Insilico profiling of microRNAs in Korean ginseng (Panax ginseng Meyer).

MicroRNAs (miRNAs) are a class of recently discovered non-coding small RNA molecules, on average approximately 21 nucleotides in length, which underlie numerous important biological roles in gene regulation in various organisms. The miRNA database (release 18) has 18,226 miRNAs, which have been deposited from different species. Although miRNAs have been identified and validated in many plant species, no studies have been reported on discovering miRNAs in Panax ginseng Meyer, which is a traditionally known medicinal plant in oriental medicine, also known as Korean ginseng. It has triterpene ginseng saponins called ginsenosides, which are responsible for its various pharmacological activities. Predicting conserved miRNAs by homology-based analysis with available expressed sequence tag (EST) sequences can be powerful, if the species lacks whole genome sequence information. In this study by using the EST based computational approach, 69 conserved miRNAs belonging to 44 miRNA families were identified in Korean ginseng. The digital gene expression patterns of predicted conserved miRNAs were analyzed by deep sequencing using small RNA sequences of flower buds, leaves, and lateral roots. We have found that many of the identified miRNAs showed tissue specific expressions. Using the insilico method, 346 potential targets were identified for the predicted 69 conserved miRNAs by searching the ginseng EST database, and the predicted targets were mainly involved in secondary metabolic processes, responses to biotic and abiotic stress, and transcription regulator activities, as well as a variety of other metabolic processes.

INTRODUCTION

MicroRNAs (miRNAs) are a class of small, nonprotein-coding RNAs with lengths of approximately 21 nucleotides (nt) that act as post-transcriptional regulators in eukaryotes [1]. Like other genes, mature miRNAs also have their own miRNA genes, which are transcribed from their own miRNA genes. In plants, miRNA genes are initially transcribed into primary miRNAs (primiRNAs) by pol II [2]. Pri-miRNAs are processed into miRNA precursors (pre-miRNAs) by DICER-LIKE1, which are able to fold into a perfect or near-perfect secondary hairpin structure, and processed into a miRNA duplex (miRNA:miRNA*). It further leads to the release of mature miRNA by the unwinding of the duplexes [1]. Mature miRNAs are assembled into the RNA-induced silencing complex (RISC) to direct the RISC to their complementary target sites in the messenger RNA (mRNA). The activity of miRNA on a target mRNA is dependent on the degree of base pairing, and in the case of perfect or near-perfect base pairing, it leads to target mRNA degradation in plants [3]. Therefore, the perfect or near-perfect base matching of miRNA to the targets makes the computational prediction of miRNAs easier in plants compared to animals, and they have been successfully applied in many plants [4-6]. miRNA genes are an important class of fine-tuning regulators, playing an important role in a wide range of developmental, biological, and metabolic processes in plants, including metabolism, stress response, vegetative phase change, organogenesis, and signal transduction [7,8].

To date, different approaches have been employed to identify miRNAs in various species, including: 1) direct cloning after isolation of small RNAs with a computational strategy 2) expressed sequence tags (ESTs) analysis, and 3) high throughput sequencing of small RNA [9,10]. Among these three methods, we employed EST analysis and high throughput sequencing of small RNAs to discover Panax ginseng Meyer miRNAs. Comparisons of miRNA of different plant species show that miRNAs have been highly conserved throughout evolution. Its conserved nature helps to identify the miRNA from different plant species by comparative EST based homolog searches, which have been successfully applied in many species, including potato [11], citrus [12], switch grass [13], lettuce [14], and tobacco [15], and it is applicable for those species in which whole genome sequence information is not available [16]. Even though the miRNAs are conserved, some of the miRNAs often express at low levels, or are expressed only in specific tissue or under specific conditions. A new generation of sequencing technologies like high-throughput pyrosequencing technology allows for the identification of lowly expressed or tissue specific expressed miRNA, which was reported in several species such as grapevine [9], tomato [17], and grapevine flower and berry [18].

Based on the annotation criteria, to date 18,226 miRNAs have been deposited in the miRNA registry database (miRBase; release 18.0, http://microrna.sanger.ac.uk) from various species. Although miRNAs have been identified and validated in many plant species, they are largely unknown in P. ginseng (Korean ginseng), which is a traditionally known medicinal plant in oriental medicine where the roots of the plant are mainly used for medicinal purposes. The genus Panax is derived from panacea, which means a cure-all and longevity. It is a slow growing perennial herb of the Araliaceae family, and because of its mysterious power in oriental medicine, people have been using ginseng roots and its extracts to increase physical strength and vigor, and revitalize the body and mind [19]. Ginseng has been used in Korea, as well as other countries such as China and Japan. It contains triterpene ginseng saponins called ginsenosides, which are responsible for its various pharmacological activities, including immune system modulation, anti-stress activities, anti-hyperglycemic activities, anti-inflammatory, anti-oxidant, and anti-cancer effects. It also has polysaccharides, flavonoides, peptides, polyacetylic alcohols, and fatty acids [20,21]. In recent years, the increasing evidence of miRNA identification and characterization in other important food crops such as rice, maize, arabidopsis, potato, tomato, citrus, grape fruit, and medicinal tuber crops [22], and also the prediction of terpenoid pathway genes targeting miRNAs in various plant species [11,23,24], as well as evidence of root development related miRNA [25], all induces insight into the analysis of miRNA in P. ginseng. Here, we first report the profiling of miRNA and their targets in P. ginseng (Korean ginseng).

MATERIALS AND METHODS

Plant materials and small RNA sequencing

The flower buds, leaves, and roots were collected from 6-year field grown P. ginseng plants in south Korea. Immediately after collection, the samples were stored in liquid nitrogen for further analysis. A small RNA library of three samples was constructed using a TruSeq small RNA sample preparation kit, the concentration of RNA was analyzed using a bioanlyzer to determine the RNA integrity number, and a 28s rRNA:18s rRNA ration and ribogreen were used to analyze the RNA concentration. The good qualities of RNA were taken for sequencing using Illumina’s Genome Analyzer IIx (GAIIx). The sequence reads were initially trimmed by removing the adapter sequences and low quality sequences with a phred score below 20. Finally, the small RNA sequence was taken in FASTQ format for further bioinformatics analysis.

Transcriptome sequences and microRNA registry database sequences

All known miRNAs of mature plants from different plant species were used as reference miRNA for predicting the conserved miRNA in P. ginseng. Known plant miRNAs (reference miRNAs) from the miRBase database (release 17) [26] were derived from different plant species, including Arabidopsis thaliana, Oryza sativa, Glycine max, Brassica napus, Medicago truncatula, Sorghum bicolor, Zea mays, and Saccharum officinarum, as well as all of the other plant species. The complete transcriptome sequences for P. ginseng were collected from the ginseng EST database (http://www.bioherbs.khu.ac.kr/ggrb) to predict the miRNA for P. ginseng [27].

