Literature DB >> 23592920

A novel homozygous R764H mutation in crumbs homolog 1 causes autosomal recessive retinitis pigmentosa.

Leila Tiab1, Leila Largueche, Ibtissem Chouchane, Kaouthar Derouiche, Francis L Munier, Leila El Matri, Daniel F Schorderet.   

Abstract

PURPOSE: Retinitis pigmentosa (RP; MIM 268000) is a hereditary disease characterized by poor night vision and progressive loss of photoreceptors, eventually leading to blindness. This degenerative process primarily affects peripheral vision due to the loss of rods. Autosomal recessive RP (arRP) is clinically and genetically heterogeneous. It has been associated with mutations in different genes, including CRB1 (crumbs homolog 1). The aim of this study was to determine the causative gene in a Tunisian patient with arRP born to non-consanguineous parents.
METHODS: Four accessible family members were included. They underwent full ophthalmic examination with best-corrected Snellen visual acuity, fundus photography and fluorescein angiography. Haplotype analysis was used to evaluate homozygosity in the family to 20 arRP loci. All exons and intron-exon junctions of candidate genes not excluded by haplotype analysis were PCR amplified and directly sequenced.
RESULTS: The proband was a 43-year-old female patient. Best-corrected visual acuity was 20/63 (right eye) and 20/80 (left eye). Visual loss began during the third decade. Funduscopic examination and fluorescein angiography revealed typical advanced RP changes with bone spicule-like pigment deposits in the posterior pole and the midperiphery along with retinal atrophy, narrowing of the vessels, and waxy optic discs. Haplotype analysis revealed homozygosity with microsatellite markers D1S412 and D1S413 on chromosome 1q31.3. These markers flanked CRB1. Our results excluded linkage of all the other arRP loci/genes tested. Sequencing of the 12 coding exons and splice sites of CRB1 disclosed a homozygous missense mutation in exon 7 at nucleotide c. 2291G>A, resulting in an arginine to histidine substitution (p.R764H).
CONCLUSIONS: R764H is a novel mutation associated with CRB1-related arRP. Previously, an R764C mutation was reported. Extending the mutation spectrum of CRB1 with additional families is important for genotype-phenotype correlations and characterization of the scope of mutation.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23592920      PMCID: PMC3626296     

Source DB:  PubMed          Journal:  Mol Vis        ISSN: 1090-0535            Impact factor:   2.367


Introduction

The term pigmentary retinopathy covers a set of hereditary diseases. Some are present at birth while others appear much later, around 40 or 50 years of age and even later. The primary symptoms are often difficulties with night vision. The retina gradually develops pigment spots, thus the name of the disease. This degenerative process initially affects peripheral rather than central vision, due to the loss of rods. Retinitis pigmentosa (RP; OMIM 268000) has a prevalence of about 1:4,000 [1]. RP is clinically and genetically heterogeneous with autosomal dominant (30%–40% of cases), autosomal recessive (50%–60% of cases), and X-linked inheritance (5%–15% of cases) [1,2]. A total of at least 36 genes and loci have been found to cause autosomal recessive RP (arRP). In three of the 36 previously reported arRP loci (RP22, RP29, RP32) the causative gene has not been discovered. Identification of a new gene or mutation allows the confirmation of the diagnosis and a better understanding of the familial pathology and the functional aspects implicated in the disease. Identifying new genes or mutations is also important for accurate genetic counseling and identifying potentially treatable forms. Mutations in crumbs homolog 1 (CRB1) have been shown to result in retinitis pigmentosa and Leber congenital amaurosis (LCA), a severe form of retinal dystrophy, present at birth [3,4]. CRB1 is a vertebrate homolog of the Drosophila crumbs. This gene consists of 12 exons and encodes crumbs, a protein of 1376 amino acids involved in the polarity of epithelial cells [5]. CRB1 is present in all retinal epithelial cells, rod and cone epithelial cells, and Müller glial cells in the adult mouse retina [6]. In this study, we characterized a Tunisian family (Figure 1) with RP with an unknown, but probable, autosomal recessive mode of inheritance. To determine if the family was linked to one of the known arRP genes, two microsatellite markers were selected from the known genes and loci of arRP and used to genotype the members of this family. After linkage analysis, we excluded all arRP genes but the CRB1 locus. Mutation screening of the 12 exons and splice sites of CRB1 gene revealed a novel homozygous missense mutation.
Figure 1

Pedigree structure of the investigated family. Squares and circles represent men and women, respectively. The arrow points to the proband (II:1) affected with retinitis pigmentosa.

Pedigree structure of the investigated family. Squares and circles represent men and women, respectively. The arrow points to the proband (II:1) affected with retinitis pigmentosa.

