Literature DB >> 23687957

Clinical implication of the BRAFV600E mutation in papillary thyroid carcinoma.

Yong-Seok Kim1, Jeong-Soo Kim, Ja-Seong Bae, Woo-Chan Park.   

Abstract

BACKGROUND: The BRAFV600E mutation is the most common genetic alteration in papillary thyroid carcinoma (PTC). In recent studies, the BRAFV600E mutation has been associated with poor clinicopathological characteristics, such as lymph node metastasis, extrathyroidal extension, and advanced stage. However, other studies have failed to establish an association between the BRAFV600E mutation and clinicopathological features. Therefore, we investigated the relationship between the BRAFV600E mutation and its clinicopathological factors at a single institution.
METHODS: A total of 327 consecutive patients with PTC were enrolled in this study and underwent thyroid surgery at Yeouido St. Mary's Hospital between February 2010 and December 2011.BRAFV600E mutation analysis was performed using polymerase chain reaction (PCR)-based amplification of DNA extracted from paraffin-embedded tumour specimens.
RESULTS: The BRAFV600E mutation was detected in the tumours of 241 (73.7%) patients. Lymph node metastasis, TNM stage, and multifocality were not significantly associated with the BRAFV600E mutation. However, larger tumour size, extrathyroidal extension, histologic type (classic type), and concurrent Hashimoto's thyroiditis were associated with the BRAFV600E mutation in the univariate analysis, although no clinicopathological features were associated with the BRAFV600E mutation in the multivariate analysis.
CONCLUSION: There was no idependent prognostic factor associated with BRAFV600E mutation status in this study. The BRAFV600E mutation is unlikely to serve as a prognostic factor for PTC.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23687957      PMCID: PMC3660263          DOI: 10.1186/1477-7819-11-99

Source DB:  PubMed          Journal:  World J Surg Oncol        ISSN: 1477-7819            Impact factor:   2.754


Background

Papillary thyroid carcinoma (PTC) is the most common endocrine malignancy, accounting for 85% to 90% of all thyroid malignancies [1,2]. PTC is generally treated successfully with surgery, radioiodine ablation, and levothyroxine suppression therapy. This malignancy typically has a favourable prognosis, with an average 10-year survival rate of over 90%, although up to 35% of patients suffer from disease recurrence during long-term follow up [3]. Several genetic events have been associated with PTC, and the BRAF mutation is the most common genetic alteration detected in patients with PTC [4]. The RAF protein has three isoforms, with BRAF being the most common isoform found in thyroid follicular cells and the strongest activator of mitogen-activated protein kinase signalling [5]. The most common BRAF mutation in thyroid cancer, occurring in more than 95% of cases, is the T1799A transversion mutation in exon 15. The thymidine to adenine transversion at position 1,799 results in a valine to glutamic acid substitution at residue 600 (V600E) [4,6] and occurs at a prevalence ranging from 29% to 83% [7,8]. The BRAFV600E mutation in PTC has been investigated at many institutions, but the relationship between the BRAFV600E mutation and the clinicopathological features of PTC remain controversial. Several studies have reported that the BRAFV600E mutation is associated with a poor prognosis when combined with the aggressive clinicopathological features of PTC [8,9], whereas other studies have failed to demonstrate a statistically significant association between the BRAFV600E mutation and aggressive clinicopathological features [7,10]. Therefore, the purpose of this study was to evaluate the prevalence of the BRAFV600E mutation in PTC and to analyse the association between the BRAFV600E mutation and the clinicopathological features of PTC at a single institution.

Methods

Patients

A total of 327 consecutive patients with PTC were enrolled in this study and underwent thyroid surgery at Yeouido St Mary’s Hospital of the Catholic University in Seoul, Korea, between February 2010 and December 2011. We routinely performed central lymph node dissections in all patients and selectively performed lateral neck lymph node dissections if the preoperative imaging studies (ultrasound and computed tomography) raised suspicions of malignancy and if the fine needle aspiration cytology (FNAC) were found to contain atypical cells or metastatic papillary carcinomas. The patients diagnosed with a recurrence of PTC and those who refused to be enrolled were excluded. Written informed consent was obtained from all patients in advance. This study was reviewed and approved by the institutional review board at Yeouido St Mary’s Hospital (SC13TISI0007).

