Literature DB >> 23580754

BZR1 and BES1 participate in regulation of glucosinolate biosynthesis by brassinosteroids in Arabidopsis.

Rongfang Guo1, Hongmei Qian, Wangshu Shen, Lihong Liu, Min Zhang, Congxi Cai, Yanting Zhao, Junjie Qiao, Qiaomei Wang.   

Abstract

The effect of 24-epibrassinolide (EBR) on glucosinolate biosynthesis in Arabidopsis thaliana was investigated in the present study by using mutants and transgenic plants involved in brassinosteroid (BR) biosynthesis and signal transduction, as well as glucosinolate biosynthesis. The results showed that EBR significantly decreased the contents of major aliphatic glucosinolates including glucoiberin (S3), glucoraphanin (S4), and glucoerucin (T4), as well as the indolic glucosinolates glucobrassicin (IM) and neoglucobrassicin (1IM). In addition, a significantly higher level of glucosinolates accumulated in the BR-deficient mutant cpd and a dramatically lower glucosinolate content in the transgenic plant DWF4-ox overexpressing the BR biosynthetic gene DWF4 compared with their related wild-types, confirmed the repressing effect of BR on glucosinolate biosynthesis. BRI1, the receptor of BR signal transduction, was involved in regulation of glucosinolate biosynthesis by BR. Furthermore, the observation of reduced content of glucosinolates and lower expression levels of glucosinolate biosynthetic genes in 35S-BZR1/bzr1-1D and bes1-D plants compared with the corresponding wild-types suggested that BZR1 and BES1, two important components in BR signal transduction, are responsible for the inhibiting role of BR in glucosinolate biosynthesis. The disappearance of the repressing effect of BR on glucosinolate content in the myb28, myb34, and myb122 mutants indicated that these three MYB factors are important for the regulation of BR in glucosinolate biosynthesis.

Entities:  

Keywords:  Arabidopsis thaliana; BES1; BZR1; MYB.; brassinosteroids; glucosinolates

Mesh:

Substances:

Year:  2013        PMID: 23580754      PMCID: PMC3654425          DOI: 10.1093/jxb/ert094

Source DB:  PubMed          Journal:  J Exp Bot        ISSN: 0022-0957            Impact factor:   6.992


Introduction

Glucosinolates, a group of nitrogen and sulfur-containing secondary metabolites found mainly in Brassicaceae crops, has been proved to be involved in plant interaction with herbivores (Kliebenstein ; Mewis ) and micro-organisms (Kliebenstein ; Brader ). The main pathway and genes involved in glucosinolate biosynthesis have been identified using genetic tools and biochemical approaches in Arabidopsis. In the biosynthesis of the glucosinolate core structure, the substrates tryptophan and methionine are first metabolized by CYP79B2 and CYP79B3, or CYP79F1 and CYP79F2 (Du ; Du and Halkier, 1996; Halkier and Du, 1997; Chen ) to the corresponding aldoximes, which are further converted by the cytochrome P450 enzymes CYP83B1 and CYP83A1 to the next intermediate in indolic or aliphatic glucosinolate pathway (Bak and Feyereisen, 2001). Six MYB factors have been found to be transcriptional regulators in the biosynthesis of glucosinolate in Arabidopsis. Among these, MYB28, MYB29, and MYB76 were shown to specifically trans-activate genes related to aliphatic glucosinolate biosynthetic pathway, i.e. MAM3, CYP79F1, and CYP83A1 (Gigolashvili , 2008). On the other hand, MYB34, MYB51, and MYB122, identified as regulators of the indolic glucosinolate biosynthetic pathway, exclusively trans-activate the promoters of TSB1, CYP79B2, and CYP79B3, which are involved in the indolic glucosinolate biosynthetic pathway (Celenza ; Gigolashvili ). The regulation of glucosinolate biosynthesis by plant hormones such as jasmonates and salicylic acid has been widely investigated (Kiddle ; Doughty ; Brader ; Mikkelsen ). Brassinosteroids (BRs), as stress alleviators distributed ubiquitously in the plant kingdom, protect plants from a variety of environmental stresses, including high- and low-temperature stress, drought, salinity, herbicidal injury, and insect and pathogen attack (Khripach ; Bajguz and Hayat, 2009; Campos ; Yang ). Although the physiological functions of BR in plants and their potential application in crops have been extensively studied, the role of BR in regulating glucosinolate and other secondary metabolites has not been reported. Great progress has been made in BR signal transduction in recent years by molecular genetic and proteomic surveys in Arabidopsis. The BR signal transduction pathway from the cell-surface receptor to nuclear gene expression has been elucidated. BR is perceived by the receptor kinase brassinosteroid insensitive 1 (BRI1) (Nam and Li, 2002). In the presence of BRs, the extracellular domain of BRI1 perceives BRs, leading to the dissociation of BRI1 kinase inhibitor 1 (BKI1) from plasma membrane, the association of BRI1-associated receptor kinase 1 (BAK1) with BRI1, and their trans-phosphorylation to form a completely active BR receptor complex (Yang ). The activation of BRI1 leads to sequential phosphorylation and activation of the BR-signalling kinases (BSKs) and members of the BRI1 and suppressor 1 (BSU1) family phosphatases (Kim and Wang, 2010; Kim ), which inactivates the glycogen synthase kinase-3 enzymes through tyrosine dephosphorylation (Kim ), allowing the activation of brassinazole-resistant 1 (BZR1) and BRI1-EMS-suppressor 1 (BES1) by protein phosphatase 2A (PP2A)-mediated dephosphorylation. Dephosphorylated BZR1 and BES1 are translocated into the nucleus to regulate over 1000 target genes (Sun ). BZR1 and BES1 are essential in BR-regulated gene expression and physiological responses. Studies on BR signal transduction and its responsive genes have provided the clues for the regulation of BR in glucosinolate biosynthesis. Microarray chip data for the BR-responsive genes have shown that CYP79B2, an important gene involved in the biosynthesis of indolic glucosinolates (Chen and Andreasson, 2001), is downregulated by BR treatment in Arabidopsis (Goda ). Moreover, analysis of the target genes of BZR1 has indicated that MYB34 and MYB51, encoding transcriptional factors of indolic glucosinolate biosynthesis, both contain a BZR1-binding site in their promoters (Sun ). In the present study, the role of BR in glucosinolate biosynthesis was investigated in the model plant Arabidopsis. Mutants and transgenic plants involved in BR biosynthesis and signal transduction as well as glucosinolate biosynthesis were selected to investigate how the biosynthesis of glucosinolate in Arabidopsis is modulated by BR, and a possible genetic pathway involved in the regulation of glucosinolate biosynthesis by BR was also elucidated.

