Construction, expression, and characterization of thymosin alpha 1 tandem repeats in Escherichia coli.

Thymosin alpha 1 (T α 1), which is composed of 28 amino acids, has been commercialized worldwide for its immune-modulatory and antitumor effects. T α 1 can stimulate T cell proliferation and differentiation from bone marrow stem cells, augment cell-mediated immune responses, and regulate homeostasis of immune system. In this study, we developed a novel strategy to produce T α 1 concatemer (T α 1③) in Escherichia coli and compared its activity with chemically synthesized T α 1. Results showed that T α 1③ can more effectively stimulate T cell proliferation and significantly upregulate IL-2 receptor expression. We concluded that the expression system for T α 1 concatemer was constructed successfully, which could serve as an efficient tool for the production of large quantities of the active protein.

1. Introduction

The tandem repeats of proteins and peptides are studied widely and formidable progress has been made in this field. It was reported that tandem amino acid repeats have many functions of stabilizing proteins [1], maintaining conformation [2], elevating activity, and increasing half-life of proteins in blood or tissues. Frasch and colleagues suggested that tandem repeats present in Trypanosoma cruzi transsialidase stabilized the catalytic activity. In addition, repeats present on T. cruzi shed proteins increased trans-sialidase half-life in blood from 7 to almost 35 h [3]. Some proteins that contain tandemly repeated sequences play important roles in cell membrane skeleton system [4, 5].

Thymosin alpha1 (Tα1) is a heat-stable, acidic polypeptide composed of 28 amino acid residues blocked at the N-terminus by an acetyl group [6, 7]. It is an immune modifier that has been shown to trigger lymphocytes maturation, augment T cell function, induce T-cell differentiation, and promote reconstitution of immune defects. All these findings showed that Tα1 could be a useful restorative therapeutic agent in the treatment of immunodeficiency diseases and immunosuppressed conditions [8-10].

In this study, Tα1③ which was composed of three repeated copies of Tα1 was fuse-expressed with thioredoxin (trx) in E. coli TOP10 strain and purified by heat treatment and Q-Sepharose Fast Flow ion-exchange chromatography. Then, Tα1③ was released by treatment with 0.5 M Cyanogen bromide (CNBr) and purified by SP-Sepharose Fast Flow chromatography. In our strategy, trx acts as a chaperon to help Tα1③ folding and CNBr treatment removed any exogenous amino acid (such as Met at the N-terminus for translation start) from Tα1③ molecule. So we can get the “natural” Tα1③. Finally, the biological activity of Tα1③ on T lymphocyte proliferation and IL-2R expression was assessed.

2. Materials and Methods

2.1. Materials

Restriction enzymes, Taq DNA polymerase, and T4 DNA ligase were purchased from TaKaRa. Expression vector pThioHisA and E. coli strain TOP10 (F-mcrAΔ(mrr-hsd RMS-mcrBC) φ80 lacZΔM15 ΔlacX74 recA1 araΔ139Δ(ara-leu)7697 galU galK rpsL (Strr)endA1 nupG) were from Invitrogen. DNA fragments were synthesized in BIOASIA. Synthetic Tα1 (ZADAXIN) was from Sciclone Pharmaceuticals, USA. The anti-Tα1 antibody (ab55635) was purchased from Abcam and FITC-anti-IL-2Rβ (18344D 554452) was from BD Pharmingen.

2.2. Tα1③ Gene Amplification

Tα1③ gene was cloned by gene synthesis and PCR (Figure 1). The forward primer (with an introduced EcoR I site) was p1: 5′-GGAATTCATGTCTGATGCAGCCGTGGAC ACCAGCAGCG-3′ and the reverse primer (with an introduced Pst I site) was p2: 5′-GCACTGCAGTCAGTTCTGGGCCTCCTCCACCACCT-3′. The template for PCR was annealing products of 4 synthesized fragments listed in Table 1. PCR product was cloned into pGEM-3Zf plasmid to obtain vector pGEM-Tα1③ for identification.

Figure 1

Schematic diagram shows the strategy for constructing Tα1 concatemers. The Arabic numerals 1 to 4 are sequences 1 to 4 split from Tα1 described previously for concatemers assembly. P1 and P2 are forward and reverse primers for PCR.

Table 1

Nucleotide sequence of DNA fragments split from Tα1 for concatemers assembly.

Number	nucleotide sequence
1	GACACCAGCAGCGAGATCACCACCAAGGACC GGAAGGAGAAGAAGGAGGTGGTG
2	GAGGAGGCCGAGAACAGCGACGCCGCCGTG
3	CTTGGTGGTGATCTCGCTGCTGGTGTCCACGG CGGCGTCGCT
4	GTTCTCGGCCTCCTCCACCACCTCCTTCTTCTCC TTCAGGTC

2.3. Construction of Expression Vector pThioHisA-Tα1③

The vector pGEM-Tα1③ was digested with EcoR I and Pst I and cloned into expression vector pThioHisA digested with the same enzymes. The candidate plasmid pThioHisA-Tα1③ was then confirmed by restriction enzymes digestion and DNA sequencing.