DNA extraction

DNA was extracted from five paraffin sections with a thickness of 10 μm that contained a representative portion of the tumour tissue obtained after thyroidectomy. DNA extraction from formalin-fixed paraffin-embedded (FFPE) tissue was conducted using the QIAamp DNA FFPE Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol.

Amplification of BRAFV600E gene

Fifty nanograms of DNA was amplified in a 20-μl reaction solution containing 10 μl of 2× concentrated HotStarTaq Master Mix (Qiagen), including PCR buffer with 3 mM MgCl2, 400 μM of each dNTP, and 0.3 μM of each primer pair (exon 15, forward: 5′- ATGCTTGCTCTGATAGGAAAATGA; reverse: 5′- AGCAGCATCTCAGGGCCA). The amplifications were performed under the following conditions: a 15-minute initial denaturation at 95°C; 35 cycles of 30 s at 94°C, 30 s at 58°C, and 45 s at 72°C; and a 10-minute final extension at 72°C. The PCR products were then 2% gel-purified using a QIAgen gel extraction kit (Qiagen).

Direct sequencing

The DNA templates were processed for the DNA sequencing reaction using the ABI-PRISM BigDye Terminator version 3.1 (Applied Biosystems, Foster, CA, USA) with both forward and reverse sequence-specific primers. Twenty nanograms of purified PCR products were used in a 10-μl sequencing reaction solution containing 1 μl of BigDye Terminator v3.1 and 0.1 μM of the same PCR primer. Sequencing reactions were performed using 25 cycles of 10 s at 96°C, 5 s at 50°C, and 4 minutes at 60°C. The sequence data were generated with the ABI PRISM 3730 DNA Analyzer (Applied Biosystems). The sequences were analysed and compared using Sequencing Analysis 5.1.1. software (Applied Biosystems).

Statistical analysis

Data analyses were performed with SPSS version 18.0 (SPSS Inc., Chicago, IL, USA). The chi-square test and Fisher’s exact test were used for categorical variables, and Student’s t-test for independent samples was used for continuous variables. Continuous variables were presented as the mean ± standard deviation. A multivariate analysis was performed using logistic regression analysis. Differences were considered statistically significant when P was <0.05.

Results

The clinicopathological characteristics of the 327 patients, 268 female (82%) and 59 male (18%), with a mean age of 47.79 ± 11.03 years at the time of surgery, are summarised in Table 1.
Table 1

Clinicopathological characteristics of the study population (n = 327)

CharacteristicsValue
Age, years,
 
mean ± SD
47.79 ± 11.03
range
 
≥45
210 (64.2%)
<45
117 (35.8%)
Sex,
 
male
59 (18%)
female
268 (82%)
Tumour size, cm,
 
mean ± SD
1.04 ± 0.73
≤1 cm
213 (65.1%)
>1 cm
114 (34.9%)
Extrathyroidal extension
192 (58.7%)
BRAFV600E mutation
241 (73.7%)
Lymph node metastasis
147 (45%)
Central node metastasis
145 (44.3%)
Lateral node metastasis
28 (8.6%)
TNM stage
 
I
137 (41.9%)
II
40 (12.2%)
III
121 (37.0%)
IVA
18 (8.9%)
Extent of surgery
 
Total thyroidectomy
270 (82.6%)
Hemithyroidectomy
55 (16.8%)
Completion thyroidectomy
2 (0.6%)
Hashimoto thyroiditis56 (17.1%)

Results are presented as mean ± SD, or number of patients (%). TNM, classification by tumour, nodes and metastases.

Clinicopathological characteristics of the study population (n = 327) Results are presented as mean ± SD, or number of patients (%). TNM, classification by tumour, nodes and metastases. The mean tumour size was 1.04 ± 0.73 cm. Extrathyroidal extensions and lymph node metastases were present in 192 patients (58.7%) and 147 patients (45%), respectively. Total thyroidectomy was performed in 270 patients (82.6%). Other thyroidectomies, including hemithyroidectomies and completion thyroidectomies, were performed in 57 (17.4%) patients. Of the 327 patients with PTC, 56 (17.1%) demonstrated pathological features of Hashimoto’s thyroiditis. In total, 137 patients (41.9%) had stage I disease, 40 (12.2%) had stage II disease, 121 (37.0%) had stage III disease, and 18 (8.9%) had stage IVA disease. The BRAFV600E mutation was detected in the tumours of 241 patients (73.7%). Table 2 shows the association between BRAFV600E mutation status and the clinicopathological characteristics of the patients. Lymph node metastasis, TNM stage, and multifocality were not significantly associated with the BRAFV600E mutation. However, larger tumour size, extrathyroidal extensions, and histologic type (classic type) concurrent with Hashimoto’s thyroiditis were associated with the BRAFV600E mutation.
Table 2