Methods

To assess the molecular origins of RP/LCA in Tunisia, 156 patients belonging to 67 families were enrolled. Among this cohort, 87 (36 females and 51 males) were affected and 69 (43 females and 26 males) were healthy. As recruitment of patients was not based on appearance of symptoms, the age of affected and non -affected individuals varied from less than 2 years to over 70 years. Accessible members were clinically assessed and underwent complete ophthalmic examination, including best-corrected visual acuity (BCVA) with Snellen chart and illiterate E chart, slit-lamp biomicroscopy, and fundus photography. In the proband, fluorescein angiography was performed (fundus camera: FA IMAGEnet, Topcon Corporation, Tokyo, Japan). Blood samples were obtained from participating family members after informed consent was received in compliance with the Declaration of Helsinki for research involving human subjects. The study was approved by the Hedi Rais Institute of Ophthalmology.

DNA extraction

Total human genomic DNA was isolated with the DNA isolation Kit for Mammalian Blood (Nucleon Bacc2 genomic DNA Extraction, Amersham RPN 8502, GE Healthcare, Glattbrugg Switzerland).

Haplotype analysis

Linkage and haplotype analyses were used to test linkage of the family to 19 arRP loci, including CRB1, ABCA4, LRAT, USH2A, RP29, CERKL, CNGA1, CNGB1, EYS, FAM161A, SAG, MERTK, NR2E3, PDE6A, PDE6B, RGR, RHO, RLBP1, and TULP1. Microsatellite markers flanking these loci were selected from (Appendix 1), amplified with PCR, and genotyped using an ABI 3100XL Genetic Analyzer (Applied Biosystems, Foster City, CA; with the Gene Mapper 2.5 software program from Applied Biosystems). Haplotypes were constructed by hand and checked for homozygosity.

Mutation screening

Primer3 (v. 0.4.0) software was used to designed oligonucleotides primers from the DNA sequence of CRB1. These primers covered all the exons and splice junctions of CRB1, including the promoter (Table 1). Twelve exons and splice sites were analyzed in the proband after PCR amplification with the following conditions: initial denaturation for 5 min at 95 °C, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 60 °C for 1 min, extension at 72 °C for 1 min, and final extension at 72 °C for 10 min. Amplicons were directly sequenced on an ABI 3100XL DNA sequencer, using the Big Dye Terminator Labeling Kit version 1 (Life Technologies, Zug, Switzerland). The frequency of the mutation was checked in 96 ethnically matched controls and in 96 Caucasian controls.
Table 1

Primers for amplification of exons of CRB1

ExonsForward primer (5′ - 3′)Reverse primer (5′ - 3′)Annealing temp. (°C)
1
GTAGGGTGGGACAGAGATGG
AACTGACTGTTCACATTGACTGG
60
2
TTTTTCATTAGGATGAACCCAAC
CCATGTTGGCAGGAGTTCTT
60
3
CTCTGCCTTGTGCAACTTCC
TAAGCCGAGAACGTGAGAGC
60
4
CCATGGGTCTTGGGTTGATA
GCACCACAGCAGCAGAGTT
60
5
GATTCCCCTTACCAGCTCCT
GCACCACAGCAGCAGAGTT
60
6a
AACCTGAGCTATTCATGCACTTC
TGGTGTTGTGGGAAATGAAC
62
6b
GCAACAGGGATGTGTTTGTG
TTTCATAGCAGGCAGAAGCA
60
7a
TTCGTCTTCCATCCCTTCTG
GTCAGGTAGGCCACCAATGT
60
7b
GGAAATGTCCACTTGATATCTTTG
CTGGTGGGTCAGTAACATCATC
60
8
GCCCTTTTAGAAAGGAGTTGG
AGGCAAGAGGCCAGTCAGTA
60
9a
CATGTATCAAATAGTCAATATGCAATG
GTCTGGGACAGTGGGTCTGT
60
9b
ATTGCAAAGTGGCAACAGC
CAAGGGACAGGAGCAATGAT
60
9c
CAGTGGTCACTGGCTGTTTG
CAGTGTCACCCTGTTCAGCA
60
10
CCTCCAGCAGGAGCTTTTTA
GCATAGATTTTCCTATGGGAACTG
60
11
AGACTGTGCTGTTCCAGAGAGA
TTTTTCATTTGGGAATGTTCAA
60
12GCTTGCTCTGGTTGGTCTTCTTTTAAGGTGGTCAAAGGAATCA60

