In this study, a MADS-box gene (BpMADS), which is an ortholog of AP1 from Arabidopsis, was isolated from birch (Betula platyphylla). Transgenic Arabidopsis containing a BpMADS promoter::GUS construct was produced, which exhibited strong GUS staining in sepal tissues. Ectopic expression of BpMADS significantly enhanced the flowering of tobacco (35S::BpMADS). In addition, the chloroplasts of transgenic tobacco exhibited much higher growth and division rates, as well rates of photosynthesis, than wild-type. A grafting experiment demonstrated that the flowering time of the scion was not affected by stock that overexpressed BpMADS. In addition, the overexpression of BpMADS resulted in the upregulation of some flowering-related genes in tobacco.
In this study, a MADS-box gene (BpMADS), which is an ortholog of AP1 from Arabidopsis, was isolated from birch (Betula platyphylla). Transgenic Arabidopsis containing a BpMADS promoter::GUS construct was produced, which exhibited strong GUS staining in sepal tissues. Ectopic expression of BpMADS significantly enhanced the flowering of tobacco (35S::BpMADS). In addition, the chloroplasts of transgenic tobacco exhibited much higher growth and division rates, as well rates of photosynthesis, than wild-type. A grafting experiment demonstrated that the flowering time of the scion was not affected by stock that overexpressed BpMADS. In addition, the overexpression of BpMADS resulted in the upregulation of some flowering-related genes in tobacco.
In plants, vegetative and reproductive development occur postembryonically in the meristem, a small group of undifferentiated cells. Shoot apical meristems (SAMs) can develop into either shoots or flowers. The transition from the vegetative phase to the reproductive phase is controlled by complex genetic networks. Five genetically defined pathways, including the vernalization, photoperiod, gibberellin, autonomous, and endogenous pathways, control flowering [1]. Arabidopsis plants with mutations in three genes, including CO, FCA, and GA1, which function in the long-day, autonomous, and gibberellin pathways, respectively, never flower under long- or short-day conditions. This indicates that the three pathways impaired by these mutations are absolutely required for flowering under long- or short-day conditions [2]. Signals from different pathways interact to regulate floral development through the action of flowering pathway integrators, such as FT and SOC1. Integrators act upstream of floral meristem identity genes, such as AP1 and LFY, to determine the fate of the SAM [3], [4]. In Arabidopsis, AP1 converts inflorescence shoot meristems into floral meristems, and ectopic AP1 expression can dramatically reduce the time to flowering [5]. In addition, LFY expression in Arabidopsis is sufficient to determine floral fate in lateral shoot meristems of Arabidopsis
[6]. In strong ap1 mutants of Arabidopsis, sepals and petals fail to develop, and secondary flowers develop in the axils of sepals that have been converted into bracts [7], [8].In this study, we cloned a MADS-box gene from Betula platyphylla Suk (BpMADS), which is an ortholog of AP1 in Arabidopsis. The ectopic expression of BpMADS in tobacco (Nicotiana tabacum) not only promoted the transition to flowering, but it also enhanced the division and growth of the chloroplast.
Materials and Methods
Isolation of BpMADS
We previously constructed a SSH cDNA library from the female inflorescence of Betula platyphylla Suk (unpublished data). The partial sequence of BpMADS (GenBank No. EE284583) showed high levels of homology (73%) with AP1 in Arabidopsis according to the Blast analysis in GenBank. The full-length cDNA for BpMADS was cloned from total RNA of birch inflorescences using the SMART™ RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA), according to the manufacturer’s instructions. The primers used to amplify the open reading frame (ORF) of BpMADS were as follows: MADS-Forward: (ATGGGGAGGGGTAGGGTTCAGCT) and MADS-Reverse: (TCACGTGGCAAAGCATCCAAGGT). The deduced BpMADS cDNA protein was identified using Expasy tools (http://www.expasy.org/tools).
Quantitative Real-time PCR Analysis
To detect the expression of BpMADS, total RNA was isolated from male inflorescences, leaf buds, and young leaves of birch tree (Betula platyphylla Suk) that were exposed to 6 h of light or 6 h of dark in a greenhouse, respectively. For quantitative real-time PCR analysis (Q-PCR), a PrimeScript RT Reagent Kit (TaKaRa, Dalian, China), SYBR Premix EX Taq II (TaKaRa), and an MJ Opticon 2 System (Bio-Rad, Hercules, CA, USA) were employed following the manufacturer’s instructions. Gene-specific primers were used to quantify the BpMADS transcripts, and 18 s ribosomal RNA was used as an internal reference. To estimate the transcript levels of flowering-related genes in transgenic and wild-type tobacco with Q-PCR, aerial parts of 20-day-old transgenic and wild-type tobacco plants were harvested before flower buds were visible. Specific primers for flowering-related genes were used for Q-PCR, and the actin gene (GenBank No. JQ435884) was used as an internal reference. All primers employed for Q-PCR are shown in Table 1. Each reaction was conducted in triplicate to ensure the reproducibility of results. Expression levels were calculated from the cycle threshold using the delta-delta CT method [9].
Table 1
Primers employed in quantitative real-time PCR.