Expressed sequence tag based conserved microRNA prediction

The small RNA raw sequence reads from Illumina’s GAIIx were converted from the FASTQ to the FASTA format, and then the redundancy sequences were removed using the FASTX tool kit (http://hannonlab.cshl.edu/fastx_toolkit), and the remaining unique sequences were selected for further analysis. Sequences 18 to 27 nt bases long were used to do BLASTN against the Rfam database to remove other small RNAs such as transfer RNA (tRNA), ribosomal RNA (rRNA), small interfering RNA (siRNA), small nuclear RNA (snRNA), and small nucleolar RNAs (snoRNA). The remaining sequences were used for the EST based miRNA prediction with the stranded protocol using the mirCheck tool, as well as a custom-made perl script [28]. Firstly, the sequences were matched using the PatScan algorithm with the miRBase database (release 17) to predict the conserved miRNAs in ginseng. Sequences with ≤3 mismatches were considered to be conserved miRNAs in ginseng. Those conserved miRNAs were taken for further analysis, as described in the workflow (Fig. 1).

Fig. 1.

Flow chart of microRNA (miRNA) identification in Panax ginseng. Both expressed sequence tag (EST) analysis and high throughput sequencing methodology were used for the identification of conserved miRNA in P. ginseng.

MicroRNA validation and digital expression analysis

To validate the predicted miRNAs, further evaluation was conducted using the RNA secondary structure prediction with RNAFold (http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi), a web based tool. The predicted structures were evaluated with miRCheck with known criteria for plant miRNA prediction. Further confirmation was carried out through the minimal free-folding energy (MFE) and MFE index (MFEI) [29,30]. Those sequences which passed the previous steps were matched with individual samples using the patScan algorithm, having 3 mismatches to get the digital gene expression. Finally, the exact matched read counts were calculated using a custom made perl script.

Target prediction and functional analysis

Predicted miRNA sequences were subjected to target prediction using the web based server psRNATarget (http://plantgrn.noble.org/psRNATarget). This tool has an option to predict user submitted RNAs vs. user submitted transcripts, and we used that option to predict all of the targets. All of the unique transcripts were taken for the functional annotation using the blast2go functional annotation tool. Transcripts were prepared through the de novo assembly and blasted against the non-redundant database, and then subjected to gene ontology analysis.

RESULTS AND DISCUSSION

Generally, miRNAs can be predicted by analysis of EST and sequencing of small RNAs. Here, we used both of EST analysis and high through put sequencing methodology for the identification of conserved miRNA in P. ginseng (Fig. 1).

Computational identification of conserved microRNA by expressed sequence tag analysis

The identification of conserved miRNAs by EST analysis is greatly facilitated by the conserved properties of miRNA families among various plant species [29]. To identify the complete set of conserved miRNAs by computational predictions, the availability of the complete genome sequences is a pre-requisite. If complete genomic sequences are lacking, fragmented data like EST and high-throughput genomic sequences have been used [31]. Using the homology based strategy, lots of conserved miRNAs have been identified in various plant species, including potato (Solanum tuberosum) [11], switch grass (Panicum virgatum) [13], lettuce (Lactuca sativa) [14], and rapeseed (B. napus) [32]. We employed the computational based approaches to predict miRNAs in P. ginseng with available ginseng EST sources from our lab.

miRNA sequences of various plant species were predicted and deposited in the miRBase database [33]. We used miRBase mature miRNA sequences as a reference sequence to predict miRNAs in ginseng using similarity searches. Mature plant miRNAs from different plant species were downloaded from miRBase, redundant sequences were then removed, and non-redundant unique sequences were blasted with P. ginseng EST sequences. Using homology searches, 69 miRNAs belonging to 44 conserved miRNA families were identified after repeated and protein coding sequences were removed (Table 1).

Table 1.