2.4. Expression of the Fusion Protein

The plasmid pThioHisA-Tα1③ was transformed into E. coli TOP10 strain. A single colony was inoculated into 10 mL Luria-Bertani (LB) medium supplemented with ampicillin (100 μg/mL) and grown at 200 rpm and 37°C overnight. Then it was inoculated into 300 mL fresh LB medium in a 500 mL shake flask and cultured until the OD600 reached 0.5. Trx-Tα1③ expression was induced by 1 mM IPTG (final concentration) for 4 h. Large scale fed-batch culture was performed in a 5-L fermentor as previously described [11].

2.5. Purification of Tα1③

Cell pellet was suspended in 20 mM Tris/HCl buffer (pH 8.0) in proportion of 200 g/L and disrupted by sonication. Then, the lysate was incubated at 80°C for 10 min (shaken once every 2-3 min) and cooled quickly. Samples were centrifuged at 12 000 g for 20 min and the supernatant was loaded onto a Q-Sepharose Fast Flow chromatography column and eluted with linear NaCl gradient. The purified Trx-Tα1③ was then cleaved by CNBr (0.5 M) in 70% formic acid for 24 h. The cleavage reaction was stopped by addition of ten times amount of H2O [12] and Tα1③ was purified by SP-Sepharose Fast Flow chromatography. Purified Tα1③ was dialyzed against PBS for later use.

2.6. Western-Blot Analysis

Proteins were transferred to nitrocellulose membranes (0.22 μm, Invitrogen) after SDS-PAGE using a Bio-Rad Semi-Dry electrophoretic cell. Western blot analyses were carried out using a Tα1 specific antibody and followed by a phosphatase-conjugated goat anti-mouse IgG (Boster, China). Western Blue Stabilized Substrate (Promega) for alkaline phosphatase was used for visualization.

2.7. Biological Activity Assay

The proliferation response of splenocytes was determined by MTT assay. Spleens from C57BL6 mice were dispersed through nylon mesh to generate a single-cell suspension. Then lymphocytes were separated by EZ-Sep 1× Lymphocyte Separation Medium (DKW33-R0100, Dakewe Biotech Company, China) and suspended at 4 × 106/mL in RPMI 1640 media. For proliferation assay, cells were seeded in 96-well plates (4 × 105/well) and cultured in the presence of 2.5 μg/mL concanavalin A (ConA) at 37°C in 5% CO2 in humid air. Six h later, 90 μL of Tα1③ diluted with RPMI 1640 media was added to all but the control wells. The synthetic Tα1 and media were used as positive and negative controls. After 66 h incubation, 20 μL of MTT (0.5 mg/mL) solution was added and the plates were centrifuged (2000 rpm, 25°C, 10 min) 4 h later. Supernatants were discarded, and 100 μL of DMSO was added. After incubated at room temperature for 10 min, the solubilized reduced MTT was measured at 570 nm using a Bio-Rad plate reader and the optical densities were used for calculate growth rate with the formula

To evaluate the effect of Tα1③ on the expression level of IL-2R on T lymphocytes, cells were isolated as before and cultured in the presence of ConA and Tα1③. The synthetic Tα1 and a recombinant Tα1 monomer prepared in our lab were used as positive controls. Cells were collected and stained 48 h later according to standard protocol. In brief, 5 × 105 cells were washed with PBS and stainedin “FACS buffer” (PBS with 0.1% sodium azide, 2% FBS, and 1 μM EDTA) with FITC-anti-mIL-2Rβ for 10 min at room temperature. After washing, cells were fixed for 30 minutes on ice with 4% paraformaldehyde and analyzed on a FACSCalibur flow cytometer (BD Biosciences).

3. Results and Discussion

3.1. Tα1③ Gene Cloning

Although synthetic Tα1 has been successfully applied in clinical trials for immunodeficiency diseases therapy, the high costs is still a hard nut to crack. Fortunately, molecular biology techniques allowed us to produce recombinant Tα1 in E. coli. Considering that Tα1 is too small to be directly expressed in E. coli, it was usually assembled as concatemers. But some exogenous amino acid residues such as His6 tag or methionine (Met) introduced by the initiation codon AUG usually affects the effect of concatemers [13].

In order to produce the real “natural” concatemers of Tα1, we put forward a new strategy as showed in Figure 1. By this strategy, we obtained a series of Tα1 concatemers in which Tα1③ that was assembled by three repeated copies of Tα1 gene owned highest proportion. After cloning into pGEM-3Zf vector, the gene was proven by enzyme digestion and DNA sequencing. The sequence of Tα1③ gene was consistent with our design as follows: 5′-atgagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaacagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaacagcgacgccgccgtggacaccagcagcgagatcaccaccaaggaccggaaggagaagaaggaggtggtggaggaggccgagaactga-3′.