Univariate analysis of the association between clinicopathological characteristics and the BRAFmutation

Variables
BRAFV600E mutation
P-value
 Positive (n = 241)Negative (n = 86) 
Age, years,
 
 
 
mean ± SD
47.63 ± 11.26
48.23 ± 10.41
0.665
≥45
85 (35.3%)
32 (37.2%)
0.747
<45
156 (64.7%)
54 (62.8%)
 
Sex,
 
 
 
male
39 (16.2%)
20 (23.3%)
0.143
female
202 (83.8%)
66 (76.7%)
 
Tumour size, cm,
 
 
 
mean ± SD,
1.09 ± 0.72
0.89 ± 0.75
0.040
≤1 cm
147 (61%)
66 (76.7%)
0.009
>1 cm
94 (39%)
20 (23.3%)
 
Extrathyroidal extension,
 
 
 
yes
152 (63.1%)
40 (46.5%)
0.007
no
89 (36.9%)
46 (53.5%)
 
Lymph node metastasis,
 
 
 
yes
110 (47.6%)
37 (43.5%)
0.518
no
121 (52.4%)
48 (56.5%)
 
Central node metastasis,
 
 
 
yes
110 (47.6%)
35 (41.2%)
0.308
no
121 (52.4%)
50 (58.8%)
 
Lateral node metastasis,
 
 
 
yes
19 (8.2%)
9 (10.6%)
0.512
no
212 (91.8%)
76 (89.4%)
 
TNM stage,
 
 
 
I
96 (41.6%)
41 (48.2%)
0.138
II
33 (14.3%)
7 (8.2%)
 
III
91 (37.7%)
30 (34.8%)
 
IVA
11 (6.4%)
7 (8.8%)
 
Multifocality,
 
 
 
yes
59 (24.5%)
23 (26.7%)
0.678
no
182 (75.5%)
63 (73.3%)
 
Histology,
 
 
 
classic type
233 (96.7%)
78 (90.7%)
0.027
follicular variant
8 (3.3%)
8 (3.3%)
 
Concurrent Hashimoto’s thyroiditis,
 
 
 
yes
35 (14.5%)
21 (24.4%)
0.037
no206 (85.5%)65 (75.6%) 

Results are presented as mean ± SD, or number of patients (%). TNM, classification by tumor, nodes and metastases.

Univariate analysis of the association between clinicopathological characteristics and the BRAFmutation Results are presented as mean ± SD, or number of patients (%). TNM, classification by tumor, nodes and metastases. The results of the multivariate analysis are shown in Table 3. The BRAFV600E mutation was not significantly associated with tumour size, extrathyroidal extension, or the histologic type concurrent with Hashimoto’s thyroiditis.
Table 3

Multivariate analysis of the association between clinicopathological characteristics and the BRAFmutation

Variables
Odds ratio
95% CI
P-value
  LowerUpper 
Tumour size (>1 cm)
2.050
0.887
4.736
0.093
Extrathyroidal extension (+)
1.508
0.874
2.602
0.140
Histology (classic type)
2.697
0.926
7.855
0.069
Hashimoto’s thyroiditis0.5840.3121.0950.093
Multivariate analysis of the association between clinicopathological characteristics and the BRAFmutation Of the 327 patients with PTC, 247 (75.5%) received postoperative radioiodine-131 treatment. There was no I-131 avidity in the foci of lateral lymph node metastases.