Materials and methods

Plants and growth conditions

Seeds were sterilized for 30 s in 75% ethanol and washed with sterile H2O until neutral, and then immersed in 10% sodium hypochlorite for 3min, followed by washing with sterile H2O five times. The seeds were stratified for 3 d at 4 °C and transferred into flasks with liquid growth medium (1/2 sterilized Murashige–Skoog salt solution+1% sucrose), or transferred into Petri dishes with growth medium (1/2 sterilized Murashige–Skoog salt solution+1% sucrose+0.7% agar). Plants were grown with a photoperiod of 16h light/8h dark (110 μm photons m–2) in a plant growth chamber at 23 °C. After 10 d, the flask seedlings were drenched with or without 24-epibrassinolide (EBR; Sigma-Aldrich, St Louis, USA) at different concentrations for 3 d. The control was treated with 0.07% ethanol, which is a solvent of EBR. The Petri dish seedlings were grown for 13 d and then collected to analyse the glucosinolate content and the expression level of related genes. Using two methods of planting Arabidopsis thaliana was due to the special phenotypes of BR-related mutants and transgenic plants such as bes1-D, DWF4-ox, and 35S-BZR1/bzr1-1D, which are too big for liquid cultivation, as well as cpd and bri1 which are too small for liquid cultivation. Seeds of bri1-5, DWF4-ox, bes1-D, and 35S-BZR1/bzr1-1D were obtained from Dr Zhiyong Wang (Department of Plant Biology, Carnegie Institution for Science, Stanford University, CA, USA), and cpd (SALK_090732C), myb28 (SALK_136312), myb29 (CS121027), myb34 (SALK_006901), myb51 (SALK_045103), and myb122 (SALK_022993) were provided by the Arabidopsis Biological Resource Center. The genetic background of all mutants was Columbia (Col-0) but harvested under different conditions, except for bri1-5, whose genetic background was Wassilewskija (Ws).

Glucosinolate assay

Glucosinolates were extracted and analysed as described previously with minor modifications (Guo ; Miao ). Samples (200mg) were boiled in 1ml of H2O for 10min. After transferring the supernatant to a new tube, the residues were washed with 1ml of H2O and the combined aqueous extract was applied to a DEAE–Sephadex A-25 (35mg) column (pyridine acetate form) (Sigma-Aldrich). Sinigrin (Sigma-Aldrich) was used as an internal standard for HPLC analysis. Desulfoglucosinolates were identified by comparison of retention time and quantified by peak area. The glucosinolate concentration was expressed as μmol g–1 of fresh weight of Arabidopsis seedlings.

RNA extraction

Total RNA was isolated from Arabidopsis seedlings six times for two biological repeats using RNAiso Plus (Takara, Japan) according to the manufacturer’s instruction. A total of 1ml of RNAiso Plus was added to the cell pellet. After resuspending the cells, the tubes were shaken vigorously at room temperature for 5min. After centrifugation at 12 000g at 4 °C for 5min, the samples were immediately added to 200 μl of chloroform, shaken, and stored at room temperature for 5min. The extraction mix was then centrifuged for 15min at 12 000g at 4 °C to promote phase separation. The aqueous phase was retrieved and mixed with an equal volume of isopropanol, incubated at room temperature, and centrifuged to concentrate the precipitated RNA. The RNA pellet was washed using 75% ethanol, air dried, and dissolved in diethylpyrocarbonate H2O.