Plant species
Gene
Sequence
Birch
18S-F
ATCTTGGGTTGGGCAGATCG
18S-R
CATTACTCCGATCCCGAAGG
BpMADS-F
CTAGTTGCAGCTGATTCTGAAGG
BpMADS-R
CCTTTCTCTGAAGCTGCGAG
Tobacco
NtActin-F
TGTGTTGGACTCTGGTGATG
NtActin-R
CGCTCGGTAAGGATCTTCATC
NsMADS3-F
ACAACTCAAACTCAGGGCG
NsMADS3-R
TGTAGTTATTCACACTGGGCC
NtMADS4-F
GGAAGACTCAAAACATGCTGG
NtMADS4-R
TGACAATCGAAGTGGAACTCG
NtMADS5-F
GCATGGGTACAAGGAATCAAG
NtMADS5-R
TCCTACAACCACATCCTTGC
NtMADS11-F
AAGAAAGGGAGAAAGAGCTGG
NtMADS11-R
GGGCTGTGACAAAACGAATG
NtFUL-F
GCTCTTAAACACATTCGCTCAAG
NtFUL-R
CAACTCTTTCTCCCTCTCCTTC
NtSOC1-F
TGGCCTTCAACAGAGACAAG
NtSOC1-R
ACGCCTTATTCTGCACTCG
NFL2-F
AATCAGGTGTTCAGGTACGC
NFL2-R
TCGCTCCTTGAAAGCTCTTC
Generation of Transgenic Arabidopsis
A 1.8-Kb fragment upstream of the transcription start site of BpMADS was amplified by PCR using genomic DNA from birch with a Genome Walking Kit (Takara, Dalian, China), according to the manufacturer’s instructions. The DNA fragment was inserted into the vector pCAMBIA-1301 to obtain a GUS fusion vector, in which the 35S promoter upstream of GUS was deleted and replaced with the BpMADS promoter. The resulting construct was introduced into Agrobacterium tumefaciens strain EHA105 and transformed into Arabidopsis thaliana (ecotype Col-0) plants using the floral dip method [10].
Northern Blot Analyses
To detect the expression of exogenous BpMADS, 10 µg of total RNA from young leaves of 20-day-old tobacco plant was separated on 1% agarose denaturing formaldehyde gel, transferred to a Hybond-N+nylon membrane and fixed by UV cross-linking (254 nm, 8 min). Hybridization and detection were conducted following the manufacturer’s instructions (DIG Northern Starter Kit, Roche, Mannheim, Germany).
Subcellular Localization Analysis
The cDNA encoding the ORF of BpMADS was cloned into the vector pTH2 to generate the BpMADS-GFP gene fusion driven by the CaMV35S promoter as described by Niwa [11]. The BpMADS-GFP construct was transformed into onion epidermal cells by particle bombardment (Bio-Rad PDS-1000/He System, USA). The transient expression of the BpMADS-GFP fusion protein was observed through a Zeiss confocal microscope.
Generation of Transgenic Tobacco Plants Overexpressing BpMADS
To constitutively express in BpMADS in tobacco, BpMADS was cloned into the XbaI and SacI sites of the pROKII vector under the control of the CaMV35S promoter and the NOS terminator. The resulting vector, pROKII-BpMADS, was transferred into Agrobacterium tumefaciens strain EHA105 using the freeze–thaw transformation method [12]. Transgenic tobacco plants (Nicotiana tabacum cv. ‘Havana SRI’) were obtained by Agrobacterium-mediated transformation as described by Horsch et al. [13]. Tobacco transformants were selected on differentiation medium (MS medium supplemented with 20 g l−1 sucrose, 0.1 mg l−1 1-Naphthylacetic acid [NAA], 0.5 mg l−1 N6-Benzyladenine [6-BA], and 8 g l−1 agar) containing 60 mg l−1 kanamycin (Km). Tobacco seedlings were germinated and grown in pots containing soil in a growth room at 22±2°C under lights with a photon flux density of 200 µmol m−2 s−1, with a 16 h light/8 h dark cycle.
Histological Microscope Observations
To observe the cell morphology of tobacco leaves, plant tissue samples mounted on scanning electron microscope (SEM) stubs were frozen in liquid nitrogen for several minutes and quickly observed under a scanning electron microscope (FEI Quanta 200).To observe chloroplasts, leaf samples were fixed in 5% glutaraldehyde solution with 0.05 M phosphate at 4°C and post fixed in 2% OsO4 for 2 hours. The samples were dehydrated in ethyl alcohol and embedded in epoxy resin. For transmission electron microscopy (TEM) observation, pale golden sections of fixed samples were loaded onto 100-mesh copper grids coated with Formvar (1% in ethylene dichloride), stained with uranyl acetate and lead citrate, and viewed with TEM.For histological observation of vegetative apices of tobacco, 15-day-old seedlings were collected and fixed by immersion in a formalin:acetic acid:ethanol:water solution (FAA, 1∶1:9∶9 v:v) at room temperature for 48 h and stored in 70% ethanol at 4°C. The fixed material was then stained with hematoxylin solution (Ehrlich) for 2 days. After dehydration through an ethanol series (30, 50, 70, 85, 95, and 100% at 2 h for each concentration), the samples were embedded in paraffin wax (58–60°C). Longitudinal semi-sections (8 µm) were produced from fixed tobacco apices using a microtome (HM 340 E; Microm International GmbH, Walldorf, Germany) and fixed onto glass slides. The sections were dewaxed in xylene for 5–10 min and observed under a light microscope (Docuval, Carl Zeiss, Germany).
