Literature DB >> 23550128

A targeted genetic modifier screen links the SWI2/SNF2 protein domino to growth and autophagy genes in Drosophila melanogaster.

Matt Hyoung Kwon1, Heather Callaway, Jim Zhong, Barry Yedvobnick.   

Abstract

Targeted genetic studies can facilitate phenotypic analyses and provide important insights into development and other complex processes. The SWI2/SNF2 DNA-dependent ATPase Domino (Dom) of Drosophila melanogaster, a component of the Tip60 acetyltransferase complex, has been associated with a wide spectrum of cellular processes at multiple developmental stages. These include hematopoiesis, cell proliferation, homeotic gene regulation, histone exchange during DNA repair, and Notch signaling. To explore the wider gene network associated with Dom action, we used RNAi directed against domino (dom) to mediate loss-of-function at the wing margin, a tissue that is readily scored for phenotypic changes. Dom RNAi driven through GAL4-UAS elicited dominant wing nicking that responded phenotypically to the dose of dom and other loci known to function with dom. We screened for phenotypic modifiers of this wing phenotype among 2500 transpositions of the EP P element and found both enhancers and suppressors. Several classes of modifier were obtained, including those encoding transcription factors, RNA regulatory proteins, and factors that regulate cell growth, proliferation and autophagy, a lysosomal degradation pathway that affects cell growth under conditions of starvation and stress. Our analysis is consistent with prior studies, suggesting that Dom acts pleiotropically as a positive effector of Notch signaling and a repressor of proliferation. This genetic system should facilitate screens for additional loci associated with Dom function, and complement biochemical approaches to their regulatory activity.

Entities:  

Keywords:  Notch signaling; autophagy; cell proliferation; chromatin; gene regulation

Mesh:

Substances:

Year:  2013        PMID: 23550128      PMCID: PMC3656729          DOI: 10.1534/g3.112.005496

Source DB:  PubMed          Journal:  G3 (Bethesda)        ISSN: 2160-1836            Impact factor:   3.154


Genetic interaction screening is a powerful tool for the analysis of complex processes. In cases where a gene acts throughout development, targeting loss of function to a later stage can abrogate early lethality and allow application of effective genetic strategies. In Drosophila, targeted genetic screening has been used to study the genetics of key developmental pathways operating in specific tissues at particular times (Zhong and Yedvobnick 2009). Such screening often uses the yeast GAL4-UAS system to express high levels of normal or mutated versions of genes in a defined fashion. Phenotypes derived from such constructs allow screens for modifiers, thereby expanding the known set of genes that contribute to a pathway (Brand and Perrimon 1993; Rorth 1996). For example, by targeting the wing margin and eye, these methods were used to identify novel genes that contribute to the Notch pathway, a major signaling system of metazoans (Hall ; Alexander ; Kankel ; Shalaby ). These screens, among others (Mummery-Widmer , Yatim ), have revealed a wide network of loci that impinge on Notch signaling at numerous levels. One identified locus named (), originally linked to hematopoiesis and homeotic gene repression (Braun , Ruhf ), also interacts genetically with Notch during wing margin formation (Hall ). Subsequent studies further elaborated ’s role in Notch pathway regulation (Eissenberg ; Gause ) and other processes including exchange of phosphorylated histone H2Av as part of the Tip60 acetyltransferase complex (Kusch ), germline and somatic stem cell self-renewal (Xi and Xie 2005), and repression of E2F responsive loci (Lu ). The gene sequence predicts two major proteins of the SWI2/SNF2 class of DNA-dependent ATPases, implicating in gene regulation at the level of chromatin modification/nucleosome remodeling (Ruhf ). Dom proteins are widely expressed in embryos and imaginal discs, and the sequence is highly conserved (Ruhf ; Kusch ; Eissenberg ). Moreover, alleles of result in larval or pupal lethality (Ruhf ). We reasoned that a multifunctional chromatin remodeling protein that acts at the wing margin would be a practical choice for a targeted genetic modifier screen. Genetic changes that interact with a -associated wing phenotype should allow a sensitive screen for genes functioning with, or regulated by Dom. Therefore, we constructed a strain that expresses RNAi directed against transcripts at the wing margin. This strain shows a dominant wing phenotype that can be modified through changes in expression of loci known to interact with . Using this strain in a transposon-based genetic screen we obtained several classes of modifier, including those encoding transcription factors, RNA-binding proteins, and several proteins associated with growth regulation and autophagy. These modifiers link Dom function to cell proliferation, as suggested by others (Braun ; Ruhf ; Lu ). Thus, this preliminary screen for modifiers of a wing phenotype indicates that it is a reliable method to further dissect function.

