATGG TGTACGAGCCAGCTCTGATG
179
Woo et al., 2001
19kDa α-zein
AF371269
Seed endosperm
CGTGGGTGAGACCAACTAGC GAAGACACCGCTGGTGAGAG
203
Woo et al., 2001
18kDa δ-zein
AF371265
Seed endosperm
CTCTGATTCCATCTCGCACA GGCATGCCGACTTCATTATT
161
Woo et al., 2001
22kDa α-zein/Floury2
L34340
Seed endosperm
CAACAGTTTCTGCCATCACTG GGCTAGTTGACTGAGCACTGG
162
Coleman et al., 1995
Soybean ferritin
M64337
Seed endosperm
AACTGCTCCCCAAGTCTC G CAGCGTGCTCTCTTTCTTCC
200
Lescure et al., 1991
Maize ferritin
X61392
Root, leaf, Seed endosperm
CGACCCCCACGCGCCTATATC GCGGCCCCACCAGAGAGATG
200
Lobreaux et al., 1992
ferredoxin-1
EU958223
Root, leaf, seed endosperm
GCCTGTCGTCGCAGTAGTGA AGGAGTAGGGCAGGTCCAAC
172
Alexandrov et al., 2009
4Fe-4S ferredoxin
EU969603
Root, leaf, seed endosperm
AGAGCTGTGTCCTATGTTCGAG TAACTGCAACCAGCTTCACG
145
Alexandrov et al., 2009
ZmNAAT1
AB375372
Root
TGGCCACATTGCTCCTGTCTTG GAAGTGCTCCCTGAAAGTTGCTGA
184
Inoue et al., 2008
yellow stripe 1
NM_001111482
Root
GATGCAAGTCCGAGGGTTCCTC CGAGGTGCGAACAGATCATCCC
180
Ueno et al., 2009
ZmNAS1
AB061270
Root, leaf, seed endosperm
TGTTCACCAGCCTCGTCATG CTGAAGTAGGGAAAGCGGCC
180
Mori and Mizuno, 2001a
ZmNAS2
AB061271
Root, leaf, seed endosperm
GCTATGTCACGGGCATCGCA GAACATTTGCTTGCGCAGGC
172
Mori and Mizuno, 2001b
ZmNAS3
AB042551
Root, leaf, seed endosperm
TCGCTCTTCCCGTACATCAA CCGCAGATGTCGTAGTTGTC
191
Mori and Mizuno, 2002
Soybean ferritin is the transgene used in this study.
Details on gene, primer information, and maize plant tissue in which the gene was tested in the QPCR experiment.Soybeanferritin is the transgene used in this study.
Comparison of zein proteins in maize seed endosperms positive or negative for the soybean ferritin transgene
This experiment was carried out to compare zein protein levels in maize seeds, positive or negative for the soybeanferritin transgene using the high performance liquid chromatography (HPLC). The materials used for this analysis were obtained from plants harvested in the third generation. Three transformation events (P344-2-4-1, P344-4-1-6, and P344-5-2-1) and three ears per event were used for this study. In brief, a 10 mg sample was drilled from each of the several kernels from the three ears from each of the three transformation events. DNA was extracted from each of the sample and tested with PCR to identify positive and negative maize seeds for the soybeanferritin transgene. The PCR reaction primers and conditions were as described in the previous sections. The remaining portion of the seed endosperm (positive or negative) was used to obtain another 10 mg sample for zein extraction and HPLC analysis.
Extraction of zein proteins and HPLC analysis
Maize zeins were extracted from each 10 mg sample with 400 μl of extraction buffer (70% Ethanol and 61 mM sodium acetate solution) in a 1.5 m centrifuge tube. The tubes were shaken for 1 h at room temperature before they were centrifuged for 10 min at 14,000 rpm. The supernatant was removed and transferred into a fresh tube. One hundred micro liters of supernatant were transferred into a vial (Alltech 8 × 30 mm shell vial clear glass, catalog 97029) and used for HPLC analysis using the Waters Alliance HPLC system. The solvents used were trifluoroacetic acid (TFA) (0.1%) in ultrapure water, TFA (0.1%) in acetonitrile (Paulis et al., 1991). Samples were separated with a c-18 column (Vydac 218TP54) and the UV absorbance was monitored at 210 nm. Levels of individual zeins were determined by integration of the resulting peaks.
Comparison of total mineral concentrations in ferritin PCR positive and negative maize seeds
Previous studies have shown that activation of enzymes related to iron uptake also increases the uptake of other divalent metal cations (Welch, 1993; Delhaize, 1996; Vansuyt et al., 2000). In light of these previous findings we sought to carry out mineral quantification in maize seeds transformed with the soybeanferritin transgene. The minerals that were analyzed in this study included calcium, copper, magnesium, manganese, zinc and iron. Three transformation events (P344-2-4-1, P344-4-1-6, and P344-5-2-1) were analyzed and samples were obtained from three maize ears for each of the events. The analysis was done on ground whole maize seeds that tested positive or negative using PCR, for the soybeanferritin transgene. Samples of 1.5 g were prepared from 20–45 seeds (depending on kernel size) from a bulk of ears from the same transformation event. Six samples, three PCR positives and three PCR negatives were prepared for each of the transformation events. Samples were analyzed for mineral content using inductively coupled plasma atomic emission spectrometry (ICAP) at the Soil and Plant Analysis Laboratory, Iowa State University. A total of eighteen samples were analyzed in duplicates.