3.2. Expression of Recombinant Fusion Protein

Both SDS-PAGE (Figure 2(a)) and Western blot (Figure 2(f)) analyses of the induced supernatant from pThioHisA-Tα1③/TOP10 showed that a new 31 kDa protein which can be specifically recognized by Tα1 antibody was produced. It suggested that trx-Tα1③ was successfully expressed. Trx was used as a chaperon to guarantee the correct folding of Tα1③ and trx-Tα1③ was expressed as a soluble fusion protein.

Figure 2

Expression, purification, and identification of Tα1③. (a) Expression of trx-Tα1③ in TOP10. Lane 1: protein marker; lane 2: total bacterial proteins of pThioHisA-Tα1③/TOP10 without induction; lane 3: total bacterial protein with IPTG induction. (b) Chromatogram of Q-Sepharose Fast Flow chromatography for purification of trx-Tα1③. The arrow indicated trx-Tα1③. (c) Chromatogram of SP-Sepharose Fast Flow chromatography for purification of Tα1③. The arrow indicated Tα1③. (d) SDS-PAGE analysis of trx-Tα1③ purification. Lane 1–3: total proteins of pThioHisA-Tα1③/TOP10 after IPTG induction (1 h, 3 h, 5 h); lane 4: supernatant of lysate heated at 80°C for 10 min; lane 5: purified trx-Tα1③. (e) Tricine-SDS-PAGE analysis of Tα1③ purification. Lane 1: standard peptide marker; lane 2: cleavage products without Tα1③; lane 3: purified Tα1③. (f) Western-blot analysis of trx-Tα1③. Lane 1: total bacterial proteins after IPTG induction; lane 2: purified trx-Tα1③.

3.3. Purification of Tα1③

Both trx and Tα1 are heat-stable proteins, so trx-Tα1③ was easily purified by one-step Q-Sepharose Fast Flow chromatography after the lysate of recombinant bacterial cells was heated at 80°C for 10 min (Figures 2(b) and 2(d)). Then, the purified trx-Tα1③ was cleaved by CNBr, and Tα1③ was purified by SP-Sepharose Fast Flow chromatography (Figures 2(c) and 2(e)). 2L-Tricine-SDS-PAGE [14] and HPLC analyses were used to identify the purity of Tα1③. CNBr treatment was utilized here to remove the redundant Met from the N-terminus of Tα1③ to obtain the real “natural” molecule.

3.4. Biological Activity of  Tα1③

We expected that the tandem repeats could obtain stronger activity through elongating the half-life of Tα1 and simulating polymerization of monomer molecules and thereafter triggering the polymerization and activation of receptors which was usually used by molecules to gain function.

To examine the effect of Tα1③ on stimulating the proliferation of splenic lymphocytes, we compared the proliferation ratio of mice lymphocytes treated with synthetic Tα1 ZADAXIN and Tα1③. MTT assay results showed that 40 μg/mL synthetic Tα1 could induce significant proliferation of lymphocytes compared to the control (P < 0.05), whereas 5 μg/mL Tα1③ could induce significant proliferation (P < 0.05). Furthermore, the effect of 10 μg/mL Tα1③ was stronger than that of 40 μg/mL synthetic Tα1 (Figure 3).

Figure 3

Tα1③ stimulated proliferation of mouse spleen lymphocytes. T lymphocytes from B6 mice spleen were treated with ConA (control) or ConA plus Tα1③ or synthetic Tα1. Cell proliferation was determined by the MTT viability assay. The assays were repeated in triplicate. (*P < 0.05 compared with control group. **P < 0.05 compared with Tα1 group.)

In addition, the upregulation of IL-2R on lymphocytes by ZADAXIN purified recombinant Tα1 monomer and Tα1③ was compared. Results showed that when costimulated with ConA, IL-2R expression level on T cell was upregulated by all these three molecules and Tα1③ obtained strongest effect (Figure 4).

Figure 4

Effect on upregulation of IL-2R expression level on T cell surface of Tα1③. T lymphocytes from B6 mice spleen were cultured in the presence of ConA (b) or ConA plus standard synthesized Tα1 (c), recombinant Tα1 (d), and recombinant Tα1③ (e), respectively. (a) The unstrained control. Data are representative of three experiments.

4. Conclusions

Trx-Tα1③ was expressed in E. coli as a soluble form and the real “natural” Tα1③ was conveniently purified by heat treatment and ion-exchange chromatography. As expected, the bioactivity of Tα1③ was stronger than that of synthetic Tα1. Lower dose (5 μg/mL) of Tα1③ apparently stimulated the proliferation of T lymphocytes compared with that of ZADAXIN (40 μg/mL). In addition, Tα1③ significantly upregulated IL-2R on T cell, which is very important for T cell activation and proliferation in vivo. The detailed mechanism for stronger effect of Tα1③ and the pharmacokinetics of different tandem repeats are still under investigation.