Histochemical Staining for Lignin
For phloroglucinol-HCl staining, hand-cut sections of 4-week-old tobacco stems were collected and fixed by immersion in FAA fixation liquid at room temperature for 48 h and stained with 1% phloroglucinol in 95% ethanol and concentrated HCl (2∶1, v:v) for 5 min, followed by observation under a light microscope.
Histochemical Staining for Starch
For starch-iodine staining, young leaves of 3-week-old tobacco plants subjected to 3 h of light treatment were harvested and fixed in FAA fixation liquid for 24 h. After chlorophyll extraction, the leaves were incubated in iodine solution for 20 min and washed with deionized water. The leaves, which contained iodine-stained starch, were photographed with a digital camera.
Histochemical Analysis for GUS Activity
Histochemical analysis of GUS activity was performed as described by Jefferson et al. [14]. The plant material was collected and immediately incubated in GUS staining buffer (100 mM sodium phosphate pH 7.0, 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide, 0.5 mM potassium ferrocyanide, 0.5 mM potassium ferricyanide, 10 mM Na2EDTA, and 0.1% Triton X-100) for 16 h at 37°C. The stained tissues were then rinsed with a graded ethanol series until pigments such as chlorophyll were completely cleared. The samples were then photographed with a camera mounted on a Carl Zeiss laser scanning microscope.
Chlorophyll Content Analysis
The chlorophyll content of leaves was measured using the DMSO method as described by Barnes et al. [15] and Shinano et al. [16].
Measurement of Photosynthetic Rates
Leaf photosynthesis was measured with a LI-6400 portable photosynthesis system (LiCor, Nebraska, USA). After stabilization in a greenhouse for 1 hour, the leaf photosynthetic rate under saturated light was measured, and photosynthetic active radiation (PAR) was maintained at 1,500 µmol m−2 s−1 using an LED red-blue light source.
Grafting Experiment
In this experiment, 25-day-old tobacco seedlings, which contained three leaves, were used as stock, and 14-day-old seedlings were used as scion. A classic wedge-shaped/slit grafting technique was employed, and the site of the union was wrapped with Parafilm. The plants were covered with plastic bags to maintain a relative humidity level of 80%. The plants were grown for a total of 10 days in 80% humidity.
Results
The cDNA for the BpMADS ORF is 732 bp in length from the ATG start codon to the TGA stop codon. This cDNA encodes a predicted polypeptide of 243 amino acids with a molecular weight of 28.01 kDa and a pI of 8.99. The sequence was deposited in GenBank under accession number JX565468. The predicted BpMADS polypeptide exhibits high identity at the amino acid level (74%) with AP1 (AT1G69120) in Arabidopsis and extremely high identity (97%) with BpMADS3 (GenBank No. X99653) from Betula pendula
[17].
Subcellular Localization Analysis of BpMADS
The subcellular localization of the BpMADS protein was examined by introducing the BpMADS-GFP fusion protein into onion epidermal cells by particle bombardment. GFP from the control plasmid (lacking BpMADS) localized to the cytoplasm and the nucleus (Figure 1A–1C). BpMADS-GFP fluorescence in transformed onion cells was observed in the cytoplasm and the nucleus (Figure 1D–1F). In a previous study examining the expression of the AP1 ortholog of Arabidopsis, expression of the C-terminal AP1-GFP appeared to occurred exclusively in the nucleus, while the N-terminal GFP:AP1 fusion produced a mainly cytoplasmic signal [18]. In present study, transformed onion epidermal cells expressing C-terminal BpMADS:GFP produced both cytoplasmic and nuclear signals.
Figure 1
Subcellular localization analysis of BpMADS.
The BpMADS-GFP fusion (and GFP alone) were transiently expressed under the control of the CaMV 35S promoter in onion epidermal cells and observed under a confocal microscope. The photographs were taken in dark field for green fluorescence localization (A, D), in bright light to examine cellular morphology (B, E), and in combination (C, F). (A, B, C) Transient expression of GFP in the control (D, E, F) Expression of the BpMADS-GFP fusion protein.
Subcellular localization analysis of BpMADS.
The BpMADS-GFP fusion (and GFP alone) were transiently expressed under the control of the CaMV35S promoter in onion epidermal cells and observed under a confocal microscope. The photographs were taken in dark field for green fluorescence localization (A, D), in bright light to examine cellular morphology (B, E), and in combination (C, F). (A, B, C) Transient expression of GFP in the control (D, E, F) Expression of the BpMADS-GFP fusion protein.