Real-time PCR (RT-PCR) analysis

RNA samples were reverse transcribed into cDNA. The synthesized cDNAs were diluted ten times in H2O and their concentrations were normalized based on the amplification of AtActin. RT-PCR was performed with a total volume of 25 μl, which contained 1 μl of diluted cDNA, 1μl of each 5 μM forward and reverse primer, 9.5 μl of ddH2O and 12.5μl of SYBR Green PCR Master Mix (Takara) on an ABI PRISM Step One Plus TM Real-Time PCR System. PCR amplification was performed using cycling conditions of 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 58 °C for 1min. The expression level of Arabidopsis ACTIN2 was used as an internal control and the expression of other genes was computed with the 2–ΔΔ method (Livak and Schmittgen, 2001). The primers used are listed in Table 1.
Table 1.

Primers used for RT-PCR. F, Forward; R, reverse.

Gene nameLocus codeSequence (5’→3’)
MYB34 At5g60890F: CGGGTCTTAAGTAATTAGCC
R: AAGAAAGGAGCTTGGACTCC
MYB51 At1g18570F: ACAAATGGTCTGCTATAGCT
R: CTTGTGTGTAACTGGATCAA
MYB122 At1g74080F: TCCGTTGAGTCTTGTTTGGA
R: TTGTCAATCCCTTCACAGGA
MYB28 At5g61420F: TCCCTGACAAATACTCTTGCTGAT
R: CATTGTGGTTATCTCCTCCGAATT
MYB29 At5g07690F: CAATACTGGAGGAGGATATAACC
R: AGTTCTTGTCGTCATAATCTTGG
MYB76 At5g07700F: ACGTTTAATCGATGATGGCA
R: ATGGGCTCAACTGGATTAGG
CYP79F1 At1g16410F: CCATACCCTTTTCACATCCTACTGTCT
R: GTAGATTGCCGAGGATGGGC
CYP79F2 At1g16400F: ACTAGGATTTATCGTCTTCATCGCA
R: CTAGGACGAGTCATGATTAGTTCGG
CYP79B2 At4g39950F: TTTGATGGATTGTCTGGCGC
R: CAAAGACGAACAAGGCAACC
CYP79B3 At2g22330F: CGGTTTGTTTATCATCTCCGC
R: TTGCTTACCGCTGATGAAATC
CYP83A1 At4g13770F: TTCAAGAGGTTGTCAATGAGACGC
R: CTACAATATCCAAGATGACGGCTTT
CYP83B1 At4g31500F: TCCGACCTTTTCCCTTATTTCG
R: TTGAGACGTGCACTGAGACCAG
ACTIN2 At3g18780F: TAACTCTCCCGCTATGTATGTCGC
R: CCACTGAGCACAATGTTACCGTAC
Primers used for RT-PCR. F, Forward; R, reverse.

Statistical analysis

Statistical analysis was performed using the SPSS package program version 11.5 (SPSS, Chicago, IL, USA). For Fig. 1, the data were analysed by one-way analysis of variance, followed by Turkey’s HSD multiple comparison test. For Figs 2–5 and 7, the data were analysed using an independent-samples t-test. The values are reported as means ±standard error (SE) for all results. Differences were considered significant at P <0.05.
Fig. 1.

Effect of EBR treatment at different concentrations on glucosinolate (GS) contents. (A) Individual and total aliphatic GS content were measured in 13-d-old Arabidopsis seedlings treated with 1, 3, and 5 μM EBR for 3 d. (B) Individual and total indolic GS content were measured in 13-d-old Arabidopsis seedlings treated with 1, 3, and 5 μM EBR for 3 d. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk wre significantly different from the control (P <0.05). S3, glucoiberin; S4, glucoraphanin; S5, glucoalysin; T4, glucoerucin; S8, glucohirsutin; IM, glucobrassicin; 4IM, 4-methoxy glucobrassicin; 1IM, neoglucobrassicin.

Fig. 2.

Composition and content of glucosinolate (GS) in the BR-deficient mutant cpd. (A) The aliphatic GS profile was analysed in 18-d-old cpd and its corresponding wild-type. (B) The indolic GS profile was analysed in 18-d-old cpd and its corresponding wild type. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Fig. 5.

Composition and content of glucosinolate (GS) in the BR signal transduction plants 35S-BZR1/bzr1-1D and bes1-D. (A) The aliphatic GS profile was analysed in 13-d-old 35S-BZR1/bzr1-1D and bes1-D and their corresponding wild type. (B) The indolic GS profile was analysed in 13-d-old 35S-BZR1/bzr1-1D and bes1-D and their corresponding wild type. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Fig. 7.

