Literature DB >> 23697400

Characterization of Stra8 in Southern catfish (Silurus meridionalis): evidence for its role in meiotic initiation.

Ranran Dong1, Shijie Yang, Jing Jiao, Tingru Wang, Hongjuan Shi, Linyan Zhou, Yaoguang Zhang, Deshou Wang.   

Abstract

BACKGROUND: RA (retinoic acid) signal pathway has been proved to be required for germ cell meiotic initiation in mammals, aves and amphibians. Stra8 (Stimulated by retinoic acid gene 8) is an important factor in RA signal pathway. However, the role of RA and Stra8 in germ cell meiotic initiation in teleosts is poorly characterized.
RESULTS: In this study, the full length cDNA of Stra8 was cloned from Southern catfish (Silurus meridionalis), and its spatio-temporal expression profiles were analyzed. The Stra8 cDNA (1606 bp) includes 163 bp 5'-UTR (untranslated region), 456 bp 3'-UTR, and an ORF (open reading frame) of 987 bp, encoding a polypeptide of 328 aa. Phylogenetic analysis revealed its existence in some primitive teleosts, such as Siluriformes and Salmoniformes. Tissue distribution analysis by RT-PCR showed that Stra8 is specifically expressed in gonads. By real-time PCR, in situ hybridization and immunohistochemistry, the highest expression level of Stra8/Stra8 was detected in 50 and 130 dah (day after hatching), the premeiotic stage of germ cells in XX and XY gonads, respectively.
CONCLUSIONS: Our results suggest that Stra8 might be involved in germ cell meiotic initiation in S. meridionalis as it did in tetrapods.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23697400      PMCID: PMC3668142          DOI: 10.1186/1471-2199-14-11

Source DB:  PubMed          Journal:  BMC Mol Biol        ISSN: 1471-2199            Impact factor:   2.946


Background

Meiosis is a special type of cell division necessary for sexual reproduction in eukaryotes. It not only generates genetic diversity on which natural selection can act, but also helps maintain the immortality of the germ line [1]. In mammals, meiosis is initiated at different time points in males and females. Recent discoveries indicate that the key to this sex-specific timing of meiosis entry is the presence or absence of the signaling molecule RA (retinoic acid) [2-7]. In mouse, a model was proposed in which RA signaling and metabolism regulate whether female and male germ cells initiate meiosis during embryogenesis. The model posits that, in embryonic ovaries, RA induces germ cells to express Stra8, which in turn leads to meiotic initiation. In embryonic testes, an enzyme of the Cyp26 family, likely Cyp26b1, degrades RA and thereby prevents expression of Stra8 and precludes meiotic initiation [8-10]. In avians and amphibians, the role of RA in meiotic initiation is similar to that in mammals showing that RA-dependent meiosis entry could be a conserved mechanism of germ cell differentiation in tetrapods [11,12]. Stra8 which was first identified in a screen for genes induced by RA is specifically expressed in mammalian germ cells before their transition from mitosis to meiosis [13-16]. Studies on the teratocarcinoma cells and embryonic stem cells (ESC) transfected with Stra8-EGFP shown that the positive cells may undergo meiosis develop into sperm and generate live offspring mice [16]. In female embryos lacking Stra8 gene function, the early mitotic development of germ cells is normal, but these cells then fail to undergo premeiotic DNA replication, meiotic chromosome condensation, cohesion, synapsis and recombination [17]. Analysis of Stra8-deficient testes of mice demonstrated that Stra8 is essential for normal progression into meiotic prophase [4,14,17]. Above all, Stra8 is the key factor involved in RA signal pathway in the control of germ cell meiosis. The role of Stra8 in the meiosis of teleost has not yet been reported. Some researchers even suspected that Stra8 may be amniote- or even mammalian-specific, according to Ensemble orthologue prediction (http://www.ensembl.org/index.html) [18]. In the present study, homologous sequences of Stra8 were isolated from channel catfish, rainbow trout and salmon in EST database, and Stra8 cDNA was cloned from S. meridionalis. The spatial and temporal expression patterns of Stra8 were examined by RT-PCR, real-time PCR, in situ hybridization and immunohistochemistry. The study shows for the first time that Stra8 is expressed highest in the premeiotic phase of germ cell in S. meridionalis. Our data indicated that Stra8 may be involved in meiotic initiation of S. meridionalis.