Expression Profiles of BpMADS
Transgenic Arabidopsis plants containing the BpMADS promoter fused to GUS (BpMADS::GUS) were examined by histochemical analysis. Strong GUS activity was detected in young sepals of the transformants (Figure 2). In Arabidopsis, AP1 RNA is uniformly expressed in young flower primordia, and later becomes localized to sepals and petals, which suggests that AP1 acts locally to specify the identity of the floral meristem and to determine sepal and petal development [19]. No GUS activity was detected in the petals of BpMADS::GUS Arabidopsis plants, suggesting that there are differences in the expression profiles of AP1 in Arabidopsis and its ortholog in birch.
Figure 2
GUS staining of transgenic Arabidopsis inflorescence.
The inflorescence was sampled from a 30-day-old seedling of an Arabidopsis transformant (containing the BpMADS promoter driving the GUS reporter gene).
GUS staining of transgenic Arabidopsis inflorescence.
The inflorescence was sampled from a 30-day-old seedling of an Arabidopsis transformant (containing the BpMADS promoter driving the GUS reporter gene).The male inflorescences of birch are visible in Northeast China in July. We therefore examined the expression levels of BpMADS in male inflorescence buds and leaves in July in plants exposed to light or dark conditions using Q-PCR (Table 2). BpMADS exhibited a high level of expression in male inflorescences and extremely low levels of expression in leaves, which is consistent with the results of Elo et al. [17]. In addition, our experiment demonstrated that light treatment increases the expression of BpMADS in birch.
Table 2
Relative expression of BpMADS in birch.
Inflorescence
Leaves
Dark
10089.57±1283.35
0.63±0.13
Light
4623.23±200.57
0.13±0.02
Young leaves and inflorescences of birch treated with 6 h of light or 6 h of dark. Values are expressed as mean ± S.D. (n = 3 samples for each test).
Young leaves and inflorescences of birch treated with 6 h of light or 6 h of dark. Values are expressed as mean ± S.D. (n = 3 samples for each test).
Modulation of Flowering Time by Constitutive Expression of BpMADS
Tobacco was transformed with BpMADS under the control of the constitutive CaMV35S promoter. Three homozygous (T3 generation) 35S::BpMADS tobacco lines (MADS-1, MADS-2, and MADS-3) were selected for subsequent analysis. Northern blot analysis confirmed that these lines overexpressed exogenous BpMADS, while wild-type tobacco did not (Figure 3). The transgenic plants (35S::BpMADS) exhibited much earlier stem initiation than the wild-type. However, the transformants were dwarfed, with a final aerial height of less than 15 cm, while the final aerial height of wild-type plants was greater than 50 cm after more than 80 days of growth (Figure 4). In addition, the transgenic plants flowered considerably earlier than wild-type plants, indicating that the overexpression of BpMADS is sufficient to promote the transition from vegetative to reproductive development (Figure 5A–5C). Flower buds were first visible in the transformants only four weeks after sowing, when the aerial heights of the plants were under 4 cm. Under long-day conditions (with a 16 h light/8 h dark cycle), all transformants flowered less than 40 days after sowing, whereas the wild-type plants flowered 65 days after sowing (Figure 5C). The transformants were dwarfed and produced fewer than 10 leaves before flowering. By contrast, wild-type plants produced more than 15 leaves before flowering. However, there was no significant variation in either flower or fruit morphology, or fertility levels, between transgenic and WT plants, although the transgenic plants developed lower numbers of flower buds and fruits than the wild-type (Figure 5D and 5E).
Figure 3
Northern blot analysis of BpMADS expression in transgenic tobacco.
Leaves were sampled from wild-type and transgenic plants. WT, wild-type; 1–3, three 35S::BpMADS lines (MADS-1, MADS-2, and MADS-3).
Figure 4
Plant height of transgenic and wild-type tobacco at different time points.
The tobacco seedlings were grown in a greenhouse. Each test was repeated with nine seedlings (n = 9). Nine seedlings from homozygous 35S::BpMADS lines (MADS-1, MADS-2 and MADS-3) were selected at random. Error bars indicate SD.
Figure 5
Effects of BpMADS overexpression on flowering in transgenic tobacco.
(A) 28-day-old wild-type and (B) 35S::BpMADS seedlings. (C) phenotype of wild-type and 35S::BpMADS seedlings at various time points; 65-day-old wild-type and 40-day-old 35S::BpMADS were in bloom. (D, E) Flower and fruit phenotype of wild-type (D) and 35S::BpMADS (E) plants. (F) Wild-type and 35S::BpMADS leaf explants were cultured on differentiation media (MS medium supplemented with 20 g/L sucrose, 0.1 mg/L NAA, 0.5 mg/L 6-BA, and 8 g/L agar) for 30 days under normal light conditions; no flower buds were found in the wild-type. (G) Close-up view of the circled area in (F); arrows indicate flower buds. (H) Rudimentary flower bud formed directly from a leaf disk on differentiation media. (I) Wild-type and 35S::BpMADS leaf explants were cultured on differentiation media for 30 days in the dark; no flower buds developed on wild-type or 35S::BpMADS plants.
Northern blot analysis of BpMADS expression in transgenic tobacco.