Identified homology based conserved miRNA in Panax ginseng

miRNA family	Sequence	Length of mature miRNA	Reference	Precursor EST	Length of precursor	Location (3’|5’)	GC%	MFE (kcal/mol)	MFEI
miR156a	TTTACGGAAGATTGAGAGGAC	21	bna	contig45577	60	3’	46.67	30	0.64
miR159a	AUAGCAGUGAAGGCAGCUCCU	21	osa	contig47841	94	3’	44.68	31.91	0.71
miR164	UGGAGAAUCAAGGCCCUUGAG	21	osa	contig50068	248	3’	41.53	33.06	0.8
miR169h	GAACUGAAGAUGACUUGACGG	21	mtr	contig14564	133	5’	29.32	20.53	0.7
miR172f	GUAAUCAUGAUCAUGCUGCU	20	sbi	contig47560	287	3’	42.51	33.59	0.79
miR319b	UUGGAGUGAAGGAAACUCCA	20	mtr	contig41016	72	5’	36.11	34.03	0.94
miR319e	UUGGAGUGAAGGAAACUCCAU	21	vvi	contig41016	72	5’	36.11	34.03	0.94
miR319f	UAGCAGUGAAGGCAGCUCCU	20	ptc	contig47841	94	3’	44.68	31.91	0.71
miR319g	UAGGACUGGAGGCAGCUUCU	20	ptc	contig54185	55	3’	54.55	49.45	0.91
miR319h	UUAGGACUGGAGGCAGCUUCU	21	vvi	contig54185	55	3’	54.55	49.45	0.91
miR396b	UUCCACAUCUAUCUUUAUCU	20	vvi	contig23595	366	5’	33.61	25.05	0.75
miR396c	UUCCUCGCCUUUCUUGCUCUU	21	ptc	contig58969	263	5’	55.51	39.35	0.71
miR397	UCAUUGAGCACAAUGUUGUUG	21	zma	contig39102	88	5’	39.77	31.82	0.8
miR408a	AUGCACUGCCUCUUCCCUGGC	21	ath	contig30298	102	3’	51.96	45.5	0.85
miR414d	UCAUCAUCAUCAUCAUCAUCA	21	ath	contig45947	60	3’	45	25.7	0.95
miR414e	UCAUCAUCAUCAUCAUCAUCA	21	ath	contig45947	60	3’	45	42.83	0.95
miR414f	UCAUCAUCAUCAUCAUCAUCA	21	osa	contig46717	328	5’	47.87	32.99	0.69
miR414h	UCAUCAUCAUCAUCAUCGAAU	21	osa	contig27681	229	5’	41.92	32.97	0.79
miR414i	UCAUGGGCAUCAUCAUGGUCA	21	ath	contig54204	85	3’	44.71	35.65	0.8
miR414j	UCGAAUUCAUCAUCAUCAUCA	21	ath	contig27681	241	5’	41.49	34.44	0.83
miR414l	UCUUCGUCAUCUUCAUCUUCC	21	osa	contig55217	118	5’	47.46	38.39	0.81
miR417	GAACAAAAUGAAUUUGUUCGA	21	ath	contig47470	60	5’	28.33	37	1.31
miR419e	UUAUUGAUGAUGAGGAUGAUG	21	ath	contig58582	192	3’	25.52	25.78	1.01
miR446	CAUCAAUAUGAAUAUGUCAGAUGC	24	osa	contig48939	106	5’	36.79	31.13	0.85
miR482	CCUUUCCUAUUCCUCCCAUACC	22	vvi	contig29669	101	3’	46.53	41.7	0.88
miR482a	CCUAUUCCUCCCAUACC	17	ptc	contig29669	101	3’	46.53	41.7	0.88
miR482c	CCUUUCCUAUUCCUCCCAUA	20	ptc	contig29669	97	3’	48.45	40.41	0.83
miR530a	GGCAUCUGCACCUGAACUUU	20	ptc	contig48663	353	5’	42.78	30.31	0.71
miR783	AAGCUUUUUUCUGUCAUGUUC	21	ath	contig18217	346	5’	45.38	32.95	0.73
miR815	GAGGGGAAAGAGGUGAUUGGG	21	osa	contig59498	187	3’	52.94	37.33	0.71
miR816a	GUGACAUACUCUACUUCAGC	20	osa	contig48862	90	5’	36.67	25.6	0.7
miR834b	UUGUAGUAGUGGCGGUGGCAA	21	ath	contig32379	67	3’	52.24	37.61	0.72
miR846	UUGAAUUUUAGCGGUUGAAUU	21	ath	contig33367	129	3’	34.11	27.05	0.79
miR847a	UCAAACUUCUUCUUCUUGAUC	21	ath	contig50301	186	5’	43.01	30	0.7
miR847b	UCAAUCUUCUUCUUCUUCUUG	21	ath	contig46552	202	5’	42.57	29.06	0.68
miR847c	UCUCUUCUCUUCUUCUUUAUA	21	ath	contig00227	166	3’	39.76	29.4	0.74
miR854b	GAGGAGGAGGAGGAGGAGGAG	21	ath	contig45937	119	5’	30.25	24.12	0.8
miR854d	GAUGAGGAGGAGGAGGAGGAU	21	ath	contig33518	280	5’	40.71	29.05	0.71
miR854e	GAAGAGGAGAGAGAUGAGGAG	21	ath	contig26917	169	3’	48.52	32.78	0.68
miR854c	GAUGAGGAUGAGGAUGAGGAU	21	ath	contig34488	261	5’	42.15	29.04	0.69
miR1132h	UAUUAUGGGACGGAGGUAG	19	tae	contig63186	273	3’	30.4	28.54	0.94
miR1134	CAACAAGAAGAAGAAGUAGAAGAU	24	tae	contig12044	144	5’	25.69	31.66	0.85
miR1436c	UUAUCCUGGGACGGAGGGAGU	21	osa	contig61393	264	3’	34.09	34.33	1.01
miR1436d	UUAUUAUGGGACGGAGGUAGU	21	osa	contig63186	275	3’	30.9	80.51	0.94
miR1439a	UAUAGGAAUGGAGGGAGUAUU	21	osa	contig16765	277	3’	29.96	25.13	0.84
miR1439b	UUUAGGAACGGAGGGAGUACU	21	osa	contig56537	267	3’	32.21	28.13	0.87
miR1439c	UUUAGGAAUGGAGGGAGUAAU	21	osa	contig56367	281	3’	28.83	27.94	0.97
miR1439d	UUUGGGAAUGGAGGGAGUAAU	21	osa	contig10661	236	3’	25	22.2	0.89
miR1439e	UUUGGGGAUGGAGAGAGUAUU	21	osa	contig27854	283	3’	29.68	23.92	0.81
miR1439h	UUUAGGAACGGAGGGAGUACU	21	osa	contig56537	267	3’	32.2	75.1	0.87
miR1448	CUUUCCUAUUCCUCCCAUAC	20	ptc	contig29669	99	3’	47.47	40.9	0.87
miR1534a	UAUUUUGUGGAUAUAGUAAU	20	gma	contig49029	70	3’	31.43	26.86	0.85
miR1886c	UGAGAUGAGAUCUGGGUUUGG	21	ath	contig11222	98	3’	42.86	38.47	0.9
miR20975p	AGGGAAGGGAAGGGAAGGGAAG	22	osa	contig15753	69	5’	42.03	43.62	1.04
miR21015p	AUAUUUUUACAAGUAAAAUUGU	22	osa	contig17137	123	5’	38.21	48.62	1.27
miR2108b	UUAAUGUUUUGUCUAAGUGAG	21	gma	contig50952	65	3’	32.31	46.15	1.43
miR2109c	UGCGAGUUUCUGGGGCUCUG	20	gma	contig56006	346	5’	51.45	40.64	0.79
miR2112b	CUUUAUAUAUGCAUUUGUGCU	21	ath	contig55266	270	3’	32.59	23.8	0.73
miR2606a	UACAAUUUCUAAGUUGCUUUG	21	mtr	contig46524	141	5’	37.59	26.88	0.72
miR2607	AUGUGAUUAUGUAAUGAUAGU	21	mtr	contig38869	116	5’	25.86	26.81	1.04
miR2626	AACGUCGUGGUUAAGGGUGUC	21	mtr	contig62419	56	5’	39.29	50.89	1.3
miR2628a	CAUAACUGAAUGAUUAGUAA	20	mtr	contig23672	71	5’	28.17	27.75	0.98
miR2628b	GAUGCAAGGAUGAUGAGUCA	20	mtr	contig11869	189	5’	42.33	31.64	0.75
miR2642	AUGAUUUUCACCAAAUCUUGC	21	mtr	contig07593	77	5’	40.26	30.26	0.75
miR2643b	UUUGGGAUCAGAUAUAAGACA	21	mtr	contig22496	363	5’	36.08	99.8	0.76
miR2658	AUGUGACCUUUUUUAUGUGC	20	mtr	contig28456	74	3’	32.43	31.89	0.98
miR2665	UGCUUUCAUGCCAAGAUUUGA	21	mtr	contig49532	60	5’	33.33	27	0.81
miR2673b	CCGCCUCUUCUUCCUCUUCCGC	22	mtr	contig52872	189	5’	55.03	41.33	0.75
miR2937	AAAAGAGCUUUUGAGGGAGUU	21	ath	contig45835	79	3’	43.04	41.9	0.97

miRNA, microRNA, EST, expressed sequence tag, GC, guanine-cytosine content, MFE, minimal free-folding energy, MFEI, minimal free-folding energy index.

The majority of predicted miRNAs included miR414, miR1132, miR1439, miR319, miR482, miR847, miR854, miR1436, and miR2628. The mature miRNA sequences were grouped into same member families based on mature miRNA sequence similarity searches using miRBase. In our predictions, the miR414 family was predicted to have the largest abundance of miRNA members (7 members) (Fig. 2), which was also reported in rice (O. sativa) [34], Stevia (Stevia rebaudiana) [35], and opium poppy (Papaver somniferum) [36], while the highest abundance of the same family was reported in switch grass (11 members) [13].

Fig. 2.

Abundance or frequency of microRNA (miRNA) families in Panax ginseng. miR414, miR1439 and miR319 families has highest abundance of miRNAs.