Effect of EBR on glucosinolate (GS) contents in Arabidopsis. (A) The total aliphatic GS level was measured in 13-d-old seedlings of Arabidopsis glucosinolate mutants and the related wild type treated with 3 μM EBR for 3d. (B) The total indolic GS level was measured in 13-d-old seedlings of Arabidopsis glucosinolate mutants and the related wild type treated with 3 μM EBR for 3d. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Effect of EBR treatment at different concentrations on glucosinolate (GS) contents. (A) Individual and total aliphatic GS content were measured in 13-d-old Arabidopsis seedlings treated with 1, 3, and 5 μM EBR for 3 d. (B) Individual and total indolic GS content were measured in 13-d-old Arabidopsis seedlings treated with 1, 3, and 5 μM EBR for 3 d. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk wre significantly different from the control (P <0.05). S3, glucoiberin; S4, glucoraphanin; S5, glucoalysin; T4, glucoerucin; S8, glucohirsutin; IM, glucobrassicin; 4IM, 4-methoxy glucobrassicin; 1IM, neoglucobrassicin. Composition and content of glucosinolate (GS) in the BR-deficient mutant cpd. (A) The aliphatic GS profile was analysed in 18-d-old cpd and its corresponding wild-type. (B) The indolic GS profile was analysed in 18-d-old cpd and its corresponding wild type. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Results

Effect of EBR on glucosinolate content in Arabidopsis

To study the role of BR on glucosinolate biosynthesis, 10-d-old Col-0 seedlings were treated with EBR at different concentrations (1, 3, and 5 μM) for 3 d. As shown in Fig. 1, the influence of EBR on glucosinolate accumulation was concentration dependent, and treatment with 3 μM EBR was the most effective in inhibiting the biosynthesis of glucosinolate. The contents of the aliphatic glucosinolates glucoiberin (S3), glucoraphanin (S4), and glucoerucin (T4), as well as the indolic glucosinolates glucobrassicin (IM) and neoglucobrassicin (1IM), all decreased significantly after treatment with 3 μM EBR.

Glucosinolate accumulation in cpd and DWF4-ox

To investigate further the inhibiting role of BR in glucosinolate accumulation, plants containing different levels of BR were used in our experiment, and the results showed that the contents of aliphatic and indolic glucosinolates increased in the BR-deficient mutant cpd and decreased in the BR-overproducing plant DWF4-ox (Wang ) compared with their corresponding wild-type (Figs 2 and 3), indicating that the endogenous BR level affected the accumulation of glucosinolate.
Fig. 3.

Composition and content of glucosinolate (GS) in the BR-overproducing plant DWF4-ox. (A) The aliphatic GS profile was analysed in 13-d-old DWF4-ox and its corresponding wild type. (B) The indolic GS profile was analysed in 13-d-old DWF4-ox and its corresponding wild type. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Composition and content of glucosinolate (GS) in the BR-overproducing plant DWF4-ox. (A) The aliphatic GS profile was analysed in 13-d-old DWF4-ox and its corresponding wild type. (B) The indolic GS profile was analysed in 13-d-old DWF4-ox and its corresponding wild type. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

BRI1 is involved in the regulation of glucosinolate by EBR

BRI1, a kinase with an extracellular leucine-rich repeat and a transmembrane domain, has been shown to be the receptor of the BR-signalling pathway (Nam and Li, 2002). The BRI1 mutant bri1-5 (a weak allele) was used to identify whether the regulation of glucosinolate accumulation by BR was via the BRI-signalling pathway. As shown in Fig. 4, the S3 content, a predominant glucosinolate in Ws, as well as that of the indolic glucosinolates IM and 1IM in the bri1-5 mutant were significantly increased compared with that of the wild-type Ws.
Fig. 4.

Composition and content of glucosinolate (GS) in the BR receptor mutant bri1-5. (A) The aliphatic GS profile was analysed in 13-d-old bri1-5 and its corresponding wild type. (B) The indolic GS profile was analysed in 13-d-old bri1-5 and its corresponding wild type. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Composition and content of glucosinolate (GS) in the BR receptor mutant bri1-5. (A) The aliphatic GS profile was analysed in 13-d-old bri1-5 and its corresponding wild type. (B) The indolic GS profile was analysed in 13-d-old bri1-5 and its corresponding wild type. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Glucosinolate accumulation in BR-signalling transduction mutants

The nuclear protein BZR1 and its homologue BES1, two important transcriptional factors in the BR-signalling pathway, regulating BR-response genes by binding to their DNA promoters (Wang ). The dominant Arabidopsis mutant brassinazole-resistant 1-1D (bzr1-1D) stabilizes the nuclear protein encoded by BZR1, and transformation of the mutant BZR1 gene into Col-0 endows 35S-BZR1/bzr1-1D with a gain-of-function nature in BR-regulated responses. In addition, the BES1 protein is stabilized and accumulates at high levels in the mutant bri1-EMS-suppressor 1-D (bes1-D). In the current study, the accumulation of both aliphatic and indolic glucosinolates was decreased significantly in 35S-BZR1/bzr1-1D and bes1-D compared with the wild type (Fig. 5), indicating the key roles of BZR1 and BES1 in regulating the biosynthesis of glucosinolate in Arabidopsis. Composition and content of glucosinolate (GS) in the BR signal transduction plants 35S-BZR1/bzr1-1D and bes1-D. (A) The aliphatic GS profile was analysed in 13-d-old 35S-BZR1/bzr1-1D and bes1-D and their corresponding wild type. (B) The indolic GS profile was analysed in 13-d-old 35S-BZR1/bzr1-1D and bes1-D and their corresponding wild type. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Expression of glucosinolate-related genes in 35S-BZR1/bzr1-1D and bes1-D