Results

Cloning and characterization of S. meridionalis Stra8 cDNA

Using degenerated PCR amplification, a cDNA fragment of 642 bp was obtained and was confirmed to be a partial sequence of S. meridionalis Stra8 gene by homology search in the GenBank database. The full length cDNA of Stra8 was successfully isolated by RACE-PCR. Stra8 cDNA (accession number: KC533813) was 1606 bp in length containing an open reading frame (ORF) of 987 bp, corresponding to 328 amino acid residues and the 5’ and 3’ UTRs of 163 and 483 bp, respectively. The predicted molecular mass and pI value of the deduced Stra8 protein were 43 kDa and 4.29, respectively.

Amino acid sequence alignment

Alignment of the S. meridionalis Stra8 with those from other organisms revealed a low identity, especially in the N-terminal regions (Figure  1). The overall similarity between fish and tetrapods Stra8 is very low, averagely less than 30%. It shared 28% similarity with H. sapiens (NP_872295), 29% with M. musculus (NP_033318) and M. gallopavo (XP_003202232), 30% with G. gallus (XP_416179), 27% with A. carolinensis (XP_003221102), and 23% with X. tropicalis (XP_002941476). However, S. meridionalis Stra8 shared 75% with I. punctatus, and 44% with O. mykiss, respectively. There are three motifs (depicted as Box 1–3) relatively conserved among all Stra8. Box3 is the most important and conserved signature motif. All fish share the same 12 amino acid sequences in this motif while only 3 out of 12 amino acid residues differ between Stra8 from fish and tetrapods.
Figure 1

Alignments of Stra8 with those of other species. ClustalX and GeneDoc were used to make this figure. The overall similarity among the isolated Stra8 is very low, averagely less than 30%. The three relatively conserved motifs were depicted as Box 1–3. The sources of the sequences are described in the Materials and Methods section. Has, H.sapiens; Bta, B. taurus; Mmu, M. musculus; Rno, R. norvegicus; Gga, G. gallus; Clf, C. lupus familiaris; Omy, O. mykiss; Aca, A. carolinensis; Mga, M. gallopavo; Ipu, I. punetaus; Sme, S. meridionalis.

Alignments of Stra8 with those of other species. ClustalX and GeneDoc were used to make this figure. The overall similarity among the isolated Stra8 is very low, averagely less than 30%. The three relatively conserved motifs were depicted as Box 1–3. The sources of the sequences are described in the Materials and Methods section. Has, H.sapiens; Bta, B. taurus; Mmu, M. musculus; Rno, R. norvegicus; Gga, G. gallus; Clf, C. lupus familiaris; Omy, O. mykiss; Aca, A. carolinensis; Mga, M. gallopavo; Ipu, I. punetaus; Sme, S. meridionalis.

Phylogenetic analysis of Stra8

Phylogenetic analysis of Stra8 from representative cephalochordate, fish, amphibians, reptiles, avians and mammals (Figure  2) produced an NJ-phylogenetic tree that contained three distinct branches. The S. meridionalis Stra8 clustered with those of fish, while sequences from tetrapod and cephalochordate formed a separate cluster, respectively.
Figure 2

Phylogenetic tree of Stra8. The tree was made with the default settings of the ClustalX protein alignment program and visualized using treeview32. The values represent bootstrap scores out of 1000 trials, indicating the credibility of each branch. Asterisks indicate partial sequences.

Phylogenetic tree of Stra8. The tree was made with the default settings of the ClustalX protein alignment program and visualized using treeview32. The values represent bootstrap scores out of 1000 trials, indicating the credibility of each branch. Asterisks indicate partial sequences.

Tissue distribution by RT-PCR

In adult S. meridionalis, Stra8 was found to be exclusively expressed in gonads, with much higher expression in the testis compared with the ovary (Figure  3).
Figure 3

RT-PCR analysis of Stra8 from various adult tissues. B, brain; P, pituitary; G, gill; H, heart; S, spleen; L, liver; I, intestine; O, ovary; T, testis; K, kidney; M, muscle; HK, head kidney; +, positive control; -, negative control. Lower panel: β-actin was used as internal control.