Comparison of percent total nitrogen in maize seed samples positive or negative for the soybean ferritin DNA
Percent total nitrogen (as a measure of percentage total protein) was measured using the LECO CN combustion elemental analyzer (LECO Corporation, St. Joseph, MI) and using the same materials as those in the previous section on mineral analysis. As described above, samples negative or positive for the soybeanferritin transgene were compared in three transformation events (P344-2-4-1, P344-4-1-6, and P344-5-2-1).
Statistical analysis
For zein and nitrogen data, analysis of variance (ANOVA) was carried out using JMP SAS-based statistical software (Version 8.0.1) in which the variance was partitioned among the effects listed in Tables 2 and 3 by least squares fitting to a linear model. All effects were considered fixed, limiting the inference space to observations in this experiment and allowing us to estimate the magnitudes and significance probabilities of all effects. The significance of the transgene PCR + or − effect indicates whether a significant difference was between transgenic and non-transgenic plants and is therefore the effect of greatest interest and wherever significant differences were obtained, means were compared by the student's t-test. For the qPCR analyses, the delta cycle threshold values were used and these were calculated as discussed in Pfaffl (2001).
Table 2
Transcript ratios of transgene PCR positive plants relative to PCR negative plants averaged across four transformation events .
Gene
Tissue
Root
Leaf
Endosperm1
1 MAP
18 DAP
1MAP
18 DAP
18 DAP
Transgene: Soybean ferritin2
n.a.
n.a.
n.a.
n.a.
32.21***
ZmNAS1
0.94
1.02
0.99
1.08
4.76**
ZmNAS2
0.93
1.02
0.98
0.90
5.88**
ZmNAS3
1.08
0.95
0.76
0.39
4.23**
Maize ferritin
1.10
1.82
1.10
1.04
4.13*
Yellow stripe 1
0.92
1.01
n.a.3
n.a.
n.a.
ZmNAAT1
4.35**
5.00**
n.a.
n.a.
n.a.
Maize ferredoxin
n.a.
n.a.
1.49
1.49
4.50*
4Fe-4S ferredoxin
n.a.
n.a.
1.08
6.67*
5.29***
27kDa γ-zein
n.a.
n.a.
n.a.
n.a.
1.36
16kDa γ-zein
n.a.
n.a.
n.a.
n.a.
1.05
15kDa β-zein
n.a.
n.a.
n.a.
n.a.
1.35
19kDa α-zein
n.a.
n.a.
n.a.
n.a.
8.34**
18kDa δ-zein
n.a.
n.a.
n.a.
n.a.
1.10
22kDa α-zein/Floury2
n.a.
n.a.
n.a.
n.a.
8.35**
Endosperm was examined only at 18 DAP because it was not formed yet at 1 MAP.
Since the transgene is not present in the PCR negative samples, these ratios are represent of the PCR positive samples to the background level.
n.a.: measurement not taken because genes are not expressed in tissue.
indicate significance probabilities at P < 0.05, P < 0.001, and P < 0.0001, respectively.
Table 3
ANOVA Table showing the sums of squares for the mean HPLC peak areas of maize zein proteins in maize seed samples positive or negative for the soybean ferritin transgene.
Model effects
Event1
Transgene PCR + or −2
Event × Transgene PCR + or −
Error
Total
DF3
2
1
2
12
17
HPLC Peak4
1
2.39E+12
9.87E+12***
1.16E+11
5.70E+12
1.81E+13
2
4.88E+12
2.15E+12
2.74E+12
1.27E+13
2.24E+13
3
7.91E+12
7.47E+12*
1.00E+12
1.23E+13
2.87E+13
4
1.62E+11
3.47E+12***
2.93E+11
1.06E+12
4.90E+12
5
1.79E+12
1.32E+13**
1.17E+12
1.14E+13
2.75E+13
6
1.59E+11
5.27E+12***
4.53E+11
2.10E+12
7.98E+12
7
9.40E+11
2.27E+13**
1.39E+12
8.82E+12
3.39E+13
8
1.30E+13
1.885E+14***
1.61E+13
1.12E+14
3.29E+14
9
1.45E+12
2.7973E+13***
9.25E+11
5.19E+13
1.08E+14
10
1.84E+12
4.7691E+13**
6.14E+12
5.19E+13
1.08E+14
11
3.96E+11
9.98E+12
4.25E+11
8.98E+11
1.17E+13
12
5.11E+11
1.297E+11**
2.38E+11
1.13E+12
2.01E+12
13
1.28E+12
3.3112E+12***
1.26E+12
2.02E+13
2.60E+13
14
1.00E+12
1.39E+13
2.53E+12
1.49E+13
3.24E+13
15
4.34E+09
3.3112E+11*
1.58E+11
9.45E+11
1.44E+12
Significant differences between PCR positive and negative seed samples are indicated with one, two, or three stars before each value to represent significant differences at 5, 0.1, and 0.01% significance levels, respectively.
Three events were used in this study: P344-2-4-1, P344-4-1-6 and P344-5-2-1.
Samples were screened with PCR to identify transgene-encoded ferritin positive and negative seeds.
Degrees of freedom. Read across row.
HPLC peak assignments are shown in Figure 7.
indicate significance probabilities at P < 0.05, P < 0.001, and P < 0.0001, respectively.