Discussion

In 2003, Kimura et al. initially reported the BRAFV600E mutation in thyroid carcinomas. Since this discovery, additional research has been conducted to understand the tumorigenic role and clinical importance of this mutation [11-13]. The BRAFV600E mutation has been reported in PTC with a frequency ranging from 29% to 83% in various studies [14], and recent studies have reported differences in the incidence of the BRAFV600E mutation according to region; for example, the incidence of the BRAFV600E mutation was shown to be higher in Korea (range 52% to 87%) in comparison to other countries (range 36% to 65%) [7,8]. The reason for this variation in frequency remains unclear but may be due to geographic factors. For example, some studies have reported higher rates of the BRAFV600E mutation in high iodine intake areas, which may indicate the significance of iodine as a risk factor for the BRAFV600E mutation in PTC [8,15]. Iodine intake is very high in Korea as compared to Western countries, which may explain the high prevalence of the BRAFV600E mutation among Koreans with PTC. The prevalence of the BRAFV600E mutation in PTC patients in our study was 73.7% (241/327), and further studies will be needed to clarify differences in the prevalence of the BRAFV600E mutation between geographic regions. Many studies have reported the relationship between the BRAFV600E mutation and the clinicopathological characteristics of PTC. However, recent clinical studies have reported controversial results regarding whether the BRAFV600E mutation serves as a prognostic or predictive marker of PTC. Xing et al. [16] first reported that the BRAFV600E mutation was associated with a poorer clinicopathological outcome and independently predicted recurrence. These authors therefore concluded that the BRAFV600E mutation may be a useful marker for risk stratification in PTC. Many studies have found that extrathyroidal extensions, lymph node metastases, and advanced stage are the three most common risk factors consistently associated with the BRAFV600E mutation [17-19]. In addition, several studies have reported significant associations between the BRAFV600E mutation and clinicopathological characteristics, such as older age, male sex, tumour size, and an aggressive subtype [17-21]. Although all of the above-mentioned studies were conducted in Western countries, some results from studies conducted in Eastern countries have not been consistent, especially those performed in the Korean population. Ito et al. [22] investigated the BRAFV600E mutation in 631 patients with PTC and found that the BRAFV600E mutation was not significantly associated with high-risk biological features, such as lymph node metastasis, extrathyroidal extension, advanced age, distant metastasis at surgery, and advanced stage. Furthermore, the disease-free survival of patients with the BRAFV600E mutation did not differ from that of patients without the BRAFV600E mutation. In addition, other study groups have reported that age distribution, tumour size, extrathyroid extension, multifocality, and staging do not differ significantly between patients with and without the BRAFV600E mutation [7]. Our study found that large tumour size (odds ratio (OR) 2.131, 95% CI 1.266, 3.588) and extrathyroidal extensions (OR 1.964, 95% CI 1.194, 3.232) were associated with the BRAFV600E mutation in a univariate analysis, although no clinicopathological features were associated with the BRAFV600E mutation in a multivariate analysis. Therefore, our results indicate that there may be differences between PTC subjects in Eastern and Western countries. The prevalence of the BRAFV600E mutation in PTC is distinctly different between subtypes. For example, this mutation is specific to the classic and tall-cell variants of PTC and is rarely found in other types of differentiated thyroid cancer, including follicular variant PTC [13]. We also observed a significant prevalence of the BRAFV600E mutation among patients with classic type PTC311 (95.1%), whereas only 16 patients (4.9%) with the follicular variant PTC harboured the BRAFV600E mutation. In this study, we found that the BRAFV600E mutation was associated with a lower frequency of concurrent Hashimoto’s thyroiditis in a univariate analysis (P <0.05). The BRAFV600E mutation was present in 21 (24.4%) of 86 patients with PTC without Hashimoto’s thyroiditis and in 35 (14.5%) of 241 patients with both PTC and Hashimoto’s thyroiditis. In a previous Korean study [23], the BRAFV600E mutation was detected at a higher frequency among patients with PTC but without Hashimoto’s thyroiditis (90%) as compared to those with PTC and Hashimoto’s thyroiditis (64%). Together, these results suggest that the BRAFV600E mutation is associated with the tumourigenesis of most classic type PTCs and that the somatic BRAFV600E mutation likely acts on a component of Hashimoto’s thyroiditis following PTC as cells age. However, the current study had some inherent limitation. First, the rate of mirocarcinoma was higher (65.1%) in this study, and this condition is known to be associated with low aggressiveness and a more favourable prognosis in most cases. Second, we were not able to examine disease recurrence and describe the long-term follow up results, and the time period of the present study was too short to identify the prognostic value of the BRAFV600E mutation. Thus, a long-term follow up study is needed to identify the association between the prognosis of PTC and the BRAFV600E mutation.

Conclusions

The prevalence of the BRAFV600E mutation in this study was in accordance with that observed in previous studies. This prevalence was related to several clinicopathological factors, including extrathyroidal extension, large tumour size, classic histologic type, and a low frequency of concurrent Hashimoto’s thyroiditis. However, we failed to establish a correlation with regard to lymph node metastasis, advanced stage, sex, and age. Moreover, there were no independent factors associated with BRAFV600E mutation status. However, it will be necessary to perform a long-term follow up study to identify the clinical usefulness of the BRAFV600E mutation in PTC.