RT-PCR analysis of Stra8 from various adult tissues. B, brain; P, pituitary; G, gill; H, heart; S, spleen; L, liver; I, intestine; O, ovary; T, testis; K, kidney; M, muscle; HK, head kidney; +, positive control; -, negative control. Lower panel: β-actin was used as internal control.

Expression profiles of Stra8 in gonads by real-time PCR

As shown in Figure  4(a), the relative expression of Stra8 mRNA was at the highest level in 50 dah ovaries and 130 dah testes, corresponding to the premeiotic stage of germ cells, and at lower levels in 40 and 60 dah ovaries as well 110 and 150 dah testes.
Figure 4

Expression profile of /Stra8 in gonads during germ cell meiotic initiation analyzed by real-time PCR (a), hemotoxylin-eosin (H.E.) staining (b), in situ hybridization and immunohistochemistry (c), respectively. (a), Values represent the relative mRNA expression. Data were expressed as the mean ± SE of the triplicates. Bars bearing the same letters are not significantly different at P < 0.01 by one-way ANOVA. Weak mRNA and protein signals was detected in 40 dah and 60 dah ovaries and 110 dah and 150 dah testes (C, E, I, K, O, Q, R and T). Strong signals were found in premeiotic germ cells in 50 dah ovaries and 130 dah testes (D, J, P and S). The positive signal corresponds to the brownish color (R). Arrowhead indicates the signals of Stra8/Stra8 in ovaries and testes, respectively. H.E. staining (F-H, L-N).

Expression profile of /Stra8 in gonads during germ cell meiotic initiation analyzed by real-time PCR (a), hemotoxylin-eosin (H.E.) staining (b), in situ hybridization and immunohistochemistry (c), respectively. (a), Values represent the relative mRNA expression. Data were expressed as the mean ± SE of the triplicates. Bars bearing the same letters are not significantly different at P < 0.01 by one-way ANOVA. Weak mRNA and protein signals was detected in 40 dah and 60 dah ovaries and 110 dah and 150 dah testes (C, E, I, K, O, Q, R and T). Strong signals were found in premeiotic germ cells in 50 dah ovaries and 130 dah testes (D, J, P and S). The positive signal corresponds to the brownish color (R). Arrowhead indicates the signals of Stra8/Stra8 in ovaries and testes, respectively. H.E. staining (F-H, L-N).

Localization of Stra8 in gonads

Morphological observation of gonads by H.E. staining

To observe the germ cell meiosis in female and male gonads, H.E. staining was performed using ovaries at 40, 50 and 60 dah and testes at 110, 130 and 150 dah. The results showed that ovaries at 40, 50 and 60 dah were mainly composed of premeiotic oogonia and primary oocytes, respectively; while testes at 110, 130 and 150 dah, were basically composed of synchronized spermatogonia and primary spermatocytes (Figure  4 b). The results also showed that the majority germ cells are in the premeiotic phase in 50 dah ovaries and testes130 dah.

Expression, purification, and Western blot analysis

Recombinant Stra8 protein with a His-tag at its N terminus was successfully expressed in E. coli. Unpurified and purified recombinant Stra8 proteins were analyzed by SDS-PAGE with Coomassie blue staining (Figure  5). The specificity of the Stra8 antibody was confirmed by Western blotting. Specific bands of 43 kDa corresponding to the calculated molecular weights of the S. meridionalis Stra8 fusion proteins and total proteins extracted from 50 dah ovaries and 130 dah testes were recognized using our own Stra8 antibody (Figure  5).
Figure 5

SDS-PAGE and Western blot analyses of recombinant His-Stra8 proteins and total proteins extracted fromgonads. a) Stra8 protein with His-tag expressed in E. coli and total proteins extracted from 50 dah ovaries and 130 dah testes of S. meridionalis were analyzed by SDS-PAGE followed by Coomassie blue staining. b) The endogenous mature peptide of Stra8 was further demonstrated with Stra8 polyclonal antibody by chemiluminescence.

SDS-PAGE and Western blot analyses of recombinant His-Stra8 proteins and total proteins extracted fromgonads. a) Stra8 protein with His-tag expressed in E. coli and total proteins extracted from 50 dah ovaries and 130 dah testes of S. meridionalis were analyzed by SDS-PAGE followed by Coomassie blue staining. b) The endogenous mature peptide of Stra8 was further demonstrated with Stra8 polyclonal antibody by chemiluminescence.