Transcript ratios of transgene PCR positive plants relative to PCR negative plants averaged across four transformation events .Endosperm was examined only at 18 DAP because it was not formed yet at 1 MAP.Since the transgene is not present in the PCR negative samples, these ratios are represent of the PCR positive samples to the background level.n.a.: measurement not taken because genes are not expressed in tissue.indicate significance probabilities at P < 0.05, P < 0.001, and P < 0.0001, respectively.ANOVA Table showing the sums of squares for the mean HPLC peak areas of maizezein proteins in maize seed samples positive or negative for the soybeanferritin transgene.Significant differences between PCR positive and negative seed samples are indicated with one, two, or three stars before each value to represent significant differences at 5, 0.1, and 0.01% significance levels, respectively.Three events were used in this study: P344-2-4-1, P344-4-1-6 and P344-5-2-1.Samples were screened with PCR to identify transgene-encoded ferritin positive and negative seeds.Degrees of freedom. Read across row.HPLC peak assignments are shown in Figure 7.
Figure 7
The effect of three transformation events, 1, 2, and 3 (P344-2-4-1, P344-4-1-6, and P344-5-2-1, respectively) on mean peak areas of maize seed storage protein genes for maize seed endosperms transformed with the soybean ferritin transgene. Significant differences (P < 0.05) are indicated with a different letter on top of each error bar.
indicate significance probabilities at P < 0.05, P < 0.001, and P < 0.0001, respectively.
Results
Expression of soybean ferritin tansgene in maize seed endosperm
PCR was used to test for the presence of soybeanferritin transgene DNA in maize leaves and seed endosperm. A band of the expected size was detected in some plants in the first through the fourth generation plants. This indicated successful integration and sexual transmission of the soybeanferritin transgene into the maize genome. The PCR product was not detected in non-transgenic B73, the negative control (Figure 2A). Of the 272 seeds tested from 6 transformation events of F1 plants, 141 were positive for the soybeanferritin transgene following PCR screening (Data not shown).
Figure 2
(A) One percent agarose gel stained with ethidum bromide showing PCR analysis results of soybean ferritin DNA detection in transformed maize lines and the non-transformed line B73 used as a negative control. Lanes 1 and 2 refer to 1 kb molecular DNA size marker and soybean ferritin plasmid (pMNK01) positive control, respectively. Lane 3 represents the negative control while lanes 4 through 8 represent the transformed maize lines (P344-2-4-1, P344-4-1-6, P344-5-2-1, P344-6-6-1, and P344-7-4-1, respectively). The black arrow shows the specific 753 bp fragment of soybean ferritin coding sequence. (B) Western blot showing the 28 kDa soybean ferritin protein band in maize seed endosperms. Lanes 1 through 8 represents transformed maize seeds that were PCR, negative (lanes 1, 3, 5, and 7) or PCR positive (lanes 2, 4, 6, and 8) for the soybean ferritin transgene. Each positive/negative pair of lanes are from a different transformation event (P344-2-4-1, P344-4-1-6, P344-5-2-1, and P344-6-6-1). Lanes 1 and 3 are from event P344-2-4-1; lanes 3 and 4 are from event, P344-4-1-6; lanes 5 and 6 are from event P344-5-2-1 and lanes 7 and 8 are from event P344-6-6-1. Lanes 9 and 10 non-transgenic A188 and B73 seeds that were used as negative controls, respectively, while lane 11 contains the protein molecular size marker.
(A) One percent agarose gel stained with ethidum bromide showing PCR analysis results of soybeanferritin DNA detection in transformed maize lines and the non-transformed line B73 used as a negative control. Lanes 1 and 2 refer to 1 kb molecular DNA size marker and soybeanferritin plasmid (pMNK01) positive control, respectively. Lane 3 represents the negative control while lanes 4 through 8 represent the transformed maize lines (P344-2-4-1, P344-4-1-6, P344-5-2-1, P344-6-6-1, and P344-7-4-1, respectively). The black arrow shows the specific 753 bp fragment of soybeanferritin coding sequence. (B) Western blot showing the 28 kDa soybeanferritin protein band in maize seed endosperms. Lanes 1 through 8 represents transformed maize seeds that were PCR, negative (lanes 1, 3, 5, and 7) or PCR positive (lanes 2, 4, 6, and 8) for the soybeanferritin transgene. Each positive/negative pair of lanes are from a different transformation event (P344-2-4-1, P344-4-1-6, P344-5-2-1, and P344-6-6-1). Lanes 1 and 3 are from event P344-2-4-1; lanes 3 and 4 are from event, P344-4-1-6; lanes 5 and 6 are from event P344-5-2-1 and lanes 7 and 8 are from event P344-6-6-1. Lanes 9 and 10 non-transgenic A188 and B73 seeds that were used as negative controls, respectively, while lane 11 contains the protein molecular size marker.After DNA detection, we analyzed the ferritin protein expression using sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and western blot analyses. As anticipated, the 28 kDa soybeanferritin protein was detected in PCR positive samples but not in the PCR negative samples implying that the transgene was effectively expressed in the maize seed endosperm. In addition to the targeted protein, the antibody used also cross-reacted with another protein of a higher molecular weight in both PCR positive and negative samples for the soybean transgene. No immune reactive 28 kDa band was detected in untransformed A188 and B73 samples (Figure 2B).