The expression pattern of transcriptional factors and biosynthetic genes in the glucosinolate biosynthesis pathway was measured by RT-PCR in 35S-BZR1/bzr1-1D (Wang ) and bes1-D (Yin ) plants. Six MYB transcription factors have been demonstrated to regulate the biosynthesis of glucosinolate in Arabidopsis (Yan and Chen, 2007). Among these, MYB28, MYB29, and MYB76 are related to the regulation of aliphatic glucosinolate biosynthesis, whilst MYB34, MYB51, and MYB122 are involved in indolic glucosinolate biosynthesis. As shown in Fig. 6A, the expression levels of the six MYB genes were all significantly decreased in 35S-BZR1/bzr1-1D and bes1-D, except for MYB28 in bes1-D.
Fig. 6.

The expression of genes involved in glucosinolate (GS) biosynthesis in BR signal transduction mutant plants 35S-BZR1/bzr1-1D and bes1-D and their corresponding wild type. (A) The mRNA levels of MYB28, MYB29, and MYB76 were measured in 13-d-old seedlings. (B) The mRNA levels of CYP79B2, CYP79B3, CYP79F1, CYP79F2, CYP83A1, and CYP83B1 were measured in 13-d-old seedlings. Relative expression level was measured by RT-PCR. Results are shown as the mean transcript level from two biological replicates. In order to allow an easier comparison, we set the expression level of the control samples to ‘1’.

The expression of genes involved in glucosinolate (GS) biosynthesis in BR signal transduction mutant plants 35S-BZR1/bzr1-1D and bes1-D and their corresponding wild type. (A) The mRNA levels of MYB28, MYB29, and MYB76 were measured in 13-d-old seedlings. (B) The mRNA levels of CYP79B2, CYP79B3, CYP79F1, CYP79F2, CYP83A1, and CYP83B1 were measured in 13-d-old seedlings. Relative expression level was measured by RT-PCR. Results are shown as the mean transcript level from two biological replicates. In order to allow an easier comparison, we set the expression level of the control samples to ‘1’. Gene expression of the main biosynthetic genes such as CYP79B2, CYP79B3, CYP79F1, CYP79F2, CYP83A1, and CYP83B1 was also detected in the present study (Fig. 6B), and the results showed that all the biosynthetic genes tested were downregulated in 35S-BZR1/bzr1-1D and bes1-D compared with the wild type, which is in accordance with the reduction of glucosinolate content in 35S-BZR1/bzr1-1D and bes1-D.

Effect of BR on glucosinolate accumulation in myb28, myb29, myb34, myb51, and myb122 mutants

To investigate whether the transcriptional factors involved in glucosinolate biosynthetic pathway are essential to the regulation of BR in glucosinolate accumulation in Arabidopsis, changes in the content of glucosinolates after treatment with EBR were analysed in five mutants myb28, myb29, myb34, myb51, and myb122. As shown in Fig. 7A, the level of total aliphatic glucosinolates decreased dramatically in myb28 and myb29, especially in myb28. The repressing effect of BR on aliphatic glucosinolates accumulation was diminished in myb28. The indolic glucosinolate content was reduced significantly in myb34, myb51, and myb122, and the effect of BR on indolic glucosinolates was weakened in myb34 and myb122 (Fig. 7B). Effect of EBR on glucosinolate (GS) contents in Arabidopsis. (A) The total aliphatic GS level was measured in 13-d-old seedlings of Arabidopsis glucosinolate mutants and the related wild type treated with 3 μM EBR for 3d. (B) The total indolic GS level was measured in 13-d-old seedlings of Arabidopsis glucosinolate mutants and the related wild type treated with 3 μM EBR for 3d. Each result is the mean±SE of four replicates per treatment. Values marked with an asterisk are significantly different from the control (P <0.05).

Discussion

EBR decreases the accumulation of glucosinolates in Arabidopsis

BRs are known to alleviate plants from stress by transcriptional regulation of plant development and resistance (Khripach ; Bajguz and Hayat, 2009; Campos ; Yang ). Secondary metabolites also function in defence against difference kinds of abiotic or biotic stress (Kliebenstein, 2004). However, little has been reported about whether BR is involved in the regulation of secondary metabolites biosynthesis. Here, we took glucosinolates as an example to elucidate how BR regulates the biosynthesis of secondary metabolites. In the present study, we found that BR reduced the contents of both aliphatic and indolic glucosinolates. The accumulation of S4 and T4 (Fig. 1A), major aliphatic glucosinolates, as well as the indolic glucosinolates IM and 1IM (Fig. 1B), in Arabidopsis was significantly decreased after treatment with BR. Furthermore, the significantly higher glucosinolate content in the BR-deficient mutant cpd (Fig. 2) and dramatically lower glucosinolate content in the transgenic plant DWF4-ox overexpressing DWF4 (Fig. 3) confirmed the inhibiting role of BR in glucosinolate biosynthesis. This is in accordance with the results of microarray chip data by Goda , which indicated that CYP79B2, an important gene in indolic glucosinolate biosynthesis, was downregulated by the application of BR. Thus, we hypothesized that BR inhibits glucosinolate biosynthesis in Arabidopsis.