Abbreviations

FFPE: Formalin-fixed paraffin-embedded; FNAC: Fine needle aspiration cytology; PTC: Papillary thyroid carcinoma; OR: Odds ratio; PCR: Polymerase chain reaction; TNM: Tumour nodes, metastases.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

WCP participated in the conception and design of the study and carried out the surgery. YSK participated in the data analysis and interpretation and drafted the manuscript. JSK and JSB participated in the collection of the data. All authors read and approved the final manuscript.
  23 in total

1.  Association of high iodine intake with the T1799A BRAF mutation in papillary thyroid cancer.

Authors:  Haixia Guan; Meiju Ji; Rong Bao; Hongyu Yu; Yangang Wang; Peng Hou; Yong Zhang; Zhongyan Shan; Weiping Teng; Mingzhao Xing
Journal:  J Clin Endocrinol Metab       Date:  2009-02-03       Impact factor: 5.958

2.  Frequency of BRAF T1796A mutation in papillary thyroid carcinoma relates to age of patient at diagnosis and not to radiation exposure.

Authors:  Ned Powell; Steve Jeremiah; Mariko Morishita; Ed Dudley; Jackie Bethel; Tetyana Bogdanova; Mykola Tronko; Gerry Thomas
Journal:  J Pathol       Date:  2005-04       Impact factor: 7.996

3.  Global cancer statistics, 2002.

Authors:  D Max Parkin; Freddie Bray; J Ferlay; Paola Pisani
Journal:  CA Cancer J Clin       Date:  2005 Mar-Apr       Impact factor: 508.702

4.  Type and prevalence of BRAF mutations are closely associated with papillary thyroid carcinoma histotype and patients' age but not with tumour aggressiveness.

Authors:  Vítor Trovisco; Paula Soares; Ana Preto; Inês Vieira de Castro; Jorge Lima; Patrícia Castro; Valdemar Máximo; Tiago Botelho; Severina Moreira; Ana Margarida Meireles; João Magalhães; Alexander Abrosimov; José Cameselle-Teijeiro; Manuel Sobrinho-Simões
Journal:  Virchows Arch       Date:  2005-05-19       Impact factor: 4.064

5.  Mutations of the BRAF gene in papillary thyroid carcinoma in a Korean population.

Authors:  Kyung Hee Kim; Dong Wook Kang; Seong Ho Kim; In Ock Seong; Dae Young Kang
Journal:  Yonsei Med J       Date:  2004-10-31       Impact factor: 2.759

6.  BRAF mutations in an Italian cohort of thyroid cancers.

Authors:  Laura Fugazzola; Deborah Mannavola; Valentina Cirello; Guia Vannucchi; Marina Muzza; Leonardo Vicentini; Paolo Beck-Peccoz
Journal:  Clin Endocrinol (Oxf)       Date:  2004-08       Impact factor: 3.478

7.  A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985-1995 [see commetns].

Authors:  S A Hundahl; I D Fleming; A M Fremgen; H R Menck
Journal:  Cancer       Date:  1998-12-15       Impact factor: 6.860

8.  Oncogenic B-Raf mutations: crystal clear at last.

Authors:  Amardeep S Dhillon; Walter Kolch
Journal:  Cancer Cell       Date:  2004-04       Impact factor: 31.743

9.  Mutations of the BRAF gene in human cancer.

Authors:  Helen Davies; Graham R Bignell; Charles Cox; Philip Stephens; Sarah Edkins; Sheila Clegg; Jon Teague; Hayley Woffendin; Mathew J Garnett; William Bottomley; Neil Davis; Ed Dicks; Rebecca Ewing; Yvonne Floyd; Kristian Gray; Sarah Hall; Rachel Hawes; Jaime Hughes; Vivian Kosmidou; Andrew Menzies; Catherine Mould; Adrian Parker; Claire Stevens; Stephen Watt; Steven Hooper; Rebecca Wilson; Hiran Jayatilake; Barry A Gusterson; Colin Cooper; Janet Shipley; Darren Hargrave; Katherine Pritchard-Jones; Norman Maitland; Georgia Chenevix-Trench; Gregory J Riggins; Darell D Bigner; Giuseppe Palmieri; Antonio Cossu; Adrienne Flanagan; Andrew Nicholson; Judy W C Ho; Suet Y Leung; Siu T Yuen; Barbara L Weber; Hilliard F Seigler; Timothy L Darrow; Hugh Paterson; Richard Marais; Christopher J Marshall; Richard Wooster; Michael R Stratton; P Andrew Futreal
Journal:  Nature       Date:  2002-06-09       Impact factor: 49.962