Expression of endogenous genes in leaves, roots, and seed endosperm of maize transformed with the soybean ferritin transgene
In this experiment, differential expression of endogenous genes in roots, leaves, and seed endosperms was examined in maize lines transformed with the soybeanferritin transgene. Generally, the soybeanferritin transgene only affected expression of a few genes of those tested in maize leaves and roots measured during the vegetative and reproductive stages. The vegetative stage represents period before transgene expression (1 MAP) while reproductive stage represents period after transgene expression (18 DAP).In maize roots, the only significant differences (P = 0.0303 and P = 0.0097; vegetative and reproductive stages, respectively) in transcript levels were observed for the NAAT1 gene between the PCR positive and negative plants (Figure 3A). PCR positive plants had 4.35 and 5 times more NAAT1 mRNA before and after soybeanferritin transgene expression, respectively, relative to the PCR negative plants (Table 2). The transcript accumulation of other genes (ZmNAS1, ZmNAS2, ZmNAS3, maizeYS1, and maizeferritin) did not differ significantly (P > 0.05) between soybeanferritin PCR negative and positive maize root samples (Figure 3A; Table 2). Comparing expression levels of all the genes tested relative to 18S RNA, we observed that ZmNAS2, NAAT1, ZmNAS1, and MaizeYS1 were the most highly expressed while ZmNAS3 and maizeferritin were the least expressed before transgene expression (Data not shown). After transgene expression, the transcript level of maizeferritin increase along the others but ZmNAS3 did not change. In either case, however, it was only NAAT1 that was significantly higher in transgene PCR positive samples compared to the control.
Figure 3
Relative mRNA changes in maize plant roots (A) and leaves (B) at 1 month after planting (MAP) and 18 days after pollination (DAP). Maize plants were selected based on presence and absence of the soybean ferritin DNA using PCR. Data collected at 1 MAP and 18 DAP represent time before and after soybean ferritin transgene expression, respectively. For each gene, the delta cycle threshold (ct) values were normalized using 18S RNA. mRNA transcript levels in both PCR negative and positive samples were compared after normalization with respect to the ferritin PCR negative samples. The horizontal line on Figure represents values for PCR negative samples, normalized to one relative to the PCR negatives. Significant differences at P < 0.05 and P < 0.001) between transgene PCR positive and negative samples are indicated with one star and two stars, respectively, on top of the bar.
Relative mRNA changes in maize plant roots (A) and leaves (B) at 1 month after planting (MAP) and 18 days after pollination (DAP). Maize plants were selected based on presence and absence of the soybeanferritin DNA using PCR. Data collected at 1 MAP and 18 DAP represent time before and after soybeanferritin transgene expression, respectively. For each gene, the delta cycle threshold (ct) values were normalized using 18S RNA. mRNA transcript levels in both PCR negative and positive samples were compared after normalization with respect to the ferritin PCR negative samples. The horizontal line on Figure represents values for PCR negative samples, normalized to one relative to the PCR negatives. Significant differences at P < 0.05 and P < 0.001) between transgene PCR positive and negative samples are indicated with one star and two stars, respectively, on top of the bar.Gene expression results from leaf samples were almost identical to those observed from the root samples. Prior to transgene expression, there were no significant differences in mRNA levels of all the tested genes between transgene PCR positive and negative samples (Figure 3B). However, after transgene expression, the amount of ferredoxin binding protein mRNA levels significantly (P < 0.05) increased 6.67 fold in transgene PCR positive samples compared to the PCR negative samples (Figure 3B; Table 2). Comparing changes in the expression levels of all genes relative to 18S RNA showed that ZmNAS1 had the highest mRNA levels compared to other genes during the vegetative stage, while maizeferritin and maize ferredoxin and ferredoxin binding protein were highly expressed compared to others during the reproductive stage.More dramatic expression differences were observed for genes endogenous to maize seed endosperm (Figures 4A,B). The presence of soybeanferritin transgene in the seed endosperm significantly (P < 0.001) reduced mRNA accumulation of the 19 and 22 kDa zeins but did not affect (P > 0.05) mRNA levels of the 27, 16, 15, and 18 kDa zeins (Figure 4A). The 19 and 22 kDa zeins mRNA was reduced 8.34 and 8.35-fold, respectively, in PCR positive samples compared to the negative ones (Table 2). Similar to the zein transcripts, the mRNA abundance of the seven tested iron homeostasis genes differed between seed samples positive and negative for the soybeanferritin transgene in the maize seed endosperm. The samples positive for the transgene had significantly (P < 0.0001) more transcripts of the soybeanferritin, ferredoxin ferrodoxin, maize ferredoxin, maizeferritin, and ZmNAS3 genes than the negative samples (Figure 4B). Ferredoxin, maizeferritin, maize ferredoxin and ZmNAS3 showed atleast four times more expression in the soybeanferritin PCR positive seed endosperms than in the negative ones (Table 2). On the contrary, the presence of the transgene significantly (P < 0.001) reduced the accumulation of ZmNAS1 and 2 mRNA in PCR positive seed endosperms compared to their negative counterparts (Figure 4B).