Cell types of Stra8/Stra8 in gonads by ISH and IHC

To identify the localization of Stra8/Stra8 in gonads, ISH and IHC was performed using ovaries at 40, 50 and 60 dah and testes at 110, 130 and 150 dah. The results showed that specific signals of Stra8/Stra8 were observed in germ cells in gonads of both sexes. Weak mRNA and protein signals were detected in 40 dah ovaries and 110 dah testes (Figure  4 C, I, O and S). Strong signals were found in premeiotic germ cells in 50 dah ovaries and 130 dah testes (Figure  4 D, J, P and T). The signals became weaker in the 60 dah ovary and 150 dah testes (Figure  4 E, K, Q and U). The positive signal corresponds to the brownish color (Figure  4 R). No signal was detected in the negative control without the primary antibody (Figure  4 V).

Discussion

In this study, the full length cDNA of the Stra8 was cloned and characterized in a teleost, S. meridionalis, for the first time. Stra8 sequences were found to be poorly conserved among vertebrates. According to the phylogenetic tree, Stra8 might be existed in the common ancestor of cephalochordate and vertebrate. It is speculated that like in tetrapods Stra8 may be widespread in teleosts. However, in teleosts, Stra8 was not found in the genome databases of zebrafish, medaka, fugu, tetraodon, stickleback and Nile tilapia. Stra8 sequences were only isolated from Siluriformes and Salmoniformes by bioinformatics analysis of available databases. There are two possibilities for this, 1) It is difficult to identify Stra8 from other fish species because of the very low sequence similarity; 2) Stra8 is not included in the databases because of incomplete genome sequencing. In mammals, Stra8 was expressed in embryonic ovaries just before meiotic initiation, whereas its expression in testes was first detected after birth [2]. In this study, tissue distribution analysis showed that Stra8 was specifically expressed in gonads of both sexes of adult S. meridionalis. In mouse, moderate levels of Stra8 transcript in gonocytes and the peak of Stra8 mRNA expression coincided with the onset of meiosis in postnatal testes. Stra8 mRNA levels were greatly reduced or absent in germ cells once they entered meiosis by microarrays [19]. Interestingly, in this study real-time PCR showed that Stra8 was expressed at the highest level in ovaries at 50 dah and testes at 130 dah. In addition, our previous work showed that meiosis of germ cell in S. meridionalis initiated at about 50 dah, whereas meiosis of male germ cells initiated at about 130 dah [20]. This unique expression pattern made us curious to examine the cellular localizations of Stra8 transcripts and protein in gonads. ISH and IHC analysis revealed that Stra8/Stra8 signals were only observed in germ cells. Consistant with the Real-time PCR results, strongest signals were detected in ovaries at 50 dah and testes at 130 dah, respectively. Furthermore, hemotoxylin-eosin (H.E.) staining verified that the majority of germ cells in 50 dah ovaries and in 130 dah testes were in the premeiotic phase. These results suggest that Stra8 may play an important role in meiotic initiation in S. meridionalis. It is well document that meiosis is initiated through retinoic acid induction of Stra8 in both male and female germ lines in higher vertebrates [21-25]. There is also evidence for similar role of RA in germ cell meiotic initiation in amphibians [12]. In addition, Cyp26b1, an RA catabolic enzyme, was proved to regulate germ cell fate in a manner common among vertebrates in Japanese flounder [26]. Long term treatment of XX Nile tilapia with Citral, an RA synthetase inhibitor, from 5 dah resulted in female to male sex reversal (unpublished data from our group). In the present study, we showed evidence for possible involvement of Stra8, the key factor for RA signal pathway, in germ cell meiotic initiation in S. meridionalis. Taken together, these data strongly suggest that RA may play important roles in germ cell meiotic initiation in teleosts as it did in tetrapods.

Conclusions

Stra8 cDNA full-length was successfully cloned from S. meridionalis. Sequence and phylogenetic analyses demonstrated that it is the genuine counterpart of mammalian Stra8. Tissue distribution analysis revealed that it was exclusively expressed in the gonad. Real-time PCR, ISH and IHC analyses showed that it was highly expressed in the premeiotic phase of germ cells in both ovaries and testes. These results indicated that Stra8 probably participated in meiotic initiation in S. meridionalis as it did in higher vertebrates. Stra8 is the key factor in RA induced germ cell meiotic initiation. Together with the results from Japanese flounder and tetrapods, we conclude that RA-dependent meiotic initiation might be a conserved mechanism of germ cell differentiation in vertebrates.