BRI1-dependent regulation of glucosinolate biosynthesis by EBR

BRI1 with an extracellular domain connected by a single-pass transmembrane helix to an intracellular serine/threonine kinase domain encoding a leucine-rich repeat receptor-like kinase is essential for BR perception at the cell surface (Nam and Li, 2002). In the BR-perception mutant bri1-5 (a weak bri1 allele), the signal for BR is cut off and the mutant exhibits the phenotype of dwarfism and dark-green leaves. In our study, the absence of BRI1 increased the content of aliphatic and indolic glucosinolates (Fig. 4), indicating that BRI1 participates in the regulation of glucosinolates by BR. In addition, Sun found that 80% of the genes affected in bri1-116 were affected in opposite ways by bzr1-1D, indicating that BZR1 directly or indirectly regulates the expression of about 80% of the genes controlled by BR through BRI1.

BZR1 and BES1 are involved in the regulation of glucosinolate biosynthesis by EBR

Genetic studies have revealed a central role for BZR1 and BES1 in BR-regulated plant growth (Wang ; Yin ). Activation of either BZR1 or BES1 by dominant mutations (bzr1-1D and bes1-D) suppresses nearly all phenotypes of the BR-insensitive bri1 mutant (Wang ; Yin ). Glucosinolate accumulation in 35S-BZR1/bzr1-1D and bes1-D was analysed in our study to elucidate whether these two important transcriptional factors are involved in the BR-regulated glucosinolate accumulation. The results showed that the total aliphatic and indolic glucosinolates were all significantly reduced in these two plants compared with those in the wild type, indicating that BZR1 and BES1 play key roles in BR-regulated glucosinolate biosynthesis. This was further confirmed by analysis of target genes of BZR1 by microarray chip experiments (Sun ), which showed that both MYB34 and MYB51, two transcriptional factors in indolic glucosinolate biosynthesis, are BR-responsive genes. BZR1 and BES1 share 88% sequence identity at the protein level and bind to DNA through the conserved N-terminal DNA-binding domain (He ). They have very similar biochemical functions. ChIP-qPCR experiments have shown that both BZR1 and BES1 bind to the BR-repressed gene DWF4 and the BR-induced gene SAUR-AC1 (Sun ), and BES1 binds to 18 of the 19 BZR1-binding sites analysed (Sun ). The DNA-binding activity BZR1 and its nuclear localization are tightly controlled by BR signalling (Kim and Wang, 2010), and the genes regulated by BZR1 should be responsive to BR treatment or affected in BR mutants. The expression of glucosinolate biosynthetic genes in 35S-BZR1/bzr1-1D and bes1-D was investigated in our study, and all the tested genes including six MYB transcriptional factors and six main biosynthetic genes were downregulated in these two plants. These six MYB transcriptional factors, MYB28, MYB29, MYB76, MYB34, MYB51, and MYB122, might function in the nucleus due to an amino acid sequence acting as an SV40-type nuclear localization signal motif (Gigolashvili ). Among these, MYB28 and MYB34 are the main transcriptional regulators in the aliphatic and indolic glucosinolate biosynthesis pathways, respectively. The downstream genes of the glucosinolate biosynthetic pathway, CYP79F1, CYP79F2, and CYP83B1, as well as CYP79B2 and CYP79B3, are positively mediated by MYB28 and MYB34. Thus, we propose that BZR1 and BES1 might mediate the regulation of the glucosinolate biosynthetic pathway at the transcriptional level via the transcriptional factors or by binding directly to the biosynthetic genes (Fig. 8), such as CYP79B2, which has been shown to be responsive to BZR1 in microarray chip analysis (Sun ). Therefore, the inhibiting effect of BR on glucosinolate accumulation could be due to the transcription repressor function of BZR1 and BES1 on glucosinolate biosynthetic genes.
Fig. 8.

The possible mechanism involved in regulation of glucosinolate biosynthesis by BR in Arabidopsis. (This Fig. is available in colour at JXB online.)

The possible mechanism involved in regulation of glucosinolate biosynthesis by BR in Arabidopsis. (This Fig. is available in colour at JXB online.)