Figure 4
mRNA transcript changes in maize seed endosperm samples harvested at 18 days after pollination (DAP). Maize seed endosperms were selected based on presence and absence of the soybean ferritin DNA. The 18 DAP represents the time after the soybean ferritin transgene expression. Panels (A) and (B) represent qPCR analysis results for the maize seed storage protein genes (zeins) and iron homeostasis genes, respectively. For each gene, the delta cycle threshold (delta ct) values were normalized using 18S RNA, with respect to the ferritin PCR negative samples. The horizontal lines on the panels represent normalized values for the PCR negative samples. Significant differences (P < 0.0001, P < 0.001, and P < 0.05) are indicated with three, two, and one star(s), respectively, on top of each bar for which the soybean ferritin PCR positive and negative samples differ.
mRNA transcript changes in maize seed endosperm samples harvested at 18 days after pollination (DAP). Maize seed endosperms were selected based on presence and absence of the soybeanferritin DNA. The 18 DAP represents the time after the soybeanferritin transgene expression. Panels (A) and (B) represent qPCR analysis results for the maize seed storage protein genes (zeins) and iron homeostasis genes, respectively. For each gene, the delta cycle threshold (delta ct) values were normalized using 18S RNA, with respect to the ferritin PCR negative samples. The horizontal lines on the panels represent normalized values for the PCR negative samples. Significant differences (P < 0.0001, P < 0.001, and P < 0.05) are indicated with three, two, and one star(s), respectively, on top of each bar for which the soybeanferritin PCR positive and negative samples differ.When we analyzed mRNA accumulation levels of all zein genes relative to 18S RNA, results showed that the 16 kDa was the most highly expressed compared to all other genes. However, the analysis of iron homeostasis genes' mRNA accumulation in soybeanferritin PCR positive and negative samples relative to 18S RNA showed that ZmNAS2 had significantly (P < 0.0001) higher expression levels compared to all other genes, although significant differences were also observed among individual PCR positive and negative samples (Data not shown).
Zein protein profiles in maize, positive and negative for the soybean ferritin transgene
This experiment was carried out to determine if presence of the soybeanferritin transgene affected the overall profile of zein proteins in the transformed maize. The chromatograms showed some qualitative and quantitative differences between soybeanferritin PCR positive and negative samples (Figure 5 and Table 3). Zein profiles for each group are given numbers (1–15) depending on the elution time (peaks). For already described zeins i.e., 18δ, 27γ, and 16γ zeins, individual protein peaks were identified and their molecular sizes (kDa) indicated. Most of the peaks within the PCR negative and positive samples had similar elution patterns, indicating same protein profile in PCR negative and positive samples (Figure 5). However, in some of the PCR positive samples, the elution time for peak 12 was shifted resulting in position 13 (see expanded portion of the chromatogram, Figure 5). The occurrence of samples whether positive or negative for the transgene influenced the magnitude of the mean peak area. The peak areas in PCR negative samples were significantly (P < 0.0001) higher than their PCR positive counterparts. This was true mostly for the alpha zeins (area peaks 4–15) while the relative proportions of the delta (area peak 1) and the gamma (peaks 2 and 3) zeins were similar within the PCR positive and negative seed endosperm samples (Figure 6). Alpha peaks 8, 10, 12, 13, and 15 had significantly higher peak areas in PCR negative samples compared to the positive samples (Figure 6). The mean differences between peak areas for events one and two were significantly (P < 0.05) different among PCR positive and negative samples with the PCR negative samples having higher peak areas in all the transformation events (Figure 7).
Figure 5
HPLC chromatograms of maize zeins for maize seed endosperms transformed with the soybean ferritin transgene. Maize seed endosperms were screened with PCR to identify soybean ferritin positive (Red or bottom) and negative (blue or top) seed samples. Samples were separated with a c-18 column. Peaks are labeled 1–15, depending on elution time. When known, the peaks (1, 2, and 3) are labeled with their respective sizes (kDa) and 4–15 refer to the unassigned alpha zeins. The inset emphasizes a peak that appeared in some transgene PCR positive samples, peak 13 in green traces.
Figure 6
Peak area least square means for the maize seed storage protein genes (zeins). The horizontal axis shows the HPLC protein peaks, named 1–15 depending on the elution time (see Figure 5). Significant differences between transgene-encoded ferritin PCR positive and negative maize seed samples are indicated with one, two, and three stars on top of each bar to represent significant differences at 5, 1, and 0.1% significance levels, respectively.
HPLC chromatograms of maize zeins for maize seed endosperms transformed with the soybeanferritin transgene. Maize seed endosperms were screened with PCR to identify soybeanferritin positive (Red or bottom) and negative (blue or top) seed samples. Samples were separated with a c-18 column. Peaks are labeled 1–15, depending on elution time. When known, the peaks (1, 2, and 3) are labeled with their respective sizes (kDa) and 4–15 refer to the unassigned alpha zeins. The inset emphasizes a peak that appeared in some transgene PCR positive samples, peak 13 in green traces.Peak area least square means for the maize seed storage protein genes (zeins). The horizontal axis shows the HPLC protein peaks, named 1–15 depending on the elution time (see Figure 5). Significant differences between transgene-encoded ferritin PCR positive and negative maize seed samples are indicated with one, two, and three stars on top of each bar to represent significant differences at 5, 1, and 0.1% significance levels, respectively.The effect of three transformation events, 1, 2, and 3 (P344-2-4-1, P344-4-1-6, and P344-5-2-1, respectively) on mean peak areas of maize seed storage protein genes for maize seed endosperms transformed with the soybeanferritin transgene. Significant differences (P < 0.05) are indicated with a different letter on top of each error bar.