Methods

Animals

Adult S. meridionalis which has XY heterogametic sex determination were obtained from the Jialing River, a branch of the Yangtze River, and were kept in aerated tanks until use. All fry used in the experiments were obtained by artificial propagation using the same parental fish raised in our laboratory. All animal experiments conformed to the Guide for Care and Use of Laboratory Animals and were approved by the Committee of Laboratory Animal Experimentation at Southwest University, Chongqing, China. The pre-meiotic, meiotic and post-meiotic stages of germ cells were assessed according to meiotic initiation time and germ cell morphology characterized in S. meridionalis[20]. Gonads were sampled at these stages for real-time PCR, H.E., ISH and ICH staining.

Nucleic acid preparation and first-strand cDNA synthesis

Total RNA was extracted from various tissues using Tissue RNA Rapid Extraction Kit (TaKaRa, Japan) according to the manufacturer's protocol. The quantity and quality of RNA were examined by UV-spectrophotometry (OD260/OD280) and agarose gel electrophoresis, respectively. Total RNA (500 ng) from various tissues were reverse transcribed into first-strand cDNA using PrimeScript RT Master Mix Perfect Real Time Kit (TaKaRa, Japan) according to the manufacturer's instructions.

Degenerated RT-PCR (reverse transcription polymerase chain reaction)

Homologous sequences of Stra8 were isolated from Channel Catfish, rainbow trout and salmon in EST database. However, Stra8 was not found in the genome databases of zebrafish, medaka, fugu, tetraodon, stickleback and Nile tilapia. Degenerated primers (Table  1) were designed based on the conserved domain from known Stra8 homology sequences and were used to amplify the target fragment of the Stra8 cDNA. First strand cDNA was subjected to PCR amplification using Premix Ex Taq™Hot Start Version (TaKaRa, Japan) and degenerated primers (10 μM) were used at final concentrations in a 25 μl reaction for 94°C for 3 min, followed by 30 cycles of 94°C for 30 s, 58°C for 30 s, 72°C for 2 min and a final elongation step at 72°C for 8 min. PCR products were separated on 1.5% agarose gel and purified with an Gel Extraction Kit (Omiga BioTek, USA). The purified PCR products were cloned into a pMD19-T vector (TaKaRa, Japan) overnight. The recombinant plasmid was transformed into E. coli competent cells DH5α and positive clones were sequenced at Life Technologies Corporation (Shanghai, China). The retrieved sequences were verified and analyzed for similarity with other known Stra8 sequences using the BLASTX program at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast.cgi).
Table 1

Primers used in the present study

Primer namePrimer sequence (5’ to 3’)Purpose
Stra8-F1
CCAACATCCAGGAGTTTGA
cDNA fragment PCR
Stra8-F2
GGGATATCTCTTTTTCTAC
Stra8-F3
GCCATCTCAGGCCTGTGG
Stra8-R3
CCTGAGATGGCCTCGGACACTAC
Stra8-R2
CTGTAGTAGATCCTCCTCA
Stra8-R2
CACCACATCATAGGCATCCTG
Stra8-RACE-F1
GAGCTTCTCTTGCGCAGTGGAGTG
RACE PCR
Stra8-RACE-F2
GTCCGAGGCCATCTCAGGCCTGTGGA
Stra8-RACE-F3
CCACTGACTCACATCTCTACGGCTT
Stra8-RACE-R3
CACTCCACTGCGCAAGAGAAGCTCGA
Stra8-RACE-R2
CACAGGCCTGAGATGGCCTCGGACACT
Stra8-RACE-R1
GCCGTAGAGATGTGAGTCAGTGGTCT
Stra8-sF0
CCTCAGCAAGCTCCTTGCACTGAA
Tissue distribution
Stra8-sR0
GCTCTGCAGTACTGAAGGCCTGTT
Stra8-F0
GAGCAGGTATGTCCCGTTTGG
Full length cDNA amplification
Stra8-R0
GGAGGAACTGGCTAGAAATCC
Stra8-Q-F
AGTGCCTGATGTAGATGA
Real-time PCR
Stra8-Q-R
AGAGTCTCGCTGTAGAAG
sc-β-actin-F
GGCATCACACCTTCTACAACGA
Internal control
sc-β-actin-RACGCTCTGTCAGGATCTTCA 
Primers used in the present study