Downregulation of glucosinolates by EBR through MYB transcription factors

To elucidate the role of the MYB transcriptional factors in BR-inhibited glucosinolate accumulation, five MYB mutants, myb28, myb29, myb34, myb51, and myb122 were used to elucidate the effect of BR on their glucosinolate accumulation. As shown in Fig. 7B, MYB34, MYB51 and MYB122 loss-of-function mutation all conferred reduced indolic glucosinolate levels. The deficiency of MYB34 and MYB122 lost the responsive ability to the application of BR, and there was no detectable reduction in indolic glucosinolates in mutants myb34 and myb122 after treatment with BR, indicating an important role of MYB34 and MYB122 in the BZR1-mediated repression of glucosinolate accumulation. The expression of MYB34 has the potential to be controlled at the translational as well as the transcriptional level, because the MYB34 transcript contains three short open reading frames upstream and out of frame with the Myb-encoding open reading frame (Bender and Fink, 1998). As for the aliphatic glucosinolates, the deficiency in MYB28 and MYB29 led to a great decrease in the content of aliphatic glucosinolate compared with that of the wild type (Fig. 7A). Both MYB28 and MYB29 are transcriptional factors regulating the biosynthesis of aliphatic glucosinolates (Gigolashvili ). Hirai found that MYB28 and MYB29 have functional redundancy in the regulation of aliphatic glucosinolate, in which MYB28 is a key component of this pathway whilst MYB29 is accessory. The repressing effect of BR on glucosinolates was diminished in mutant myb28, indicating that MYB28 plays a key role in the BR-regulated decrease in glucosinolates.

Conclusions

BR inhibited the biosynthesis of glucosinolates, and the endogenous content of BR affected the accumulation of glucosinolates in A. thaliana. Furthermore, the regulation of BR in glucosinolates biosynthesis was via BRI1, the membrane receptor. BZR1 and BES1, two important transcriptional factors downstream of BRI1 in the BR signal transduction pathway, were both involved in the regulation of glucosinolates by BR, as lower levels of glucosinolate were observed in 35S-BZR1/bzr1-1D and bes1-D plants compared with those in the wild type. In addition, the downregulation of genes related to the glucosinolate biosynthetic pathway in 35S-BZR1/bzr1-1D and bes1-D combined with the former microarray chip data (Chen and Andreasson, 2001) suggested that BZR1 and BES1 might regulate glucosinolate biosynthesis directly by binding to glucosinolate biosynthetic genes by the conserved N-terminal DNA-binding domain or indirectly through MYB factors. The disappearance of the repressing effect of BR on glucosinolate contents in myb28, myb34, and myb122 mutant plants indicated that these three MYB factors are important for BR-regulated indolic glucosinolate accumulation. However, more work is needed to further elucidate how BZR1 and BES1 regulate the biosynthesis of glucosinolates at the molecular level in Arabidopsis.
  32 in total

1.  Integration of brassinosteroid signal transduction with the transcription network for plant growth regulation in Arabidopsis.

Authors:  Yu Sun; Xi-Ying Fan; Dong-Mei Cao; Wenqiang Tang; Kun He; Jia-Ying Zhu; Jun-Xian He; Ming-Yi Bai; Shengwei Zhu; Eunkyoo Oh; Sunita Patil; Tae-Wuk Kim; Hongkai Ji; Wing Hong Wong; Seung Y Rhee; Zhi-Yong Wang
Journal:  Dev Cell       Date:  2010-11-16       Impact factor: 12.270

2.  BZR1 is a transcriptional repressor with dual roles in brassinosteroid homeostasis and growth responses.

Authors:  Jun-Xian He; Joshua M Gendron; Yu Sun; Srinivas S L Gampala; Nathan Gendron; Catherine Qing Sun; Zhi-Yong Wang
Journal:  Science       Date:  2005-01-27       Impact factor: 47.728

3.  Jasmonate-dependent induction of indole glucosinolates in Arabidopsis by culture filtrates of the nonspecific pathogen Erwinia carotovora.

Authors:  G Brader; E T Palva
Journal:  Plant Physiol       Date:  2001-06       Impact factor: 8.340

Review 4.  The glucosinolate-myrosinase system in an ecological and evolutionary context.

Authors:  Dan J Kliebenstein; Juergen Kroymann; Thomas Mitchell-Olds
Journal:  Curr Opin Plant Biol       Date:  2005-06       Impact factor: 7.834

5.  Brassinosteroids interact negatively with jasmonates in the formation of anti-herbivory traits in tomato.

Authors:  Marcelo Lattarulo Campos; Marcílio de Almeida; Mônica Lanzoni Rossi; Adriana Pinheiro Martinelli; Celso Gaspar Litholdo Junior; Antonio Figueira; Fátima Teresinha Rampelotti-Ferreira; José Djair Vendramim; Vagner Augusto Benedito; Lázaro Eustáquio Pereira Peres
Journal:  J Exp Bot       Date:  2009-09-04       Impact factor: 6.992

6.  Brassinosteroid signal transduction from cell-surface receptor kinases to nuclear transcription factors.

Authors:  Tae-Wuk Kim; Shenheng Guan; Yu Sun; Zhiping Deng; Wenqiang Tang; Jian-Xiu Shang; Ying Sun; Alma L Burlingame; Zhi-Yong Wang
Journal:  Nat Cell Biol       Date:  2009-09-06       Impact factor: 28.824

7.  Modulation of CYP79 genes and glucosinolate profiles in Arabidopsis by defense signaling pathways.

Authors:  Michael Dalgaard Mikkelsen; Bent Larsen Petersen; Erich Glawischnig; Anders Bøgh Jensen; Erik Andreasson; Barbara Ann Halkier
Journal:  Plant Physiol       Date:  2003-01       Impact factor: 8.340

8.  BRI1/BAK1, a receptor kinase pair mediating brassinosteroid signaling.

Authors:  Kyoung Hee Nam; Jianming Li
Journal:  Cell       Date:  2002-07-26       Impact factor: 41.582

9.  Involvement of cytochrome P450 in oxime production in glucosinolate biosynthesis as demonstrated by an in vitro microsomal enzyme system isolated from jasmonic acid-induced seedlings of Sinapis alba L.