Effects of the soybean ferritin transgene on mineral compostion in the maize seed endosperm
The presence of the soybeanferritin transgene significantly (P < 0.05) affected the concentration of calcium, magnesium, and iron but not copper, manganese, and zinc. The mineral concentrations of calcium, magnesium and iron were higher in samples positive for the soybeanferritin transgene compared to the negative samples (Figure 8). Although the iron concentration in samples positive for the transgene differed significantly from that in the negative samples, they were only 0.2 times higher. While the mean mineral concentrations of copper, manganese and zinc were higher in the soybeanferritin PCR positive samples compared to the negative samples, their mean differences were not significant at P = 0.05.
Figure 8
Fold change in mean mineral concentration in maize seed samples transformed with the soybean ferritin transgene. The samples were screened with PCR to categorize them into those positive and negative for the soybean ferritin transgene. Three transformation events (P344-2-4-1, P344-4-1-6, and P344-5-2-1) were used for this test. The event effect was not significant (data not shown), therefore, the results presented are from combined data. The horizontal line represents normalized values for the transgene PCR negative samples. Significant differences (P < 0.05) are indicated with a star on top of each error bar for which the PCR positive and negative samples differ.
Fold change in mean mineral concentration in maize seed samples transformed with the soybeanferritin transgene. The samples were screened with PCR to categorize them into those positive and negative for the soybeanferritin transgene. Three transformation events (P344-2-4-1, P344-4-1-6, and P344-5-2-1) were used for this test. The event effect was not significant (data not shown), therefore, the results presented are from combined data. The horizontal line represents normalized values for the transgene PCR negative samples. Significant differences (P < 0.05) are indicated with a star on top of each error bar for which the PCR positive and negative samples differ.
Percent total protein decreased in maize seed endosperms transformed with the soybean ferritin transgene
The mean percentage total protein differences between PCR positive and negative maize seed endosperm samples were highly significant (P < 0.0001) (Table 4). Percentage total protein was higher in transgene PCR negative samples than PCR positive samples. On the other hand, transformation events (P344-2-4-1, P344-4-1-6, and P344-5-2-1) had significant differences in total nitrogen measurements between samples positive and negative for the soybeanferritin transgene (Table 4). Transformation events 1 (P344-2-4-1) and 3 (P344-5-2-1) had significantly higher total nitrogen (1.678 ± 1.354% and 1.666 ± 1.354%, respectively) compared to transformation event 2 (P344-4-1-6) (1.592 ± 1.354%). In this experiment, the presence of the soybeanferritin transgene was associated with decreased percentage total protein in maize seed endosperms.
Table 4
ANOVA for the least square means for percentage total nitrogen in transformed maize seeds, positive or negative for the soybean ferritin transgene.
Least square area means (total nitrogen)
Effect
DF1
Sums of squares
F-ratio
Prob > F
Replicate
1
0.0022
0.3471
0.5613
2Transgene PCR + or −
1
0.4984
73.0392
<0.0001***
3Event
2
0.0525
3.8465
0.0356*
Transgene PCR + or − × replicate
1
0.0007
0.1095
0.7436
Transgene PCR + or − × Event
2
0.0194
1.4206
0.2612
Event × replicate
2
0.0064
0.4696
0.6309
Transgene PCR + or − × Event × replicate
2
0.0028
0.2080
0.8137
Degrees of freedom.
The transformed maize seed samples were screened with PCR to identify those positive and negative for the soybean ferritin transgene. Comparisons are made based on significant differences in percentage total nitrogen between transgene PCR positive and negative samples.
Three transformation events were examined in duplicate for this test (P344-2-4-1, P344-4-1-6, and P344-5-2-1).
indicate significance probabilities at P < 0.05 and P < 0.0001, respectively.
ANOVA for the least square means for percentage total nitrogen in transformed maize seeds, positive or negative for the soybeanferritin transgene.Degrees of freedom.The transformed maize seed samples were screened with PCR to identify those positive and negative for the soybeanferritin transgene. Comparisons are made based on significant differences in percentage total nitrogen between transgene PCR positive and negative samples.Three transformation events were examined in duplicate for this test (P344-2-4-1, P344-4-1-6, and P344-5-2-1).indicate significance probabilities at P < 0.05 and P < 0.0001, respectively.