Results

Clinical findings

The proband (II:1) was born to unrelated parents, and their marriage was not consanguineous (Figure 1). The primary symptom of vision problems, reduced visual acuity, occurred at the age of 37 years, and she was 40 when she came for her first ophthalmic visit at the Institute. At that time, BCVA was 20/63 in the right eye and 20/80 in the left. The anterior segment was normal in both eyes. There was no cataract or refractive error. Funduscopic examination and fluorescein angiography revealed typical advanced retinal changes with bone spicule-like pigment deposits in the posterior pole and the midperiphery along with atrophy, narrowing of the vessels, and waxy optic discs (Figure 2). No additional symptoms or ocular defects such as strabismus or nystagmus were observed in the proband. Her husband and both children were clinically examined. No abnormalities were found in all three individuals. Visual acuities were 10/10, and fundus photography was normal except in the boy, who presented hypertrophy of the pigment epithelium in the temporal superior quadrant of the left eye.
Figure 2

Color fundus photographs of the proband at 43 years of age. Left (A) and right (B) eyes showing typical advanced retinitis pigmentosa changes with bone spicule-like pigment deposits in the posterior pole and midperiphery along with retinal atrophy, narrowing of the vessels, and waxy optic discs.

Color fundus photographs of the proband at 43 years of age. Left (A) and right (B) eyes showing typical advanced retinitis pigmentosa changes with bone spicule-like pigment deposits in the posterior pole and midperiphery along with retinal atrophy, narrowing of the vessels, and waxy optic discs.

Molecular analysis

Mutation analysis for autosomal recessive RP did not reveal any previously reported mutation. Following these results, we tested the most frequent arRP loci and genes by linkage in 14 families compatible with LCA out of a cohort of 67 families. Haplotype analysis revealed homozygosity in five families with microsatellite markers D1S412 and D1S413 on chromosome 1, two markers flanking CRB1. Our analysis excluded linkage of the other arRP loci/genes. Sequencing all the exons and intron-adjacent regions of CRB1 in the probands of these families did not identify any mutation, except the one family reported here. In that family, sequencing CRB1 disclosed a missense homozygous mutation in exon 7 at nucleotide c. 2291G>A, resulting in the substitution of histidine (His) for arginine (Arg) at position 764 (p.Arg764His; Figure 3). Examination of the pathogenicity of the Arg764His mutation with PolyPhen generated a score of 0.975 (probably damaging), close to the maximum value of 1.00, while Sorting Intolerant From Tolerant (SIFT) predicted a tolerated change with a score of 0.15. This mutation was not observed in 96 ethnically matched controls or in 96 Caucasian individuals. Alignment of CRB1 showed that R764 was conserved among various species, from apes to Caenorhabditis elegans. However, in several mammals, including the dog, rat, and mouse, R764 was not conserved. In these three species, the basic amino acid was changed to a hydrophobic (cysteine) or polar (serine) amino acid (Figure 4).
Figure 3

Partial electropherogram of exon 7 of CRB1. A: Electropherogram of the proband showing a c. 2291 homozygous G to A transition mutation in exon 7 of the crumbs homolog 1 gene leading to a p.Arg764His amino acid change. B: Normal sequence. Arrows indicate the position of the mutated nucleotide.

Figure 4

Alignment of various CRB1 orthologs. Human R764 is in bold. Conserved amino acid are replaced by a dot.

Partial electropherogram of exon 7 of CRB1. A: Electropherogram of the proband showing a c. 2291 homozygous G to A transition mutation in exon 7 of the crumbs homolog 1 gene leading to a p.Arg764His amino acid change. B: Normal sequence. Arrows indicate the position of the mutated nucleotide. Alignment of various CRB1 orthologs. Human R764 is in bold. Conserved amino acid are replaced by a dot.

Discussion

Mutations in CRB1 have been reported in patients with LCA [7,8], in two forms of retinitis pigmentosa, with or without preservation of the para-arteriolar retinal pigment epithelium [9] and in RP with Coats-like exudative vasculopathy [10,11]. CRB1 is expressed in the human retina, brain, and fetal brain, and CRB1 is an extracellular protein with a signal peptide, 19 epidermal growth factor–like domains and three laminin A G-like domains and C-type lectin (CTL) domain [12] (Figure 5). These domains interact with other extracellular or transmembrane proteins [13]. CRB1 regulates the polarity of epithelial cells by participating in assembling the zonula adherens region. In Drosophila, defects in crb cause an abnormal shape of the photoreceptors, and in the mouse, a frameshift mutation at nucleotide 3481 causes the rd18 phenotype. To date, more than 70 missense/nonsense mutations have been identified in CRB1 in patients with retinal dystrophies, and 19 variants have been reported associated with RP12 (HGMD) [14]. All these mutations map on the extracellular domain precisely on the epidermal growth factor– and laminin A G-like domains [3]. These domains are conserved from flies to mammals [13]. The Arg764His mutation is localized on the second laminin A G-like domain (Figure 5). This domain is an 180-amino-acid-long domain found in a large and diverse set of extracellular proteins [15,16]. Laminin AG-containing proteins appear to have a wide variety of roles in cell adhesion, signaling, migration, assembly, and differentiation [17]. The CRB1 protein is located at the level of the photoreceptor inner segment more precisely at the adherens junctions that connect rod and cones photoreceptor cells with each other and with Müller glial cells [18]. As CRB1 is inserted through the cell membrane, this protein probably serves important functions inside and outside the photoreceptor cell. The 37-amino-acid cytoplasmic segment is known to act as an anchor for several proteins, such as MPP5 or PALS1 [19].
Figure 5