Leaves were sampled from wild-type and transgenic plants. WT, wild-type; 1–3, three 35S::BpMADS lines (MADS-1, MADS-2, and MADS-3).
Plant height of transgenic and wild-type tobacco at different time points.
The tobacco seedlings were grown in a greenhouse. Each test was repeated with nine seedlings (n = 9). Nine seedlings from homozygous 35S::BpMADS lines (MADS-1, MADS-2 and MADS-3) were selected at random. Error bars indicate SD.
Effects of BpMADS overexpression on flowering in transgenic tobacco.
(A) 28-day-old wild-type and (B) 35S::BpMADS seedlings. (C) phenotype of wild-type and 35S::BpMADS seedlings at various time points; 65-day-old wild-type and 40-day-old 35S::BpMADS were in bloom. (D, E) Flower and fruit phenotype of wild-type (D) and 35S::BpMADS (E) plants. (F) Wild-type and 35S::BpMADS leaf explants were cultured on differentiation media (MS medium supplemented with 20 g/L sucrose, 0.1 mg/L NAA, 0.5 mg/L 6-BA, and 8 g/L agar) for 30 days under normal light conditions; no flower buds were found in the wild-type. (G) Close-up view of the circled area in (F); arrows indicate flower buds. (H) Rudimentary flower bud formed directly from a leaf disk on differentiation media. (I) Wild-type and 35S::BpMADS leaf explants were cultured on differentiation media for 30 days in the dark; no flower buds developed on wild-type or 35S::BpMADS plants.When cultured on differentiation medium, transgenic leaf disks exhibited a strikingly different morphology from those of wild-type. All of the normal apical and lateral shoots developed into terminal rudimentary flowers, with petals, stamens, and some floral organs that were not well developed, while no flower buds were present on the wild-type shoots at the same time point (Figure 5F and 5G). Some flower buds formed directly on transgenic leaf disks, instead of forming from shoot meristems that were transformed into floral meristems (Figure 5H). When leaf explants were cultured on differentiation medium in the dark, there was no significant difference in phenotype between transgenic and wild-type plants, with no flower buds generated on transgenic leaf disks. These results suggest that the accelerated conversion to flowering caused by the overexpression of BpMADS requires the presence of light (Figure 5I).
Altered Morphology and Development of 35S::BpMADS Plants
In addition to affecting the induction of flowering, the overexpression of BpMADS had other affects on the phenotype of the transgenic lines. As shown in Figure 6A, the 35S::BpMADS plants exhibited profound changes in the shapes of the fourth and subsequent true leaves, with a higher ratio of length/width in the transgenic plants than in the wild-type. SEM results indicate that guard cells in young transgenic leaves developed earlier than those in wild-type plants (Figure 6B and 6C). In addition, the palisade cells of transgenic plants were large and well developed and were arranged more closely together than those of the wild-type (Figure 6D and 6E). Phloroglucinol reacts with coniferaldehyde groups in lignin, resulting in staining; the intensity of staining reflects the total lignin content [20]. The results of phloroglucinol staining indicate that the stem of transgenic tobacco contained much more lignin than wild-type, suggesting that the overexpression of BpMADS accelerates the formation of lignin (Figure 6F and 6G). Histological observation revealed that the indeterminate meristems of transgenic seedlings did not develop as floral meristems 15 days after sowing. However, wild-type plants had bigger meristems than transgenic plants (Figure 6H and 6I).
Figure 6
Microscopic observation of tobacco.
(A) The fourth true leaves from 25-day-old wild-type and 35S::BpMADS seedlings. (B, C) SEM observation of upper-epidermal cells in the third true leaves of 20-day-old wild-type (B) and 35S::BpMADS (C) seedlings; arrows indicate immature guard cells. (D, E) SEM observation of cross sections of third true leaves from 20-day-old wild-type (D) and 35S::BpMADS (E) seedlings. (F, G) Hand-cut sections of 4-week-old wild-type (F) and 35S::BpMADS (G) tobacco stems treated with phloroglucinol-HCl for lignin staining. (H, I) Histological observation of apical shoots from 15-day-old wild-type (H) and 35S::BpMADS (I) tobacco seedlings.
Microscopic observation of tobacco.
(A) The fourth true leaves from 25-day-old wild-type and 35S::BpMADS seedlings. (B, C) SEM observation of upper-epidermal cells in the third true leaves of 20-day-old wild-type (B) and 35S::BpMADS (C) seedlings; arrows indicate immature guard cells. (D, E) SEM observation of cross sections of third true leaves from 20-day-old wild-type (D) and 35S::BpMADS (E) seedlings. (F, G) Hand-cut sections of 4-week-old wild-type (F) and 35S::BpMADS (G) tobacco stems treated with phloroglucinol-HCl for lignin staining. (H, I) Histological observation of apical shoots from 15-day-old wild-type (H) and 35S::BpMADS (I) tobacco seedlings.