The second largest representative miRNA family was miR1439, where 6 members were identified in our predictions. Only 3 miRNA members of the miR1439 family were predicted in potato [11], whereas 6 members were predicted in P. ginseng. Previously, miR1439 was listed as a new rice miRNA [37] and salt induced miRNA in rice [34], and later it was identified in tobacco [15] and potato. Therefore, the prediction of some plant miRNAs in certain plant species may be responsible for special functions, and be conserved in particular species. Another family, miR319, was predicted with 5 members, while miR482, miR847, and miR854 contained 3 members in each family. Additionally, 2 members were contained in each miR1436, miR2628, and miR396 families. The rest of the families were represented with only one member. miR319, reported for various plant development functions like the regulation of leaf senescence, leaf morphogenesis, and leaf complexity [38], and stress regulation of miR319 was reported in sugarcane [39].

Two miRNA847s were reported in A. thaliana [40] and A. lyrata [41]. Interestingly, in our study, 3 members of miRNA847 were predicted in P. ginseng. Another miRNA, miR1436, was identified in this study, which was reported in barley [42], switch grass [13], and rice [34], while 7 members were identified for the same family in potato [11].

We further analyzed the characteristics of conserved miRNAs to distinguish from other small RNAs (Table 1). The length of mature miRNAs varies from 17 to 24 nt, where the majority of miRNAs are confined to 21 nt, followed by 20 and 19 nt (Fig. 3A). The typical lengths of plant mature miRNA sequences are 21 nt, which are in the highest abundance in ginseng miRNAs, similar to other plant species [13,32]. It was reported that the length of pre-miRNAs in plants ranges from 60 to >400 nt [43,44]. The length of precursor miRNAs in P. ginseng varies significantly from 55 to 366 nt; however, the majority of pre-miRNAs are 60 to 139 nt in length (Fig. 3B), which is similar to reports of other plant species [11,13].

Fig. 3.

(A) Length distribution of predicted microRNAs (miRNAs) in Panax ginseng, the majority of miRNAs are confined to 21 nucleotides. (B) Length of precursor miRNAs (pre-miRNAs) in P. ginseng, the length varies significantly from 55 to 366 nucleotides.

Having lower MFE is important for the sequences to form stable secondary loop structures for high thermodynamic stability [30]. In this study, the MFE value of identified P. ginseng miRNAs ranged from -20.53 to -99.8 kcal/mol, with an average of -35.78 kcal/mol. This MFE value of pre-miRNAs in the present study is consistent with previous reports [32]. MFEI was a valuable criteria used to distinguish potential miRNAs from other types of RNAs. If the MFEI value of the pre-miRNA was higher than 0.85, that sequence was considered to be a potential miRNA [44]. The average MFEI of the predicted P. ginseng miRNAs was 0.851 (Table 1).

Sequence analysis of small RNAs from deep sequencing

We used the high throughput Illumina sequencing technology to sequence small RNAs in P. ginseng in order to validate the expression patterns of the EST based predicted conserved P. ginseng miRNAs. In high throughput sequencing technology, total of 56,430,729 raw sequences were obtained from the 6-year-old flower buds, leaves, and lateral roots of P. ginseng. After removing the low quality sequences, the remaining sequences with length ranging from 17 to 27 nt were obtained. The sequences were further processed to remove other RNAs and redundant sequences. Finally, a total of 5,353,559 non-redundant sequence reads were used for miRNA analysis (Table 2).

Table 2.

Distribution of small RNA reads in sequenced Panax ginseng tissues

Description	Leaves	Flower buds	Lateral roots	Total
Raw sequences	24258021	10211169	21961539	56430729
Adaptor/quality/length (17-27 nt) trimmed	22803528	7021215	16777031	46601774
Matching t/rRNAs	919530	400059	470384	1789973
Redundant sequence	13625423	2789895	4714124	21129442
Non-redundant sequence	3849681	693590	810288	5353559
Total non-redundant sequence				5353559

nt, nucleotides, t/rRNA, transfer RNA/ribosomal RNA.

Digital gene expressions of conserved microRNAs in Panax ginseng by deep sequencing

Non-redundant small RNA sequences were used to analyze the digital gene expression pattern of already predicted conserved miRNAs in P. ginseng. The small RNA sequences with 100% miRNA sequence similarity with homology based predicted miRNA sequences were used for digital gene expression studies in three tissues. Among the predicted miRNA families by small RNA analysis, miR414 and miR1439 contained the largest number of miRNA with four members, followed by the miR854 family with 3 members. Other families such as miR1436 and miR482 were represented with 2 members in each family. The remaining families had only one member of miRNA.

The expression level of each of the miRNA families also varied. The miRNA family miR482a showed a very high level of expression (number of reads) with the largest number of reads in each organ, such as 740 reads in the flower buds, 13,510 reads in the leaves, and 178 reads in the lateral roots. Followed by, miRNAs such as miR1132h, miR816a, and miR1436d showing the second largest abundant expression of miRNA reads in all three libraries. The miRNAs miR2626, miR1132f, miR1436b and c, miR1439, miR854c and d, and miR414d, e, and f were predicted with >100 miRNA reads in total for all 3 libraries, whereas miRNAs such as miR1534a, miR2658, miR482c, miR414h, and miR156b were predicted with lower expressions.

Tissue specific expression patterns were also observed, as miR1534a was expressed in lateral roots, but it was not expressed in flower buds and leaves, whereas miR414h and miR2097 were detected in flower buds and leaves tissues, but not in lateral roots. The miRNA families miR1448, miR156b, and miR2673b showed expressions in leaves and lateral roots, but not in the flower buds. miRNAs such as miR2658 and miR482c have shown expressions only in leaves, and not in the other tissues (Table 3).

Table 3.

Digital gene expressions of conserved microRNAs (miRNAs) in Panax ginseng by deep sequencing

miRNA family	Mature miRNA sequence	Sequence length	Flower buds	Leaves	Lateral roots
miR1132h	UAUUAUGGGACGGAGGUAG	19	251	1235	90
miR1436c	UUAUCCUGGGACGGAGGGAGU	21	14	97	3
miR1436d	UUAUUAUGGGACGGAGGUAGU	21	184	933	61
miR1439a	UAUAGGAAUGGAGGGAGUAUU	21	2	12	1
miR1439b	UUUAGGAACGGAGGGAGUACU	21	23	150	12
miR1439h	UUUAGGAACGGAGGGAGUACU	21	23	150	12
miR1439c	UUUAGGAAUGGAGGGAGUAAU	21	3	28	6
miR1448	CUUUCCUAUUCCUCCCAUAC	20	0	15	1
miR1534a	UAUUUUGUGGAUAUAGUAAU	20	0	0	2
miR169h	GAACUGAAGAUGACUUGACGG	21	4	16	1
miR2097-5p	AGGGAAGGGAAGGGAAGGGAAG	22	1	16	0
miR2626	AACGUCGUGGUUAAGGGUGUC	21	49	554	7
miR2658	AUGUGACCUUUUUUAUGUGC	20	0	4	0
miR2673b	CCGCCUCUUCUUCCUCUUCCGC	22	0	27	7
miR414d	UCAUCAUCAUCAUCAUCAUCA	21	5	130	2
miR414e	UCAUCAUCAUCAUCAUCAUCA	21	5	130	2
miR414f	UCAUCAUCAUCAUCAUCAUCA	21	5	130	2
miR414h	UCAUCAUCAUCAUCAUCGAAU	21	1	6	0
miR482a	CCUAUUCCUCCCAUACC	17	740	13510	178
miR482c	CCUUUCCUAUUCCUCCCAUA	20	0	6	0
miR816a	GUGACAUACUCUACUUCAGC	20	44	1244	7
miR854b	GAGGAGGAGGAGGAGGAGGAG	21	13	63	17
miR854c	GAUGAGGAGGAGGAGGAGGAG	21	16	123	20
miR854d	GAUGAGGAGGAGGAGGAGGAU	21	11	86	14

Tissue specific expressions of miRNAs were reported in various plant species [9,24]. Even though the root was considered to be the main functional part in P. ginseng, leaves and flower buds were also reported for various ginsenosides. This kind of tissue specific expressions of miRNAs represents an interesting topic for further in-depth analysis.