Materials and Methods

Drosophila strains

Strains were obtained from the following laboratories: C96-GAL4 (G. Boulianne, University of Toronto, Toronto, ON, Canada), blk-GAL4 l (M. Hoffman, University of Wisconsin, Madison, WI), vg-GAL4, pnr-GAL4, nd, UAS-N (activated Notch, weakly expressing strain, S. Artavanis-Tsakonas, Harvard Medical School, Boston, MA), UAS-Wdb (J. Jia, University of Kentucky, Lexington, Kentucky), pumilio (H. Lin, Yale University, New Haven, CT), atg1 = Unc51 and UAS-Unc51(8) (T. Tomoda, Beckman Research Institute, Duarte, CA), ptc-GAL4, Delta (M. Muskavitch, Boston College, Chestnut Hill, MA), mam (J. Campos-Ortega, deceased), dom RNAi (3) and UAS-DomB (M. Ruhf, University of Cincinnati, Cincinnati, OH), (Exelixis, San Francisco, CA), cyclin E and UAS-Rbf-280 (K. Moberg, Emory University, Atlanta, GA). C96-MamH was described previously (Helms ). The following strains were obtained from the Bloomington (BL) Stock Center: (5358), y; Ki (4368), y; P{lacW}dom (10767), y; dom (9260), y; dom, (9261), sno (8745), y; P{TRiP.JF01502}attP2 dom (31054), y; P{EPgy2}lilli (20719), EcR (4894), lilli (5726), y; P{EPgy2}emc, Sb (20124); emc[D] rho[ve-1] rs[2] st[1] bul[D]/TM1(1032), w[*]; lola[ORE119]/CyO (28284), y; P{UAST-YFP.RabX1.T19N}Pabp2 (9838), y; (17412), ; /TM6B, (8707), w*; P{UASp-YFP.Rab30.T21N}PP2A wdb (9813), w*; P{UASp-YFP.Rab9Fb.D66L}PP2A wdb/TM3, (9844), y; P{TRiP.JF02897}attP2 atg6 (28060), y; P{TRiP.JF02787}attP2 atg7 (27707), y; P{TRiP.JF02895}attP2 e* atg8A /TM3, (28989), y; P{TRiP.JF02706}attP2 atg8B (27554), y; P{TRiP.JF02704}attP2 atg12 (27552), y; P{TRiP.JF02891}attP2 atg9 (28055), y; P{TRiP.JF02703}attP2 atg5 (27551), y; P{TRiP.JF03003}attP2 atg4 (28367), y; P{TRiP.JF02786}attP2 atg2 (27706), y; P{TRiP.JF02898}attP2 atg18 (28061), y; PP2A (28939), tara (6403), y; P{TRiP.JF03141}attP2/TM3, PP2A (28714), sc* ; PP2A wrd (30512), y; PP2A (27723), y; PP2A 29B (29384), y; P{TRiP.HM04075}attP2 CK1 (31763), and w*; (26274). cn(Pc) (3056), y; P{lacW}MRG15, (10290), ; P{SUPor-P}Nipped-A (16514), y; P{EPgy2}rept, Sb (21384), y; P{TRiP.HM05049}attP2 Tip60 (28563).

Construction of UAS-domR plasmid

The forward primer GGGAGTCCGATGGTGAGTTA and reverse primer ACTTGCGCTCATTCATTGTG were used to amplify a 1057-bp segment of genomic DNA from the locus (genomic position 17215713–17216769). This segment spanned the 3′ end of exon 5, intron 5, and most of exon 6 (Ruhf ) and was chosen to minimize nucleotide similarities to other genomic regions. The PCR product was cloned into pCR2.1 (Invitrogen) and then subcloned into SympUAST-w (Giordano ). The resulting plasmid UAS-domR was transformed into the germline by Genetic Services, Inc. Chromosome 3 inserts of UAS-domR and C96-GAL4 were recombined to create the C96-domR/TM3 Sb strain. The C96-GAL4 driver expresses across the dorsal-ventral wing margin of third-instar larvae (Gustafson and Boulianne 1996; Helms ). The C96-domR chromosome is associated with a dominant but partially penetrant wing nicking phenotype described in Results.