Chlorophyll Content and Photosynthetic Analysis
The leaves of 35S::BpMADS plants were darker green than those of wild-type. Because chlorophyll gives leaves their green color, we examined the difference in chlorophyll content in wild-type vs. transgenic plants. The results show that there was a significant difference in both total chlorophyll content and the contents of pigments, including chlorophyll a, chlorophyll b, and carotenoid, between young 35S::BpMADS and wild-type plants (Figure 7). In addition, TEM also showed that the chloroplasts in both the palisade and spongy mesophyll cells of transgenic leaves were bigger and more abundant than those in wild-type leaves (Figure 8). Together, these results suggest that the overexpression of BpMADS enhances chlorophyll synthesis as well as chloroplast division and growth. Chlorophyll is extremely important for photosynthesis in plants. We therefore examined the photosynthetic rate of transformed and wild-type plants using a portable photosynthesis system. A high photosynthetic rate was detected in 35S::BpMADS plants, with a level more than 2-fold higher than that of wild-type plants (Figure 9). In addition, transgenic leaves exhibited stronger starch-iodine staining than wild-type (Figure 10).
Figure 7
Chlorophyll content analysis.
Leaves were collect from 25-day-old tobacco plants. Each transgenic line showed significant differences compared with wild-type, as determined by SPSS 11.5 analysis (Student's t-test, p = 0.05); values are expressed as means (n = 3 leaves for each test); error bars indicate S.D. ** p<0.01 for t test; * p<0.05 for t test. WT, wild-type; MADS1-3, 35S::BpMADS lines MADS1-3; Car, carotenoid; Chla, chlorophyll a; Chlb, chlorophyll b.
Figure 8
TEM observation of chloroplasts.
For TEM observation of chloroplasts, second true leaves were collect from 14-day-old tobacco plants. (A) wild-type; (B) 35S::BpMADS line MADS-1. UE, upper-epidermis; PM, palisade mesophyll; SM, spongy mesophyll; LE, lower-epidermis. Arrows indicate chloroplasts.
Figure 9
Photosynthetic rate analysis.
Leaf photosynthesis was measured with a LI-6400 portable photosynthesis system. Data comparison between transgenic and wild-type was performed using SPSS 11.5 (Student's t-test, p = 0.05); values are expressed as means (n = 3 plant for each test); error bars indicate S.D. ** p<0.01 for t-test; * p<0.05 for t-test. WT, wild-type; MADS-1–3, 35S::BpMADS lines MADS-1–3.
Figure 10
Starch-iodine staining of leaves.
After 3 h of culture under normal light conditions, the leaves were removed from the plants and subjected to starch-iodine staining analysis.
Chlorophyll content analysis.
Leaves were collect from 25-day-old tobacco plants. Each transgenic line showed significant differences compared with wild-type, as determined by SPSS 11.5 analysis (Student's t-test, p = 0.05); values are expressed as means (n = 3 leaves for each test); error bars indicate S.D. ** p<0.01 for t test; * p<0.05 for t test. WT, wild-type; MADS1-3, 35S::BpMADS lines MADS1-3; Car, carotenoid; Chla, chlorophyll a; Chlb, chlorophyll b.
TEM observation of chloroplasts.
For TEM observation of chloroplasts, second true leaves were collect from 14-day-old tobacco plants. (A) wild-type; (B) 35S::BpMADS line MADS-1. UE, upper-epidermis; PM, palisade mesophyll; SM, spongy mesophyll; LE, lower-epidermis. Arrows indicate chloroplasts.
Photosynthetic rate analysis.
Leaf photosynthesis was measured with a LI-6400 portable photosynthesis system. Data comparison between transgenic and wild-type was performed using SPSS 11.5 (Student's t-test, p = 0.05); values are expressed as means (n = 3 plant for each test); error bars indicate S.D. ** p<0.01 for t-test; * p<0.05 for t-test. WT, wild-type; MADS-1–3, 35S::BpMADS lines MADS-1–3.
Starch-iodine staining of leaves.
After 3 h of culture under normal light conditions, the leaves were removed from the plants and subjected to starch-iodine staining analysis.Some floral stimuli, such as FT protein, act as long-distance signals that induce plant flowering. To examine whether BpMADS or a downstream factor can stimulate flowering, a grafting experiment was performed using 35S::BpMADS transgenic and wild-type tobacco plants. In this experiment, the genotype of the stock did not significantly affect flowering in the scion shoot (Figure 11). When transgenic stock was grafted to a wild-type scion shoot, the wild-type shoot flowered only when it reached the height at which conventionally grown wild-type shoots flower. However, the growth of the stock was synchronized to that of the scion shoot. Normally, the stem diameter of flowering plants is greater than 8 mm in the wild-type and less than 5 mm in the 35S::BpMADS plant. However, the 35S::BpMADS stock stem was greater than 7 mm in diameter due to the effects of the wild-type scion. On the contrary, the 35S::BpMADS scion inhibited stem growth in the wild-type stock; the stem of the wild-type stock was less than 4 mm in diameter. An examination of transverse sections of tobacco revealed that 35S::BpMADS tobacco stems had fewer secondary xylem cells than control stems (data not shown). Because the proliferation of secondary xylem cells results from long-range cell division in the vascular cambium, the enhanced flowering induced by the overexpression of BpMADS may have inhibited cell division in the vascular cambium, thereby retarding secondary xylem differentiation in tobacco. No BpMADS mRNA was detected in wild-type stock or wild-type scion by RT-PCR after 40 cycles of amplification (data not shown), suggesting that BpMADS mRNA could not move through the graft joint to the wild-type region of the grafted plant.