The size distribution patterns of the identified small RNAs in P. ginseng were observed such that the majority of the small RNAs were 21 nt in size, followed by 20 nt, 22 nt, and 19 nt, as in the reports of other plant species, such as grapevine [9] and tomato [45].

Target prediction

Predicting potential targets of miRNA based on a computational approach were aided by the perfect and near perfect complementary characteristics of miRNA with their target mRNA [46]. In order to understand the putative functions of predicted miRNAs, 346 potential targets were identified for the predicted 69 conserved miRNAs by searching the ginseng EST database. Most of the miRNA targets were predicted (Appendix 1), whereas for some miRNAs such as miR482a, miR816, and miR1132, targets were unable to be predicted, which may be due to the limited number of EST sequences available in the databases. Most of the miRNAs were identified with more than one target, especially the miR414 families identified with 68 targets, the miR854 families with 44 targets, and the miR1439 families with 29 targets, which is consistent with the notion that one miRNA may have many targets [47]. Gene Ontology based functional classification of targets was analyzed for understanding the miRNA-gene regulatory network based on biological process and molecular function. In this study, predicted target functions were classified into biological process, molecular function, and cellular component. The main biological process of miRNA targets which involved in transport, protein modification process, regulation of transcription, response to various biotic and abiotic stimulus, secondary metabolic process, and regulation of gene expression which has important role in ginseng (Fig. 4A). The molecular function of predicted miRNA targets is involve in transporter, kinase activity, transcription factor, and protein binding (Fig. 4B) and plasma membrane is an main cellular component of miRNA targets (Fig. 4C).

Fig. 4.

MicroRNA (miRNA) targets grouped with Gene Ontology function. The main biological process of miRNA targets which involved in transport (A). The molecular function of predicted miRNA targets are involve in transporter (B) and plasma membrane is an main cellular component of miRNA targets (C).

The predicted putative target genes not only involved in the transcription factors, but also various physiological processes targeting miRNAs were predicted (Appendix 1). Transcription factors were targeted by the miR1439e, miR2109c, miR414h, miR414i, miR419e, miR5309, miR847a, and miR854 families. In our study, the miR414 family was identified with the largest number of targets, and this miR414 family was reported to be involved in lateral root development in potato [11]. In addition, miR397 and miR1533 were shown to be involved in lateral root development in potato, which the miR397 family was also predicted in P. ginseng, whereas miR1533 was initially identified and later removed from P. ginseng miRNAs due to the lower MFEI value.

In the present study, miR156a was predicted which was reported for leaf development, vegetative phase change, flowering, and fruit development by targeting the squamosa promoter binding (SPB) protein like family of transcription factors in other plant species [48]. It was also reported that higher levels of expression of miR156/157 could prolong root growth and development in the tuberous medicinal plant [22], but SPB targeting miR156 was unable to be predicted because of the limitless P. ginseng EST sequences. miR319, reportedly playing an important function in leaf morphogenesis [49], was identified in P. ginseng.

Ginsenosides, very important triterpenoid secondary metabolites in the medicinal plant P. ginseng, were reported for their various pharmacological properties. Genes such as 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR), farnesyl diphosphate synthase (FPS), geranyl-diphosphate synthase, squalene synthase, and squalene epoxidase (SE) were reported as putative ginsenoside pathway genes [27], and hydroxylation by cytochrome P450 and glycosylation mediated by UDP-glycosyltransferases lead to synthesis of various ginsenosides. Overexpression of P. ginseng squalene synthase was shown to increase the ginsenoside production [50]. These putative ginsenoside pathway genes were predicted as the miRNA targets, especially SE targeting miR854b and miR854c. To support this, previous reports have shown that SE was the target of miRNAs, especially miR1533 [11]. Previous reports on the target identification showed that HMGR and FPS were targeted by different miRNAs [11,23]. Accordingly, our results also showed that miR854e was identified to target FPS, while miRNA targeting HMGR was also predicted, but due to the lower MEFI value, it was removed in our analysis. Various cytochrome and glucosyltransferase targeting miRNAs were predicted in this study, as in the reports of other plant species [11,22]. Ginsenoside Ro is the only oleanane-type pentacyclic triterpene, which is a minor component in P. ginseng, and has different pharmacological effects. Beta-amyrin synthase converts 2, 3-oxidosqualene to beta-amyrin, which leads to the production of oleanane type ginsenosides (Ro). miRNAs such as miR1439b and miR1439h were predicted to target beta amyrin sythase in P. ginseng, which was also reported in potato [11]. Various reports have shown a high similarity between predicted miRNA and their targets to previously reported miRNA and their targets. Alternatively, our miRNAs and target predictions showed less similarity with previously reported known miRNAs and their targets. The lower availability of P. ginseng transcriptomes in GenBank, and the lower number of phylogenetic relations, or the lower similarity with other known crops, could be one of the possible reasons for less conservation in nature of P. ginseng miRNAs compared to other known miRNAs.

Some of the conserved miRNAs are expressed lower or below detection level in the case of the number of reads of small RNA sequences analyzed in flower buds, leaves, and lateral root tissues, and it may be present in other tissues that have not yet been analyzed. Most of the miRNA predictions in other plant species mainly used the young stage in their samples, whereas in contrast, we used fully matured tissues to sequence small RNA. These may be possible causes for the less expressed miRNAs in P. ginseng analyzed tissues. Numerous ginseng specific novel miRNAs may show a high level of expression in other tissues or organs, or different developmental stages are yet to be investigated and further experiments would provide more species specific miRNAs.

To sum up, we discovered 69 miRNAs in Korean ginseng, and tissue specific expression patterns of the identified miRNAs were analyzed using digital gene expressions of deep sequenced small RNAs of the flower buds, leaves, and lateral roots. Therefore, these results provide a basis for the regulatory roles of miRNA in ginseng. To get better insight into the miRNAs in ginseng, further studies on sRNA sequencing from specific tissues will be carried out.

Appendix 11.