Rapid amplification of cDNA ends (RACE)

Full-length Stra8 cDNA was obtained by 5’- and 3’-RACE method using the SMARTer™RACE cDNA Amplification Kit (Clontech, USA) according to the manufacturer's protocol. The 5’- and 3’-RACE primers (Table  1) were designed based on the obtained Stra8 cDNA fragment sequences. The PCR program was performed for 26 cycles of 94°C for 30 s, 68°C for 30 s and 72°C for 3 min. The amplified cDNA fragments were cloned and sequenced as described for degenerated RT-PCR above. Then the full-length Stra8 cDNA was sequenced again to confirm the nucleotide sequences.

Multiple sequence alignment and phylogenetic analysis

Deduced protein sequences of Stra8 from various species were retrieved from GenBank and phylogenetically compared with those of S. meridionalis. Multiple alignments were carried out using ClustalX and GeneDoc [27]. A bootstrapped neighbor-joining phylogenetic tree using D. rerio Stra6 (NP_001038777) as outgroup was constructed and viewed with Treeview 32. The credibility of the branching was tested using bootstrap resampling with 1000 pseudo replicates. Except S. meridionalis Stra8 which was cloned in this study, all other Stra8 protein sequences were obtained from the NCBI database (http://www.ncbi.nlm.nih.gov/). The accession numbers of these Stra8 protein sequences are: H. sapiens (NP_872295), C. familiaris (XP_852820), M. musculus (NP_033318), R. norvegicus (XP_575429), B. Taurus (XP_001253650), M. gallopavo (XP_003202232), G. gallus (XP_416179), A. carolinensis (XP_003221102), X. tropicalis (XP_002941476), O. mykiss (CX037430), S. salar (DW470925). Gene-specific primers were used for the RT-PCR analysis. Positive and negative controls were set up with plasmid DNA and water, respectively, as templates to validate the distribution pattern. A 342 bp fragment of β-actin was amplified (as internal control) from S. meridionalis to test the quality of the cDNAs used in the PCR. The PCR conditions consisted of 94°C (3 min), followed by 30 cycles of 94°C (30s), 62°C (30s), and 72°C (30s), the reaction was ended by a further 10 min at 72°C. PCR was performed on a C1000 thermal cycler (Bio-Rad, USA). All the PCR products were subjected to agarose gel (1.5%) electrophoresis and gels were stained with ethidium bromide to visualize bands.

Real-time PCR analysis

mRNA expression analysis for different meiotic stages of ovaries and testes were conducted via Real-time PCR according to the following method: gene-specific primers (Table  1) were designed based on the cloned Stra8 cDNA to produce an amplicon of 152 bp. Real-time-PCR was performed in a C1000™ Thermal Cycler (BioRad CFX 96™ Real-Time System) according to the manufacturer's protocol. The final volume of each Real-time-PCR reaction was 20 μl, which contained 10 μl 2×SYBR Premix ExTaq (TaKaRa, Japan), 2.0 μl of 10-fold diluted cDNA template, 6 μl of PCR-grade water, and 1.0 μl of each 10 μM primer. PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Each sample was run in triplicates and normalized to the selected control gene β-actin of S. meridionalis. The primers of β-actin (Table  1) were designed to produce an amplicon of 342 bp. Stra8 expression levels were calculated by the 2−ΔΔCt Comparative CT method [28]. Mean and standard deviations were calculated from triplicate experiments, and presented as n-fold differences in expression relative to β-actin. Data was analyzed using the the CFX Manager™ software (version 1.0). Data is reported as mean ± standard error of mean (S.E.). The homogeneity of variance was confirmed and comparison between means was performed with a one-way ANOVA. Duncan's procedure was used for multiple comparisons between groups. Differences were regarded as significant when P<0.01. All statistical analyses were performed by STATISTICA 6.0.