Figure 11
Grafting experiment.
(A) The wild-type (left) and 35S::BpMADS stock+wild-type scion (right) plants were in the flowering stage. (B, C) 90-day-old plants (B) and a close-up view near the base of each stem (C). 1, 35S::BpMADS; 2, wild-type stock +35S::BpMADS scion; 3, wild-type; 4, 35S::BpMADS stock+wild-type scion.
Grafting experiment.
(A) The wild-type (left) and 35S::BpMADS stock+wild-type scion (right) plants were in the flowering stage. (B, C) 90-day-old plants (B) and a close-up view near the base of each stem (C). 1, 35S::BpMADS; 2, wild-type stock +35S::BpMADS scion; 3, wild-type; 4, 35S::BpMADS stock+wild-type scion.
Expression Levels of Flowering-related Genes
Q-PCR was performed to estimate the transcript levels of flowering-related genes using the total RNA from aerial parts of 20-day-old transgenic and wild-type tobacco plants. Several reported flowering-related genes, such as NsMADS3 (GenBank Accession No. AF068722), NtMADS4 (No. AF068723), NtMADS5 (No.AF068724), NtMADS11 (No.AF385746), NFL2 (No. U16174), NtSOC1 (No. X76188), and NtFUL (No. DQ534202), were selected for analysis in transgenic 35S::BpMADS tobacco. As shown in Figure 12, the expression of all these genes was significantly upregulated in transgenic tobacco compared with the wild-type. Specially, the expression of NsMADS3, NtMADS4, NtMADS5, and NtMADS11 increased more than 5-fold in transgenic tobacco compared with the wild-type. Because all of these flowering-related genes were significantly up-regulated in the transgenic lines, and transgenic stock overexpressing BpMADS did not improve the floral transition in the wild-type scion, it appears that the above flowering-related genes cannot activate transportable floral stimuli to affect the wild-type scion.
Figure 12
Relative expression levels of flowering-related genes.
35S::BpMADS plants showed significant differences in the relative expression levels of flowering-related genes compared with the wild-type, as determined by SPSS 11.5 analysis using Student's t-test (p<0.01). Values are expressed as means (n = 3); error bars denote S.D. M3, NsMADS3; M4, NtMADS4; M5, NtMADS5; M11, NtMADS11; NFL2, NFL2; FUL, NtFUL; SOC1, NtSOC1 were induced in transgenic plants.
Relative expression levels of flowering-related genes.
35S::BpMADS plants showed significant differences in the relative expression levels of flowering-related genes compared with the wild-type, as determined by SPSS 11.5 analysis using Student's t-test (p<0.01). Values are expressed as means (n = 3); error bars denote S.D. M3, NsMADS3; M4, NtMADS4; M5, NtMADS5; M11, NtMADS11; NFL2, NFL2; FUL, NtFUL; SOC1, NtSOC1 were induced in transgenic plants.
Discussion
In plants, various signaling pathways regulate the expression of a relatively small number of common targets, which have been referred to as central floral pathway integrators or ‘‘integrator genes’ [1]. Different integrators directly or indirectly activate AP1, which marks the beginning of floral organ formation. In this study, we identified a MADS-box gene from birch, BpMADS, which is an ortholog of AP1 in Arabidopsis. BpMADS exhibited some differences in expression compared with AP1 of Arabidopsis. For example, C-terminal AP1-GFP appeared to be exclusively nuclear, while C-terminal BpMADS-GFP produced both cytoplasmic and nuclear signals. The results also indicate that the overexpression of BpMADS significantly promotes the flowering of transgenic tobacco seedlings. These results are consistent with those of Elo et al. [17].When transgenic leaf disks were cultured on differentiation medium under normal light conditions, normally indeterminate shoot apices developed into terminal rudimentary flowers (Figure 5). Also, some flower buds formed directly from transgenic leaf disk on differentiation medium under normal tissue culture conditions, with an absence of the vegetative phase. Because the leaf is a typical plant organ consisting of differentiated cells, our results suggest that some well-differentiated cells of plant organs can directly redifferentiate into floral meristems. A similar phenotype is also found in embryonic flower (emf) mutants, which are characterized by the absence of rosette growth and floral structures that develop directly from embryos or calli [21], [22]. Our results also suggest that the acceleration of the floral transition caused by the overexpression of BpMADS in tobacco absolutely requires the presence of light. Besides the overexpression of BpMADS caused earlier flowering in tobacco, other pleiotropic effects of the overexpression of BpMADS were also examined. The transgenic tobacco exhibited accelerated development of lignin, and a higher ratio of leaf length/width. These characteristics are indicators of the transition from the vegetative to the reproductive phase that are commonly seen in the wild-type (Nicotiana tabacum cv. ‘Havana SRI’). Perhaps the transgenic tobacco exhibited early signs of flowering.One of the most striking features of 35S::BpMADS tobacco plants is the enhanced chloroplast development in the leaves. We also found that 35S::BpMADS birch contains more chlorophyll than wild-type birch (data unpublished). The chloroplast is crucial for the process of photosynthesis, which