Schematic representation of the crumbs homolog 1 gene with retinitis pigmentosa–causing mutations. The reported mutation is in bold.

Schematic representation of the crumbs homolog 1 gene with retinitis pigmentosa–causing mutations. The reported mutation is in bold. p.Arg764His is a novel CRB1 mutation and represents the first homozygous mutation described in a patient originating from North Africa associated with arRP. This mutation also represents the second missense mutation at residue R764 [3,20]. The p.Arg764His mutation is most likely pathogenic as mutations in codon 764 generating cysteine mutants have already been reported. In addition, the p.Arg764His mutation was not found in 96 ethnically matched or in 96 European control individuals, and strong pathogenicity was predicted by PolyPhen. Interestingly, SIFT predicted a tolerated change. This may be because R764 was not conserved in the rat, dog, and mouse. In these first two species, arginine is replaced by cysteine, the same change observed by den Hollander et al. and Henderson et al. in five patients [3,11,20]. All patients were compound heterozygotes: three with an S403X and one with an E995X mutation. The second mutation was not found in the last patient. In addition to RP, three of these patients had Coats-like exudative vasculopathy. Genotype-phenotype correlations are difficult to establish for CRB1 mutants. However, three out of four patients with a first missense mutation at codon R764 had a null second allele. This is in contrast with the patient we described. Lack of haploinsufficiency and the presence of two missense alleles may be responsible for the late-onset retinopathy observed in this patient. Although we have not been able to document consanguinity between the parents of the proband, it is unlikely that these two alleles originated from independent mutations as the proband displayed a homozygous chromosomal region that was at least 4.6 Mb in length. Homozygosity mapping may therefore still be used in specific ethnic backgrounds despite a lack of overt consanguinity. Precise identification of the molecular mutations in patients with arRP is important for genetic counseling and for future therapies. Loss-of-function mutations in slow-developing RP will most likely be among the first to benefit from gene therapy as already shown for RPE65. Patients such as the one described here might be good candidates for such treatment.
  20 in total

1.  Structure of the C-terminal laminin G-like domain pair of the laminin alpha2 chain harbouring binding sites for alpha-dystroglycan and heparin.

Authors:  D Tisi; J F Talts; R Timpl; E Hohenester
Journal:  EMBO J       Date:  2000-04-03       Impact factor: 11.598

2.  Leber congenital amaurosis and retinitis pigmentosa with Coats-like exudative vasculopathy are associated with mutations in the crumbs homologue 1 (CRB1) gene.

Authors:  A I den Hollander; J R Heckenlively; L I van den Born; Y J de Kok; S D van der Velde-Visser; U Kellner; B Jurklies; M J van Schooneveld; A Blankenagel; K Rohrschneider; B Wissinger; J R Cruysberg; A F Deutman; H G Brunner; E Apfelstedt-Sylla; C B Hoyng; F P Cremers
Journal:  Am J Hum Genet       Date:  2001-05-24       Impact factor: 11.025

Review 3.  Adherens junctions: new insight into assembly, modulation and function.

Authors:  Ulrich Tepass
Journal:  Bioessays       Date:  2002-08       Impact factor: 4.345

Review 4.  CRB1 mutations in inherited retinal dystrophies.