Hemotoxylin-eosin (H.E.) staining and in situ hybridization (ISH)

Gonads were fixed in Bouin’s solution, embedded in paraffin, and cross-sectioned at 5 μm. Sections were deparaffinized, hydrated, H.E. stained and mounted. Gonads were fixed in 4% paraformaldehyde in 0.85× PBS (pH 7.4) at 4°C. After fixation, gonads were embedded in paraffin. Cross sections were cut at 5 μm. Probes of sense and anti-sense digoxigenin-labeled RNA strands were transcribed in vitro with an RNA labelling kit (Roche, Germany) from plasmid DNA containing ORF of the Stra8. The hybridization was carried out as follows: sections (5 μm) were deparaffinized, hydrated and treated with proteinase K (Amersco, USA.) and then hybridized with the sense or antisense DIG-labelled RNA probe at 60°C for 18-24h. The hybridization signals were then detected using alkaline phosphatase-conjugated anti-DIG antibody (Roche, Germany) and NBT as described previously [29].

Stra8 recombinant protein expression, antibody production and Western blot analysis

An expression vector of Stra8 was constructed using pCold I. Recombinant S. meridionalis Stra8 with His-tag at its N-terminal was expressed in E. coli by IPTG induction until the absorbance value reached an OD600 of 0.5-0.6. His-Stra8 recombinant protein purified using Ni-NTA superflow cartridge (Qiagen) was used as the antigen to immunize rabbit (female, from Chongqing Medical University Animal Centre) three times at 15 day intervals with 25–30 μg antigen each time for the production of polyclonal antibodies. Ten days after the last immunization, rabbit blood was collected for ELISA evaluation. To confirm the polyclonal antibody specificity, total proteins extracted from both the fish gonads as well as the His-Stra8 recombinant proteins (both purified and unpurified) were separated on 12% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) gels. The separated proteins were transferred onto PVDF membranes and immunoblotted with the primary antibodies against Stra8 (Anti-Stra8, ×1000). After PBS washing, chemiluminescence was applied for the detection after incubation with secondary antibody conjugated with horseradish peroxidase. In order to enhance the signal of Stra8 protein from fish gonads, chemiluminescence was performed as described previously [5], and the signal was visualized on Fusion Fx (BioRad, USA) using super signal west picoluminol /Enhancer Solution and super signal west picostable peroxide Solution (Pierce, USA) as substrates after PBS washing.

Immunohistochemistry (IHC)

After washing with 0.01 M PBS three times for 10 min per wash, sections were immersed in 0.01 M citric acid buffer (pH 6.0) containing 0.1% Tween 20, and autoclaved for 5 min. The sections were then treated in a blocking solution (Roche, China), incubated with Stra8 rabbit polyclonal antibody (1:1000) overnight at 4°C, and rinsed with 0.01 M PBS three times for 5 min per wash. Subsequently, the tissue sections were incubated with a second antibody (goat anti-rabbit IgG) conjugated with horseradish peroxidase (Bio-Rad) at 1:2000 for 30 min, and then rinsed with PBS three times for 5 min per wash. Immunoreactive signals were visualized using diaminobenzidine (Sigma) as the substrate. Sections were counterstained with hematoxylin. For the negative control, the primary antibody was replaced with normal rabbit serum.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

RD performed the experiments on ISH, ICH and drafted the manuscript. SY did the work on H.E. staining and ISH. JJ cloned the Stra8 cDNA and did the work on tissue distribution. TW and HS did the work on western blot. LZ did the work on bioinformatics’ analysis. YZ and DW designed and directed the study and write the manuscript. All authors read and approved the final manuscript.
  27 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

2.  New insights into the regulation of gametogenesis by retinoic acid.

Authors:  William W Wright
Journal:  Biol Reprod       Date:  2010-09-15       Impact factor: 4.285

3.  Sex determination: time for meiosis? The gonad decides.

Authors:  Amanda Swain
Journal:  Curr Biol       Date:  2006-07-11       Impact factor: 10.834

4.  Proliferation of germ cells during gonadal sex differentiation in medaka: Insights from germ cell-depleted mutant zenzai.