Target prediction of identified microRNAs (miRNAs) in Panax ginseng

miRNA family	Target protein	Target ID
miR1134	1-O-acylglucose:anthocyanin-O-acyltransferase- like protein	Contig60089
miR1134	NAC domain-containing	Contig56197
miR1134	Oligopeptide transporter OPT family	Contig23794
miR1134	PDI-like protein	Contig45218
miR1134	RESA-like protein with	Contig45096
miR1134	Ribosome biogenesis protein	Contig45306
miR1134	RNA recognition motif-containing protein	Contig61121
miR1436c	Cytochrome C oxidase polypeptide	Contig48926
miR1436d	Protein kinase	Contig09014
miR1439a	Chromatin remodeling complex subunit	Contig45689
miR1439a	Enzyme of the cupin superfamily	Contig42038
miR1439a	Proton-dependent oligopeptide transport family protein	Contig30763
miR1439a	Synaptic glycoprotein SC2	Contig35006
miR1439b	Beta-amyrin synthase	Contig54769
miR1439b	Chromatin remodeling complex subunit	Contig45689
miR1439b	Disease resistance protein	Contig11515
miR1439b	Enzyme of the cupin superfamily	Contig42038
miR1439b	Nitroreductase family protein	Contig53658
miR1439c	Chromatin remodeling complex subunit	Contig45689
miR1439c	Disease resistance protein	Contig11515
miR1439c	Enzyme of the cupin superfamily	Contig42038
miR1439c	Transcription factor jumonji domain-containing protein	Contig45164
miR1439d	Armadillo beta-catenin repeat family protein	Contig45166
miR1439d	Disease resistance protein	Contig11515
miR1439d	Enzyme of the cupin superfamily	Contig42038
miR1439e	Enzyme of the cupin superfamily	Contig42038
miR1439e	Nucleic acid binding	Contig46706
miR1439e	Protein phosphatase	Contig38335
miR1439e	Serine endopeptidase	Contig33916
miR1439e	Squalene monooxygenase	Contig47397
miR1439e	TATA-associated factor II 58	Contig51124
miR1439e	WRKY transcription	Contig59342
miR1439h	Amino acid	Contig46145
miR1439h	Beta-amyrin synthase	Contig54769
miR1439h	Chromatin remodeling complex subunit	Contig45689
miR1439h	Disease resistance protein	Contig11515
miR1439h	Enzyme of the cupin superfamily	Contig42038
miR1439h	Nitroreductase family protein	Contig53658
miR1448	CC-NBS-LRR resistance protein	Contig55112
miR1448	Cinnamyl alcohol dehydrogenase-like protein	Contig48716
miR1448	Ftsh11 ( protease 11) ATP-dependent peptidase ATPase metallopeptidase	Contig23505
miR1448	mRNA binding protein precursor	Contig49813
miR1448	Pentatricopeptide repeat-containing	Contig49516
miR1534a	Acyl- oxidase	Contig09994
miR1534a	Calcium-dependent protein	Contig33156
miR1534a	Chromosome region maintenance protein 1	Contig48609
miR1534a	Cytochrome c oxidase polypeptide vc	Contig48926
miR1534a	Cytochrome p450 monooxygenase CYP72A59	Contig11848
miR1534a	Elongation factor 1-alpha	Contig15951
miR1534a	Fat domain-containing protein	Contig49029
miR1534a	Glucan synthase component	Contig49469
miR1534a	Glutathione peroxidase	Contig51675
miR1534a	Lipase class 3 family protein	Contig42396
miR1534a	Lon protease	Contig13984
miR1534a	Multidrug resistance protein	Contig52708
miR1534a	Phosphomethyl pyrimidine kinase thiamin-phosphate pyrophosphorylase	Contig52615
miR1534a	Pre-mRNA splicing factor rna	Contig01168
miR1534a	Pyrophosphate-energized vacuolar membrane proton	Contig03662
miR1534a	R2R3-myb transcription factor myb11	Contig10498
miR156a	Dead deah box helicase family protein	Contig46517
miR156a	Methionine synthase	Contig23436
miR156a	PPR protein	Contig17870
miR156a	Hypothetical Protein	Contig45577
miR156a	Soluble starch synthase iv-2	Contig47036
miR156a	Vitamin-b12 independent methionine 5-methyltetrahydropteroyltriglutamate-homocysteine	Contig31422
miR159a	Delta-1-pyrroline-5-carboxylate dehydrogenase	Contig26802
miR159a	Shaker-like potassium channel	Contig56945
miR164	F-box family protein	Contig35247
miR169h	26s protease regulatory subunit	Contig24305
miR169h	Heterogeneous nuclear ribonucleoprotein A2	Contig33032
miR169h	Ketose-bisphosphate aldolase class-ii family protein	Contig15415
miR172f	Calcium-binding allergen OLE	Contig36501
miR172f	Lipase class 3 family protein	Contig52276
miR172f	Type ii peroxiredoxin	Contig57487
miR1886c	Cation chloride cotransporter	Contig50840
miR1886c	CCAAT-binding transcription factor family protein	Contig48908
miR1886c	Ketose-bisphosphate aldolase class-ii family protein	Contig11222
miR1886c	Phospholipase D	Contig53739
miR1886c	Receptor protein kinase clavata1	Contig30888
miR2097-5p	2OG-FE oxygenase family protein	Contig20782
miR2097-5p	ABA response element binding factor	Contig36126
miR2097-5p	Cellulose synthase	Contig11555
miR2097-5p	DNA binding	Contig52665
miR2097-5p	Gamma-adaptin 1	Contig58073
miR2097-5p	Heat shock	Contig15069
miR2097-5p	MCA1 (mid1-complementing activity 1)	Contig45919
miR2097-5p	Nucleolar protein	Contig15060
miR2097-5p	Trehalose-6-phosphate synthase	Contig27435
miR2101-5p	ELP1 (edm2-like protein1)	Contig32343
miR2101-5p	Inositol-tetrakisphosphate 1	Contig46141
miR2101-5p	Meprin and traf homology domain-containing protein math domain-containing protein	Contig45263
miR2101-5p	Protein binding	Contig48832
miR2101-5p	S-adenosylmethionine-dependent methyltransferase	Contig52110
miR2101-5p	SPL1-related2 protein	Contig17762
miR2108b	Serine threonine protein kinase	Contig48746
miR2108b	With no lysine kinase	Contig45290
miR2109c	Transcription factor, putative	Contig43484
miR2112b	C2 domain-containing protein	Contig44978
miR2112b	Cytochrome	Contig46603
miR2112b	Transcriptional repressor	Contig23975
miR2606a	ARF1-binding protein	Contig31431
miR2606a	ATP binding	Contig51306
miR2606a	Heat shock protein 70 -interacting	Contig35223
miR2607	Cytosolic phosphoglucomutase	Contig21451
miR2607	Potassium transporter	Contig10118
miR2626	Obtusifoliol 14-alpha demethylase	Contig46095
miR2626	Zinc finger (C3HC4-type ring finger) family protein	Contig50055
miR2628a	Bromodomain protein	Contig30826
miR2628b	mRNA splicing	Contig45688
miR2642	Cinnamoyl- reductase	Contig49468
miR2642	Cytochrome c6	Contig62852
miR2642	Exocyst complex subunit SEC15-like family protein	Contig51982