Authors:  L Du; J Lykkesfeldt; C E Olsen; B A Halkier
Journal:  Proc Natl Acad Sci U S A       Date:  1995-12-19       Impact factor: 11.205

10.  BAK1 regulates the accumulation of jasmonic acid and the levels of trypsin proteinase inhibitors in Nicotiana attenuata's responses to herbivory.

Authors:  Da-Hai Yang; Christian Hettenhausen; Ian T Baldwin; Jianqiang Wu
Journal:  J Exp Bot       Date:  2010-10-11       Impact factor: 6.992

View more
  19 in total

1.  Virulence factors of geminivirus interact with MYC2 to subvert plant resistance and promote vector performance.

Authors:  Ran Li; Berhane T Weldegergis; Jie Li; Choonkyun Jung; Jing Qu; Yanwei Sun; Hongmei Qian; ChuanSia Tee; Joop J A van Loon; Marcel Dicke; Nam-Hai Chua; Shu-Sheng Liu; Jian Ye
Journal:  Plant Cell       Date:  2014-12-09       Impact factor: 11.277

2.  Brassinosteroids Antagonize Jasmonate-Activated Plant Defense Responses through BRI1-EMS-SUPPRESSOR1 (BES1).

Authors:  Ke Liao; Yu-Jun Peng; Li-Bing Yuan; Yang-Shuo Dai; Qin-Fang Chen; Lu-Jun Yu; Ming-Yi Bai; Wen-Qing Zhang; Li-Juan Xie; Shi Xiao
Journal:  Plant Physiol       Date:  2019-11-27       Impact factor: 8.340

3.  Effects of glucose and gibberellic acid on glucosinolate content and antioxidant properties of Chinese kale sprouts.

Authors:  Hui-Ying Miao; Meng-Yu Wang; Jia-Qi Chang; Han Tao; Bo Sun; Qiao-Mei Wang
Journal:  J Zhejiang Univ Sci B       Date:  2017 Dec.       Impact factor: 3.066

Review 4.  It takes two to tango - molecular links between plant immunity and brassinosteroid signalling.

Authors:  Fausto Andres Ortiz-Morea; Ping He; Libo Shan; Eugenia Russinova
Journal:  J Cell Sci       Date:  2020-11-25       Impact factor: 5.285

5.  Characterization of Brassinazole resistant (BZR) gene family and stress induced expression in Eucalyptus grandis.

Authors:  Chunjie Fan; Guangsheng Guo; Huifang Yan; Zhenfei Qiu; Qianyu Liu; Bingshan Zeng
Journal:  Physiol Mol Biol Plants       Date:  2018-06-18

6.  Transcriptional Analysis of serk1 and serk3 Coreceptor Mutants.

Authors:  G Wilma van Esse; Colette A Ten Hove; Francesco Guzzonato; H Peter van Esse; Mark Boekschoten; Lars Ridder; Jacques Vervoort; Sacco C de Vries
Journal:  Plant Physiol       Date:  2016-11-01       Impact factor: 8.340

7.  Quantitative proteomics reveals the importance of nitrogen source to control glucosinolate metabolism in Arabidopsis thaliana and Brassica oleracea.

Authors:  Daniel Marino; Idoia Ariz; Berta Lasa; Enrique Santamaría; Joaquín Fernández-Irigoyen; Carmen González-Murua; Pedro M Aparicio Tejo
Journal:  J Exp Bot       Date:  2016-04-16       Impact factor: 6.992

8.  NBS-LRR Protein Pik-H4 Interacts with OsBIHD1 to Balance Rice Blast Resistance and Growth by Coordinating Ethylene-Brassinosteroid Pathway.

Authors:  Hao Liu; Shuangyu Dong; Fengwei Gu; Wei Liu; Guili Yang; Ming Huang; Wuming Xiao; Yongzhu Liu; Tao Guo; Hui Wang; Zhiqiang Chen; Jiafeng Wang
Journal:  Front Plant Sci       Date:  2017-02-06       Impact factor: 5.753

Review 9.  Possible Interactions between the Biosynthetic Pathways of Indole Glucosinolate and Auxin.

Authors:  Siva K Malka; Youfa Cheng
Journal:  Front Plant Sci       Date:  2017-12-14       Impact factor: 5.753

10.  Identification of Candidate Genes for Seed Glucosinolate Content Using Association Mapping in Brassica napus L.

Authors:  Cun-Min Qu; Shi-Meng Li; Xiu-Jian Duan; Jin-Hua Fan; Le-Dong Jia; Hui-Yan Zhao; Kun Lu; Jia-Na Li; Xin-Fu Xu; Rui Wang
Journal:  Genes (Basel)       Date:  2015-11-18       Impact factor: 4.096

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.