captures light energy and stores it as chemical energy in the form of carbohydrate molecules. The development of normal chloroplasts is a crucial step in plant growth and development. For example, mutations in the chloroplast-localized Thf1 and AtTerC genes, both of which are required for the structure of the thylakoid, can inhibit the development of Arabidopsis plants [23], [24]. Because higher chlorophyll levels were detected in 35S::BpMADS tobacco than in the wild-type, it is not surprising that 35S::BpMADS tobacco plants exhibited much higher photosynthetic rates than wild-type, which was also confirmed by histochemical staining for starch.The 35S::BpMADS tobacco plants have developed several strategies to increase their photosynthetic rates compared with wild-type plants, including the following: (i) higher chlorophyll content; (ii) larger palisade cells; and (iii) enhanced guard cell development. These strategies help the plant capture light energy and improve gas exchange to make photosynthesis easier, thus producing more chemical energy for the plant. In flowering35S::BpMADS plants, the flower and fruits comprised more than one fifth of the total fresh weight of the plant. However, the transgenic fruit matured normally, probably due to the high efficiency of photosynthesis, which provided adequate levels of carbohydrate for fruit development. Because BpMADS is expressed at extremely low levels in the young leaves of birch, which contain chloroplasts that undergo division, we propose that BpMADS is not required for chloroplast division in birch. This notion is also supported by the fact that no significant difference in chloroplast content was found between the ap1-10 mutant (seed stock No. CS6230 in TAIR) and wild-type Arabidopsis. However, perhaps the high chloroplast content in 35S::BpMADS tobacco is a byproduct of the overexpression of BpMADS. To date, no other report has addressed the relationship between chloroplasts and AP1.The FT protein is transported to the apical meristem [25]–[27], where it interacts with other factors, finally leading to the activation of floral meristem identity genes and the formation of flowers. To address whether BpMADS or other flowering-related factors that interact with BpMADS can move through the plant or activate transportable floral stimuli, a grafting experiment was performed. In the present study, no transportable BpMADS mRNA was detected in wild-type scion or stock, and the transgenic stock did not significantly enhance the flower transition of wild-type scion. In addition, wild-type stock did not attenuate the accelerated flowering induced by the overexpression of BpMADS in transgenic scion. These results suggest that flowering time in the scion is not affected by the presence or absence of 35S::BpMADS in the stock. AP1 in Arabidopsis, and its orthologs in other plant species, are meristem-identity genes, which act to control the initiation of flowering. The present results also confirm that the overexpression of BpMADS in leaves cannot accelerate the floral transition of the meristem. Perhaps the overexpression of BpMADS in the SAM promotes the floral meristem conversion in 35S::BpMADS tobacco seedlings. Moreover, BpMADS overexpression induced direct flower formation from transgenic tobacco leaves in vitro.Several studies have shown that the ectopic expression of some MADS-box genes induces early flowering and enhances the expression of endogenous flowering-related genes in tobacco [28], [29]. In the present study, the expression of endogenous NsMADS3, NtMADS4, NtMADS5, NtMADS11, NFL2, NtSOC1, and NtFUL were induced in transgenic plants. Previous reports have also shown that ectopic expression of NtSOC1, NtFUL, NsMADS3, NtMADS4, or NsMADS2 (ortholog of NtMADS5) accelerates the transition to flowering in tobacco, and ectopic expression of NtMADS11 rescues the floral organ defect in the ap1-1 mutant of Arabidopsis
[28], [30], [31]. All of the flowering-related genes examined in the current study exhibit increased expression in floral organs and play important roles in the floral transition in tobacco. Perhaps the increased expression of these genes in transgenic tobacco resulted from the earlier floral transition that resulted from BpMADS overexpression. However, the floral transition occurs via strict cooperation between many floral factors. Each flowering-related gene exhibits a different expression profile. For example, AP1 is only localized to sepals and petals in Arabidopsis, whereas ectopic expression of AP1 in Arabidopsis induces early flowering with normal flowers, suggesting that some flowering-related genes function together to convert shoots into flowers.
Authors: Eliezer Lifschitz; Tamar Eviatar; Alexander Rozman; Akiva Shalit; Alexander Goldshmidt; Ziva Amsellem; John Paul Alvarez; Yuval Eshed Journal: Proc Natl Acad Sci U S A Date: 2006-04-10 Impact factor: 11.205
Authors: Qin Wang; Rusty W Sullivan; Alicia Kight; Ralph L Henry; Jirong Huang; Alan M Jones; Kenneth L Korth Journal: Plant Physiol Date: 2004-10-29 Impact factor: 8.340
Authors: Xuelin Wu; José R Dinneny; Katrina M Crawford; Yoon Rhee; Vitaly Citovsky; Patricia C Zambryski; Detlef Weigel Journal: Development Date: 2003-08 Impact factor: 6.868