miR2642	Pectinacetylesterase family protein	Contig16753
miR2642	Photosystem i PSAH protein	Contig57701
miR2642	Plasma membrane h+-ATPase	Contig19168
miR2642	Serine-threonine protein plant-	Contig51145
miR2643b	TPR repeat-containing protein	Contig48906
miR2658	Homeodomain leucine zipper protein	Contig28456
miR2658	Metalloendopeptidase	Contig51850
miR2658	Phosphoinositide binding	Contig62161
miR2665	3-phosphoserine phosphatase	Contig49532
miR2665	Ap2 ERF domain-containing transcription factor	Contig56891
miR2665	Diacylglycerol acyltransferase	Contig48735
miR2665	Multidrug resistance protein ABC transporter family	Contig17769
miR2673b	2-cys peroxiredoxin	Contig49523
miR2673b	6b-interacting protein 1	Contig37386
miR2673b	CBS domain-containing protein	Contig13027
miR2673b	Della protein	Contig45937
miR2673b	E3 ubiquitin ligase	Contig47870
miR2673b	Glycine-rich protein 2b	Contig38426
miR2673b	Glycine-rich RNA-binding protein	Contig60922
miR2673b	H Aca ribonucleoprotein complex subunit 1-like protein 1	Contig54326
miR2673b	Inositol phosphate kinase	Contig51804
miR2673b	Kinesin light	Contig45627
miR2673b	Phospholipid cytidylyltransferase	Contig32791
miR2673b	Protein kinase	Contig46112
miR2673b	Ribosomal protein l17-like protein	Contig53111
miR2673b	Hypothetical protein	Contig49580
miR2673b	Tata-binding protein-associated factor 2n-like	Contig33856
miR2673b	WRKY transcription	Contig62618
miR2673b	Zinc finger	Contig37605
miR2937	Dme DNA n-glycosylase DNA-(apurinic or apyrimidinic site) lyase	Contig45773
miR2937	Dynamin-related protein expressed	Contig47241
miR2937	Heat shock protein binding protein	Contig23728
miR2937	Phospho ribosylformylglycinamidine synthase	Contig56549
miR2937	Serine-threonine protein plant-	Contig48306
miR319b	Transcription factor WRKY4	Contig48636
miR319b	L1 specific homeobox gene atml1 ovule-specific homeobox protein a20	Contig55022
miR319b	Receptor protein kinase clavata1	Contig30156
miR319e	Transcription factor WRKY4	Contig48636
miR319e	L1 specific homeobox gene atml1 ovule-specific homeobox protein a20	Contig55022
miR319e	Receptor protein kinase clavata1	Contig30156
miR319f	Delta-1-pyrroline-5-carboxylate dehydrogenase	Contig26802
miR319f	Proteasome subunit alpha type 3	Contig25577
miR319g	Five finger-containing phosphoinositide	Contig51379
miR319g	Phototropic-responsive NPH3 family protein	Contig36246
miR319g	Ubiquitin-protein PUB49	Contig48309
miR319h	Phototropic-responsive NPH3 family protein	Contig36246
miR319h	Stromal membrane-associated	Contig19616
miR396b	Acyl- oxidase	Contig09994
miR396b	Beta-glucosidase-like protein	Contig07198
miR396b	Heat shock protein	Contig53532
miR396c	ABC transporter family protein	Contig48065
miR396c	AP2 ERF domain-containing transcription factor	Contig24365
miR396c	ELF3 homologue	Contig10723
miR396c	Mitochondrial substrate carrier	Contig46804
miR396c	Splicing factor	Contig58523
miR396c	Type-B response regulator	Contig33927
miR397	Actin	Contig20734
miR397	Cell division protein	Contig47714
miR397	Cytosolic malate dehydrogenase	Contig39102
miR397	Multidrug resistance-associated protein	Contig23354
miR397	Synaptic glycoprotein SC2	Contig35004
miR408a	Chemocyanin precursor	Contig57069
miR414d	60s ribosomal protein l6	Contig51433
miR414d	ADP-glucose pyrophosphorylase family protein	Contig52871
miR414d	Ascorbate peroxidase	Contig36806
miR414d	CBL-interacting serine threonine-protein	Contig46717
miR414d	Conserved hypothetical protein	Contig46471
miR414d	Cytochrome p450	Contig61265
miR414d	Late embryogenesis abundant protein LEA14	Contig49375
miR414d	NLI interacting factor family protein	Contig12161
miR414d	Pre-mRNA-splicing factor CWC-22	Contig30561
miR414d	Protein phosphatase	Contig39881
miR414d	Ring finger containing	Contig48197
miR414d	RNA helicase	Contig12914
miR414e	60s ribosomal protein l6	Contig51433
miR414e	ADP-glucose pyrophosphorylase family protein	Contig52871
miR414e	Ascorbate peroxidase	Contig36806
miR414e	CBL-interacting serine threonine-protein	Contig46717
miR414e	Conserved hypothetical protein	Contig46471
miR414e	Cytochrome p450	Contig61265
miR414e	Late embryogenesis abundant protein LEA14	Contig49375
miR414e	NLI interacting factor family protein	Contig12161
miR414e	Pre-mRNA-splicing factor CWC-22	Contig30561
miR414e	Protein phosphatase	Contig39881
miR414e	Ring finger containing	Contig48197
miR414e	RNA helicase	Contig12914
miR414f	60s ribosomal protein l6	Contig51433
miR414f	ADP-glucose pyrophosphorylase family protein	Contig52871
miR414f	Ascorbate peroxidase	Contig36806
miR414f	CBL-interacting serine threonine-protein	Contig46717
miR414f	Conserved hypothetical protein	Contig46471
miR414f	Cytochrome p450	Contig61265
miR414f	Late embryogenesis abundant protein LEA14	Contig49375
miR414f	NLI interacting factor family protein	Contig12161
miR414f	Pre-mRNA-splicing factor CWC-22	Contig30561
miR414f	Protein phosphatase	Contig39881
miR414f	Ring finger containing	Contig48197
miR414f	RNA helicase	Contig12914
miR414h	60s ribosomal protein l6	Contig51433
miR414h	Ascorbate peroxidase	Contig36806
miR414h	CBL-interacting serine threonine-protein	Contig46717
miR414h	Conserved hypothetical protein	Contig46471
miR414h	Cytochrome p450	Contig61265
miR414h	Heavy-metal-associated domain-containing protein	Contig27681
miR414h	Late embryogenesis abundant protein LEA14	Contig49311
miR414h	PIN1	Contig43002
miR414h	Pre-mRNA-splicing factor Cwc-22	Contig30561
miR414h	Ring finger containing	Contig48197
miR414h	Zinc finger	Contig47019
miR414i	Luminal binding protein	Contig16316
miR414i	Pentatricopeptide repeat-containing protein	Contig48382
miR414i	Zip transporter	Contig21400
miR414j	Cytochrome p450 reductase	Contig45338
miR414j	Heat shock factor	Contig50711
miR414j	Heavy-metal-associated domain-containing protein	Contig27681
miR414j	Kinase family protein	Contig24024
miR414j	Lectin protein kinase family protein	Contig21894