Authors:  Kinga Bujakowska; Isabelle Audo; Saddek Mohand-Saïd; Marie-Elise Lancelot; Aline Antonio; Aurore Germain; Thierry Léveillard; Mélanie Letexier; Jean-Paul Saraiva; Christine Lonjou; Wassila Carpentier; José-Alain Sahel; Shomi S Bhattacharya; Christina Zeitz
Journal:  Hum Mutat       Date:  2011-12-27       Impact factor: 4.878

5.  CRB1 mutations may result in retinitis pigmentosa without para-arteriolar RPE preservation.

Authors:  A J Lotery; A Malik; S A Shami; M Sindhi; B Chohan; C Maqbool; P A Moore; M J Denton; E M Stone
Journal:  Ophthalmic Genet       Date:  2001-09       Impact factor: 1.803

6.  CRB1 has a cytoplasmic domain that is functionally conserved between human and Drosophila.

Authors:  A I den Hollander; K Johnson; Y J de Kok; A Klebes; H G Brunner; E Knust; F P Cremers
Journal:  Hum Mol Genet       Date:  2001-11-15       Impact factor: 6.150

7.  Crumbs, the Drosophila homologue of human CRB1/RP12, is essential for photoreceptor morphogenesis.

Authors:  Milena Pellikka; Guy Tanentzapf; Madalena Pinto; Christian Smith; C Jane McGlade; Donald F Ready; Ulrich Tepass
Journal:  Nature       Date:  2002-02-17       Impact factor: 49.962

Review 8.  CRB1 mutation spectrum in inherited retinal dystrophies.

Authors:  Anneke I den Hollander; Jason Davis; Saskia D van der Velde-Visser; Marijke N Zonneveld; Chiara O Pierrottet; Robert K Koenekoop; Ulrich Kellner; L Ingeborgh van den Born; John R Heckenlively; Carel B Hoyng; Penny A Handford; Ronald Roepman; Frans P M Cremers
Journal:  Hum Mutat       Date:  2004-11       Impact factor: 4.878

9.  Leber congenital amaurosis: comprehensive survey of the genetic heterogeneity, refinement of the clinical definition, and genotype-phenotype correlations as a strategy for molecular diagnosis.

Authors:  Sylvain Hanein; Isabelle Perrault; Sylvie Gerber; Gaëlle Tanguy; Fabienne Barbet; Dominique Ducroq; Patrick Calvas; Hélène Dollfus; Christian Hamel; Tuija Lopponen; Francis Munier; Louisa Santos; Stavit Shalev; Dimitrios Zafeiriou; Jean-Louis Dufier; Arnold Munnich; Jean-Michel Rozet; Josseline Kaplan
Journal:  Hum Mutat       Date:  2004-04       Impact factor: 4.878

10.  The Maguk protein, Pals1, functions as an adapter, linking mammalian homologues of Crumbs and Discs Lost.

Authors:  Michael H Roh; Olga Makarova; Chia-Jen Liu; KunYoo Shin; Seonok Lee; Stephanie Laurinec; Meera Goyal; Roger Wiggins; Ben Margolis
Journal:  J Cell Biol       Date:  2002-04-01       Impact factor: 10.539

View more
  4 in total

1.  CRB2 mutations produce a phenotype resembling congenital nephrosis, Finnish type, with cerebral ventriculomegaly and raised alpha-fetoprotein.

Authors:  Anne Slavotinek; Julie Kaylor; Heather Pierce; Michelle Cahr; Stephanie J DeWard; Dina Schneidman-Duhovny; Adnan Alsadah; Fadi Salem; Gabriela Schmajuk; Lakshmi Mehta
Journal:  Am J Hum Genet       Date:  2014-12-31       Impact factor: 11.025

Review 2.  A challenge to the striking genotypic heterogeneity of retinitis pigmentosa: a better understanding of the pathophysiology using the newest genetic strategies.

Authors:  F S Sorrentino; C E Gallenga; C Bonifazzi; P Perri
Journal:  Eye (Lond)       Date:  2016-08-26       Impact factor: 3.775

Review 3.  Expansion of phenotype and genotypic data in CRB2-related syndrome.

Authors:  Ryan E Lamont; Wen-Hann Tan; A Micheil Innes; Jillian S Parboosingh; Dina Schneidman-Duhovny; Aleksandar Rajkovic; John Pappas; Pablo Altschwager; Stephanie DeWard; Anne Fulton; Kathryn J Gray; Max Krall; Lakshmi Mehta; Lance H Rodan; Devereux N Saller; Deanna Steele; Deborah Stein; Svetlana A Yatsenko; François P Bernier; Anne M Slavotinek
Journal:  Eur J Hum Genet       Date:  2016-03-23       Impact factor: 4.246

4.  Zebrafish Crb1, Localizing Uniquely to the Cell Membranes around Cone Photoreceptor Axonemes, Alleviates Light Damage to Photoreceptors and Modulates Cones' Light Responsiveness.

Authors:  Chuanyu Guo; Ciana Deveau; Cen Zhang; Ralph Nelson; Xiangyun Wei
Journal:  J Neurosci       Date:  2020-08-14       Impact factor: 6.167

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.