Discussion
Increasing the nutritive value of plants for human benefit has been an area of interest to many research groups. Maize is an excellent target crop because it serves as a major dietary source to many nations, especially those in the developing world, who cannot afford the cost of food supplements. The main objective of this study was to determine the effect of the soybeanferritin transgene on endogenous gene transcripts and protein levels in maize roots, leaves, and seed endosperms. Maize plants expressing the soybeanferritin gene directed to the seed endosperm by the super gamma zein promoter were produced. Soybeanferritin DNA was successfully detected in the leaves and seed endosperm samples, with a corresponding increase in the transgene protein expression in only the ferritin PCR positive seed samples, indicating a successful transformation and integration process. One of the strategies for alleviating mineral or iron deficiency health problems is to produce transgenic plants with increased ferritin levels as reported in findings by different research groups (Goto et al., 1999; Brinch-Pedersen et al., 2000; Drakakaki et al., 2000, 2005; Lucca et al., 2001, 2002; Vasconcelos et al., 2003; Qu et al., 2005; Aluru et al., 2011).Transgene introduction in plants can potentially lead to unintended modifications in transcription and translation of native genes in the host plants. It is therefore necessary to assess the likelihood of these occurrences by measuring transcript changes of native genes especially those in tissues where the transgene is inserted or is likely to cause significant changes. Transgene insertion into the host genome is a random process which can result in the transgene landing in the coding sequence of a native gene. When this happens, it can cause changes in the stability or levels of mRNA accumulation of the native gene. Therefore, one of the ways in which we can determine whether or not the transgene causes some accidental effects is to look at mRNA levels of native genes that control the routine activities or that are directly involved in the regulation of specific metabolic processes where the transgene is to be acting. We made an effort in this study to assess the effects of soybeanferritin transgene on the transcript accumulation of native genes in maize roots, leaves and seed endosperm and at two developmental stages. Our results showed that the presence of the soybeanferritin transgene had no significant effects (P > 0.05) on most of the genes in the maize roots and leaves, before (1 MAP) and after (18 DAP) transgene expression in the target tissue. Measurement of mRNA transcripts for ZmNAAT1 gene, however, showed significantly (P < 0.05) higher mRNA amounts for the positive PCR root samples than the negative ones at the two data collection points. ZmNAAT1 is an enzyme that is required in the homeostasis of mugineic acid (MA), an important metal chelator that is involved in the transportation of metal ions, including iron ions across the plasma membrane in both grass and non-grass plants (Higuchi et al., 1996). In rice, Cheng et al. (2007) reported that a mutation in the riceNAAT1 gene led to substantial accumulation of nicotianamine in roots and shoots but the mutant plants could not effectively absorb Fe (III) because of the failure to produce deoxymugineic acid. Nicotianamine is a chelator that occurs in plants and it is involved in internal iron transport (Stephan et al., 1994, 1996). In our experiment, in maize roots, presence of the soybeanferritin transgene was associated with increased levels of ZmNAAT1 mRNA. This increase would make sense if the plant was experiencing iron deficiency because iron was sequestered in the seed in the transgene-encoded ferritin. It has been reported that overexpression of soybeanferritin in transgenic tobacco caused plants to respond as if they were iron deficient due to illegitimate sequestration of iron (Van Wuytswinkel et al., 1999; Vansuyt et al., 2003). This explanation is not completely satisfying, however, because the ZmNAAT1 transcript is up-regulated in transgenic plants prior to seed set as well as after seed set. Our results are in contrast to those of Aluru et al. (2011) who found that in roots of maize plants transformed with the same transgene used in this study, NAAT mRNA was reduced two to four fold. Accumulation of this message may therefore be influenced by the environment or the genetic background of the plants used in the study. Earlier studies also indicated that the presence of iron increased the amount of ferritin mRNA in bean leaves and soybean cell cultures by more than 30 fold (Proudhon et al., 1989). The fact that transcript levels of other genes in maize roots were not different in presence or absence of the soybeanferritin transgene illustrates that there was no detectable interaction between these genes and the soybeanferritin transgene in these tissues.Gene expression results from leaf samples were almost identical to those observed with the root samples, with only the ferredoxin or Iron–sulphur (4Fe-4S) proteins showing increased transcript levels in samples where the soybeanferritin transgene was detected. 4Fe-4S proteins contain iron and sulphur bound to the polypeptide chain by 4 cysteinyl sulfur linkages to the iron atoms (Sweeney and Rabinowitz, 1980). These proteins are well-known for their involvement in electron transport and gene expression regulation (Lill and Muehlenhoff, 2006). It is likely that the increased transcription of ferritin, an iron storage protein, led to increased transcript levels of this gene. Because the amount of iron present in a given tissue regulates the transcription of the ferritin gene (Savino et al., 1997; De Domenico et al., 2008), it is possible for the iron to similarly have the same effects on genes that act in the same pathway as the ferritin gene and this could explain the relative increase in the transcripts of the genes in samples where the ferritin transgene was detected.Different endogenous maize genes showed differential gene expression patterns in maize seed endosperm samples with or without the soybeanferritin transgene. Two of the alpha zein protein transcripts (19 and 22 kDa α-zeins) were significantly lower in transgenic plants than in non-transgenic plants. We found more than 8-fold decrease in mRNA accumulation in the 19 and 22 kDa in the PCR positive samples. Conversely, no significant mRNA changes were observed in the gamma and delta zeins as well as other alpha zein proteins tested. These results were consistent with those obtained in the samples harvested and analyzed in earlier previous year (data not shown). These observations are also supported by the zein protein analysis results that showed increased accumulation of these same proteins in soybeanferritin PCR negative compared to PCR positive samples. In addition, the percent total nitrogen levels were also significantly higher in ferritin PCR negative samples compared to the PCR positive samples. The use of the super gamma zein promoter is a possible explanation