miR414j	MYB transcription factor	Contig16861
miR414j	Phosphatidylinositol-4-phosphate 5-kinase family protein	Contig50328
miR414j	Small RAS-like GTP-binding protein	Contig07528
miR414j	Tryptophanyl-tRNA synthetase	Contig34813
miR414j	Vacuolar morphogenesis protein	Contig08171
miR414l	Copalyl diphosphate synthase	Contig52365
miR414l	DNA binding	Contig36892
miR414l	Heat shock factor protein HSF30	Contig23567
miR414l	Insulinase containing expressed	Contig30114
miR414l	Leucine-rich repeat-containing	Contig54865
miR414l	Pescadillo-like protein	Contig30996
miR414l	RNA polymerase ii transcription elongation factor SPT5	Contig31454
miR414l	Ubiquitin-protein ligase 1	Contig17692
miR417	Binding protein	Contig37222
miR417	Nucleic acid binding	Contig33218
miR419e	Argonaute family member	Contig09488
miR419e	Auxin response factor 4	Contig30161
miR419e	Beta-glactosidase 8	Contig50325
miR419e	Bromodomain protein	Contig45057
miR419e	Bzip transcription factor	Contig52353
miR419e	Dna binding protein	Contig49741
miR419e	Heavy-metal-associated domain-containing protein	Contig61082
miR419e	Nucleosome assembly	Contig33375
miR419e	Polyphenol oxidase	Contig27778
miR419e	SIT4 phosphatase-associated family protein	Contig27966
miR446	Beta-galactosidase like protein	Contig45051
miR482	Alpha-glucosidase	Contig47628
miR530a	COP1-interacting protein 7	Contig30564
miR530a	ISP4-like protein	Contig45556
miR530a	Zinc finger protein	Contig27700
miR783	Pentatricopeptide repeat-containing	Contig55799
miR783	Short-chain dehydrogenase reductase family protein	Contig52837
miR783	Vacuolar protein sorting-associated	Contig50413
miR815	Adenylate kinase	Contig34836
miR815	Chromatin remodeling complex subunit	Contig04324
miR815	Cullin-like 1 protein	Contig30323
miR815	Dead-box protein	Contig31488
miR815	Fat domain-containing protein	Contig29906
miR815	Glutamyl-tRNA amidotransferase subunit A	Contig34203
miR815	Lysosomal alpha-glucosidase	Contig49082
miR815	RPH1 (resistance to phytophthora 1)	Contig38523
miR834b	Histone H3	Contig50215
miR834b	Receptor-like serine threonine protein kinase ARK3	Contig45114
miR834b	Set domain protein	Contig46763
miR846	Glucan endo beta-glucosidase	Contig42642
miR846	Kip-related cyclin-dependent kinase inhibitor 7	Contig47511
miR846	Multidrug resistance protein	Contig49696
miR846	RNA-binding protein CP31	Contig49296
miR847a	Bile acid: sodium symporter family protein	Contig58467
miR847a	Heat shock protein	Contig01966
miR847a	Viral A-type inclusion protein	Contig47741
miR847a	Zinc finger	Contig51073
miR847b	Amino acid binding	Contig46296
miR847b	Amino acid permease	Contig18864
miR847b	Binding protein	Contig30978
miR847b	Chlorophyll a, b-binding protein	Contig50308
miR847b	Geranylgeranyl pyrophosphate synthase-related protein	Contig49005
miR847b	Inositol -trisphosphate 5 6 kinase	Contig46827
miR847b	Serine threonine protein kinase	Contig34614
miR847b	TPR domain containing protein	Contig45092
miR847b	Vitamin-B12 independent methionine 5-methyltetrahydropteroyltriglutamate-homocysteine	Contig23525
miR847c	2-dehydro-3-deoxyphosphoheptonate aldolase 3-deoxy-d-arabino-heptulosonate 7-phosphate synthetase	Contig28077
miR847c	Amidohydrolase domain-containing protein	Contig56377
miR847c	Cytosolic phosphoglycerate kinase 1	Contig13961
miR847c	DNA repair protein RAD4 family	Contig36417
miR847c	Eukaryotic translation initiation factor 4g	Contig17702
miR847c	PSI type iii chlorophyll a b-binding protein	Contig52383
miR847c	Small nuclear ribonucleoprotein E	Contig56509
miR847c	Vacuolar ATP synthase subunit	Contig47586
miR847c	Vq motif-containing protein	Contig35306
miR847c	Zinc finger	Contig48641
miR854b	CRR3 (chlororespiratory reduction 3)	Contig53843
miR854b	Ethylene responsive element binding factor	Contig49258
miR854b	MYB-related transcription factor LBM2-like	Contig59010
miR854b	Squalene epoxidase	Contig52768
miR854b	Starch branching enzyme ii	Contig30265
miR854b	Transcription initiation factor iib	Contig34296
miR854b	UDP-n-acetylglucosamine: dolichol phosphate n-acetylglucosamine-1-p transferase	Contig32764
miR854c	Transcription factor WRKY4	Contig56799
miR854c	CRR3 (chlororespiratory reduction 3)	Contig53843
miR854c	DNA binding	Contig35557
miR854c	Ethylene responsive element binding factor	Contig49258
miR854c	F-box family protein	Contig47190
miR854c	Gamma response i protein	Contig21322
miR854c	Hypothetical protein	Contig56684
miR854c	Phototropic-responsive NPH3 family protein	Contig46596
miR854c	Plastid division protein	Contig45829
miR854c	Polynucleotide phosphorylase	Contig32431
miR854c	Protein binding protein	Contig34488
miR854c	RNA helicase	Contig12919
miR854c	SAS10 U3 ribonucleoprotein family protein	Contig27731
miR854c	Squalene epoxidase	Contig52768
miR854c	Starch branching enzyme ii	Contig30265
miR854c	Transcription initiation factor iib	Contig34296
miR854c	Type i phosphodiesterase nucleotide pyrophosphatase family protein	Contig46494
miR854c	U4 u6 small nuclear ribonucleoprotein PRP3	Contig26841
miR854c	Ubiquitin-conjugating enzyme e2 I	Contig14762
miR854d	Transcription factor WRKY4	Contig56799
miR854d	Aminoacyl-tRNA synthetase family	Contig15841
miR854d	C-4 sterol methyl oxidase	Contig48724
miR854d	Chalcone isomerase	Contig52143
miR854d	Galactosyltransferase family protein	Contig04535
miR854d	Heat shock protein 90	Contig06778
miR854d	PDV2 (plastid division2)	Contig53900
miR854d	Serine threonine protein kinase	Contig21634
miR854e	Cell division protein	Contig11097
miR854e	Farnesyl diphosphate synthase	Contig50044
miR854e	Glutathione reductase	Contig12638
miR854e	Inositol-tetrakisphosphate 1	Contig33622
miR854e	Multicatalytic endopeptidase proteasome beta subunit	Contig48772
miR854e	Pbf68 protein	Contig53517
miR854e	Phospholipase D	Contig51301
miR854e	Pre-mRNA splicing factor PRP38	Contig48032
miR854e	TCP family transcription	Contig47975
miR854e	Type i phosphodiesterase nucleotide pyrophosphatase family protein	Contig46494