10.  High prevalence of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines.

Authors:  Xiulong Xu; Roderick M Quiros; Paolo Gattuso; Kenneth B Ain; Richard A Prinz
Journal:  Cancer Res       Date:  2003-08-01       Impact factor: 12.701

View more
  11 in total

1.  Serum TSH levels are associated with postoperative recurrence and lymph node metastasis of papillary thyroid carcinoma.

Authors:  Yingying Xiang; Yiying Xu; Adheesh Bhandari; Namita Sindan; Suzita Hirachan; Qing Yang; Guilong Guo; Yanyan Shen
Journal:  Am J Transl Res       Date:  2021-06-15       Impact factor: 4.060

2.  Predictive Value of BRAFV600E Mutation for Lymph Node Metastasis in Papillary Thyroid Cancer: A Meta-analysis.

Authors:  Jing-Yong Song; Shi-Ran Sun; Fang Dong; Tao Huang; Bin Wu; Jing Zhou
Journal:  Curr Med Sci       Date:  2018-10-20

3.  The Clinicopathological Features of BRAF Mutated Papillary Thyroid Cancers in Chinese Patients.

Authors:  Li-Bo Yang; Lin-Yong Sun; Yong Jiang; Ying Tang; Zhi-Hui Li; Hong-Ying Zhang; Hong Bu; Feng Ye
Journal:  Int J Endocrinol       Date:  2015-07-27       Impact factor: 3.257

4.  Langerhans cell histiocytosis of the thyroid with multiple cervical lymph node involvement accompanying metastatic thyroid papillary carcinoma.

Authors:  A Bahar Ceyran; Serkan Senol; Barış Bayraktar; Seyma Ozkanlı; Z Leyla Cinel; Abdullah Aydın
Journal:  Case Rep Pathol       Date:  2014-10-02

5.  First-Line Use of Vemurafenib to Enable Thyroidectomy and Radioactive Iodine Ablation for BRAF-Positive Metastatic Papillary Thyroid Carcinoma: A Case Report.

Authors:  Bao D Dao; Ildiko Lingvay; Joseph Sailors; Michael Landay; Gabriel Shapiro
Journal:  J Investig Med High Impact Case Rep       Date:  2015-09-03

6.  Unfavorable efficacy to 131I ablation in BRAFV600E mutant papillary thyroid carcinoma with positive TgAb.

Authors:  Na Zhang; Jun Liang; Yan-Song Lin
Journal:  Oncotarget       Date:  2017-10-26

7.  A meta-analysis evaluating the relationship between B-type Raf kinase mutation and cervical lymphatic metastasis in papillary thyroid cancer.

Authors:  Hongzhi Ma; Ru Wang; Jugao Fang; Qi Zhong; Xiao Chen; Lizhen Hou; Ling Feng; Xiaohong Chen; Zhigang Huang; Huanhu Zhao
Journal:  Medicine (Baltimore)       Date:  2020-01       Impact factor: 1.889

8.  Mutation of Hashimoto's Thyroiditis and Papillary Thyroid Carcinoma Related Genes and the Screening of Candidate Genes.

Authors:  Lizhuo Zhang; Lingyan Zhou; Qingqing Feng; Qinglin Li; Minghua Ge
Journal:  Front Oncol       Date:  2021-12-21       Impact factor: 6.244

9.  Construction and validation of BRAF mutation diagnostic model based on ultrasound examination and clinical features of patients with thyroid nodules.

Authors:  Chan Xu; Jianqiang Fang; Wanying Li; Chenyu Sun; Yaru Li; Scott Lowe; Rachel Bentley; Shuya Chen; Cunyu He; Xinxin Li; Bing Wang; Chengliang Yin; Wenxian Li; Wenle Li
Journal:  Front Genet       Date:  2022-09-08       Impact factor: 4.772

10.  No evidence of association between human cytomegalovirus infection and papillary thyroid cancer.

Authors:  Tung-Sun Huang; Jie-Jen Lee; Shih-Ping Cheng
Journal:  World J Surg Oncol       Date:  2014-02-21       Impact factor: 2.754

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.