for the observed differences. This promoter shares regulatory sequences with endogenous genes and could compete for transcription factors, which could result in reduction in endogenous gene transcription levels. It is somewhat surprising that differences were not observed in the zein most closely related to the transgene, the 27 kDa gamma zein, but were observed in other zeins. Peak 13 was present only in PCR positive samples and these samples lacked Peak 12. We don't know the identity of this peak, but it's co-occurrence with the transgene is intriguing. Several of the alpha peaks had significantly higher peak areas in PCR negative compared to the positive samples. The amount of zein protein depended on both transformation event and presence or absence of the soybeanferritin transgene in the maize. In fact, measurement of the percent total protein in maize seeds without the soybeanferritin transgene showed that they had significantly higher percent total protein than their corresponding positive ones. The high values for zein transcript and protein levels in soybeanferritin negative samples are consistent with percentage total protein content results.On the other hand, transcripts of iron homeostasis genes in maize seed endosperm accumulated to higher levels in ferritin PCR positive samples compared to their negative counterparts. The regulation of iron homeostasis genes depends on the iron status in the tissue of interest (Savino et al., 1997; De Domenico et al., 2008). It has been reported that overexpression of soybeanferritin in transgenic tobacco caused plants to respond as if they were iron deficient due to an illegitimate sequestration of iron (Van Wuytswinkel et al., 1999; Vansuyt et al., 2003). Thus, changes seed ferritin levels will most likely correlate with up or down-regulation of iron homeostasis genes. In this study, the mRNA transcripts of the soybeanferritin gene accumulated to high levels in maize endosperm samples. In plants, ferritin production is regulated at both transcriptional and post transcriptional levels (Lescure et al., 1991; Kimata and Theil, 1994; Savino et al., 1997). This is dependent on presence of iron that results in the relative induction of ferritin mRNA and protein levels. Protein analysis revealed soybeanferritin protein accumulated to detectable levels only in PCR positive samples. Kimata and Theil (1994) reported stable ferritin mRNA levels in soybean plants during development, with a corresponding decrease in ferritin protein content. Measurement of iron levels in maize seed endosperm samples indicated a direct correlation between presence of ferritin transgene and iron concentrations. The soybeanferritin PCR positive samples in general contained higher mineral concentrations with significant differences observed for calcium, magnesium and iron. The amount of iron that accumulated in PCR positive samples was 0.2 fold higher than in the PCR negative samples. Previous studies (Goto et al., 1999; Vasconcelos et al., 2003; Drakakaki et al., 2005) reported even higher correlations between soybeanferritin expression levels and total iron content. On the contrary, Drakakaki et al. (2000), observed no significant increases in seed iron content in rice and wheat samples transformed with a ferritin gene and whose expression was controlled by the ubiquitin promoter. Iron concentration levels have been reported to differ from one generation to another (Qu et al., 2005) and this could possibly have happened in this case. The fact that different lines will likely have differences in their expression patterns could be another reason why we might expect differences in iron levels. However, in our findings, the different transformation events did not have significant effects on the amount of iron obtained. Changes in environmental factors have also been reported to influence iron uptake and storage (Vansuyt et al., 2000), a factor we cannot rule out in explaining this observation.Significant increases in the concentrations of other metals (magnesium and calcium) in ferritin PCR positive seed samples could be due to increased iron accumulation resulting from the activation of the ferritin transgene. Vasconcelos et al. (2003) reported a similar finding in rice seeds with enhanced expression levels of the ferritin transgene. Previous research groups (Vansuyt et al., 2000; Welch, 1993) showed that it was possible to increase the uptake of other divalent metal cations with the activation of enzymes involved in iron uptake and use. Since other main factors and their interactions did not seem to have significant effects on metal accumulation, it seems very likely that the observed differences in metal concentrations were due to changes in iron status in maize seed samples. Qu et al. (2005), however, reported no significant changes in concentrations of calcium, copper, cadmium, magnesium, manganese, and zinc, a result that is contrary to our observations.
Conclusion
This work describes efforts to assess the effect of soybeanferritin transgene on transcript and protein levels of maize endogenous genes. Differential expression patterns were observed between maize samples with or without the soybeanferritin transgene. The iron homeostasis genes selected for this study were up-regulated in soybeanferritin PCR positive samples compared to negatives ones. Only two of the zein protein genes were down-regulated in soybeanferritin PCR positive samples while the rest of the zeins remained unchanged. The transformation event did not affect transcript or protein levels of the different genes, but some genes were affected by the presence or absence of the transgene. By knowing transgene effects that can lead to changes in endogenous gene activities and levels, researchers will be able to find viable explanations for the unexpected results and be able to target specific stages controlled by specific genes in iron homeostasis.
Conflict of interest statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Authors: Georgia Drakakaki; Sylvain Marcel; Raymond P Glahn; Elizabeth K Lund; Sandra Pariagh; Rainer Fischer; Paul Christou; Eva Stoger Journal: Plant Mol Biol Date: 2005-12 Impact factor: 4.076
Authors: Nickolai N Alexandrov; Vyacheslav V Brover; Stanislav Freidin; Maxim E Troukhan; Tatiana V Tatarinova; Hongyu Zhang; Timothy J Swaller; Yu-Ping Lu; John Bouck; Richard B Flavell; Kenneth A Feldmann Journal: Plant Mol Biol Date: 2008-10-21 Impact factor: 4.076
Authors: J Beslin Joshi; S Geetha; Birla Singh; K K Kumar; E Kokiladevi; L Arul; P Balasubramanian; D Sudhakar Journal: Physiol Mol Biol Plants Date: 2014-10-28
Authors: Chien-Yuan Lin; Joseph E Jakes; Bryon S Donohoe; Peter N Ciesielski; Haibing Yang; Sophie-Charlotte Gleber; Stefan Vogt; Shi-You Ding; Wendy A Peer; Angus S Murphy; Maureen C McCann; Michael E Himmel; Melvin P Tucker; Hui Wei Journal: Biotechnol Biofuels Date: 2016-10-21 Impact factor: 6.040
Authors: Paulo Izquierdo; Carolina Astudillo; Matthew W Blair; Asif M Iqbal; Bodo Raatz; Karen A Cichy Journal: Theor Appl Genet Date: 2018-05-11 Impact factor: 5.699