Authors:  Daisuke Saito; Chikako Morinaga; Yumiko Aoki; Shuhei Nakamura; Hiroshi Mitani; Makoto Furutani-Seiki; Hisato Kondoh; Minoru Tanaka
Journal:  Dev Biol       Date:  2007-08-07       Impact factor: 3.582

Review 5.  [STRA8 as a specific expression marker in postnatal male germ cells].

Authors:  Xia-Ying Lu; Bei Yang; Si-Fan Xu; Ting Zou
Journal:  Zhonghua Nan Ke Xue       Date:  2010-02

6.  High temperature induces cyp26b1 mRNA expression and delays meiotic initiation of germ cells by increasing cortisol levels during gonadal sex differentiation in Japanese flounder.

Authors:  Toshiya Yamaguchi; Takeshi Kitano
Journal:  Biochem Biophys Res Commun       Date:  2012-02-11       Impact factor: 3.575

7.  Sexually dimorphic gene expression in the developing mouse gonad.

Authors:  Douglas B Menke; David C Page
Journal:  Gene Expr Patterns       Date:  2002-12       Impact factor: 1.224

8.  [Stra8: a specifically expressed gene in premeiotic germ cells' transition from mitosis to meiosis].

Authors:  Mei-Ling Mi; Bei Yang; Si-Fan Xu; Ting Zou
Journal:  Zhonghua Nan Ke Xue       Date:  2009-01

9.  STRA8 shuttles between nucleus and cytoplasm and displays transcriptional activity.

Authors:  Marianna Tedesco; Gina La Sala; Federica Barbagallo; Massimo De Felici; Donatella Farini
Journal:  J Biol Chem       Date:  2009-12-18       Impact factor: 5.157

10.  Onset of meiosis in the chicken embryo; evidence of a role for retinoic acid.

Authors:  Craig A Smith; Kelly N Roeszler; Josephine Bowles; Peter Koopman; Andrew H Sinclair
Journal:  BMC Dev Biol       Date:  2008-09-17       Impact factor: 1.978

View more
  6 in total

1.  Retinoic acid homeostasis through aldh1a2 and cyp26a1 mediates meiotic entry in Nile tilapia (Oreochromis niloticus).

Authors:  Ruijuan Feng; Lingling Fang; Yunying Cheng; Xue He; Wentao Jiang; Ranran Dong; Hongjuan Shi; Dongneng Jiang; Lina Sun; Deshou Wang
Journal:  Sci Rep       Date:  2015-05-15       Impact factor: 4.379

2.  Gene evolution and gene expression after whole genome duplication in fish: the PhyloFish database.

Authors:  Jeremy Pasquier; Cédric Cabau; Thaovi Nguyen; Elodie Jouanno; Dany Severac; Ingo Braasch; Laurent Journot; Pierre Pontarotti; Christophe Klopp; John H Postlethwait; Yann Guiguen; Julien Bobe
Journal:  BMC Genomics       Date:  2016-05-18       Impact factor: 3.969

3.  Transcriptomic analysis of the differentiating ovary of the protogynous ricefield eel Monopterus albus.

Authors:  Jinfeng Cai; Wei Yang; Dong Chen; Yize Zhang; Zhi He; Weimin Zhang; Lihong Zhang
Journal:  BMC Genomics       Date:  2017-08-03       Impact factor: 3.969

4.  Retinoic acid and meiosis induction in adult versus embryonic gonads of medaka.

Authors:  Mateus C Adolfi; Amaury Herpin; Martina Regensburger; Jacopo Sacquegno; Joshua S Waxman; Manfred Schartl
Journal:  Sci Rep       Date:  2016-09-28       Impact factor: 4.379

5.  Transcriptome Dynamics During Turbot Spermatogenesis Predicting the Potential Key Genes Regulating Male Germ Cell Proliferation and Maturation.

Authors:  Xueying Wang; Qinghua Liu; Shihong Xu; Yongshuang Xiao; Yanfeng Wang; Chengcheng Feng; Rui Xue; Haixia Zhao; Zongcheng Song; Jun Li
Journal:  Sci Rep       Date:  2018-10-25       Impact factor: 4.379

6.  Involvement of the retinoic acid signaling pathway in sex differentiation and pubertal development in the European sea bass Dicentrarchus labrax.

Authors:  Paula Medina; Ana Gómez; Silvia Zanuy; Mercedes Blázquez
Journal:  Heliyon       Date:  2019-02-05
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.