Generation of EP transpositions and scoring for modifiers

Mobilization of the X chromosome-linked EP55 element via the transposase P[ry+ Δ2-3] Ki (99B) was described in detail previously (Kazemi-Esfarjani and Benzer 2000; Alexander ). After introduction of the transposase into w males, 3 males were mated in a vial with 5 white-eyed () females, which are homozygous for w on the X chromosomes. Any male offspring from this cross exhibiting red eyes must have a transposition of the element from the X chromosome to an autosome or rarely to the Y chromosome. Non flies with nonmottled red eyes were selected to eliminate the transposase and stabilize the insertion. Only a single transposition male from each vial was analyzed. Each male carrying a transposition was mated to C96-domR/TM3 Sb females, and progeny were scored for enhancement or suppression of the wing nicking phenotype. Modifiers were retested by crossing once again to C96-domR, then outcrossed to a balancer strain, and made homozygous or balanced in the case of recessive lethals. A subset of modifiers was mated to candidate mutations, including the Notch pathway loci and Delta. In some cases, modifiers were also mated with deficiencies covering P element hotspots to eliminate multiple alleles. Modifiers were also crossed with the C96-GAL4 strain to rule out wing effects that were independent of RNAi. All modifiers described here exhibited no phenotypes with this control cross. Likewise, we did not observe significant interaction of the modifiers with a strain exhibiting a GAL4-driven eye phenotype, suggesting that the modifiers were not selected based on a strictly GAL4-dependent effect. EP modifiers were scored as enhancers or suppressors of C96-domR based on the penetrance of wing nicking relative to that of the control crosses, rather than the severity of wing blade loss or nicking. Crosses of C96-domR to produce a 57% penetrant phenotype (57% of wings exhibit at least one anterior margin nick). Each EP test against C96-domR included controls, and wing nicking percentages were normalized to the 57% control value between experiments. For the twelve EP lines described here, the differences in penetrance between C96-domR and that of were highly significant (P < 0.001, chi-square test) (Table 2).
Table 2

Characterization of modifier alleles

EP#GeneInsertion Site (position)MutationC96-domRN Wings ScoredC96-MamHN Wings Scored
425taraIntron (12075314)LOFS (5%)414S+92
558pabp2Exon (4019484)LOFE (88%)312E100
573Lk6Intron (7585856)LOFE (68%)1023S206
593Tudor-SNUpstream (264378)GOFE (74%)426ne288
939EcRIntron (2007989)LOFE (88%)336E110
1000lolaNot DeterminedLOFE (91%)251E+100
1037wdbIntron (23402526)GOFS (20%)368S+98
1202atg1Exon (12798085)LOFS (0%)338S+90
1538lolaIntron (6421948)LOFE (91%)330E+86
1561emcUpstream (749363)GOFE (85%)240S+130
1630lilliIntron (2900668)GOFE (81%)378E+194
1646pumIntron (4983814)LOFE (70%)250E+130

The percentage of wing nicking is shown for crosses of C96-domR to EP modifiers in column labeled C96-domR. All wing nicking differences were highly significant (P < 0.001, chi-square test relative to w control; 57%, Table 1). All EP tests included w controls, and wing nicking percentages were normalized to 57% control value between experiments. EP 1000 was determined to be an allele of lola through a complementation test. The C96-MamH genotype produces 100% wing nicking when outcrossed to w control. Among this control class we determined the percent of wings with weak, moderate, and strong effects including extent of nicks and blade loss. We then compared the distribution of severity in the EP cross progeny to determine if there was suppression (S), strong suppression (S+), enhancement (E), strong enhancement (E+) or no effect (ne); these data are presented in column labeled C96-MamH. GOF, gain of function; LOF, loss of function.

Generation of dom revertant

w is a recessive lethal, P element-induced allele of that does not complement the dom or allele. w was mobilized with transposase and − revertants isolated. Each revertant was assayed for restoration of function through crosses to dom and . w complemented both alleles.

Identification of genomic sequence flanking EPs through inverse PCR

Procedures for the isolation of genomic DNA, restriction digestion, ligation, and inverse PCR were derived from the BDGP Website (http://www.fruitfly.org/about/methods/inverse.pcr.html). PCR products were purified with a QIAquick column (Qiagen), quantified on gels, and sequenced commercially by Macrogen. Sequence data were analyzed via FlyBlast (http://flybase.net/blast), and the EP UAS-driver oriented to genomic sequences by using the FlyBase Genome Browser.

Antibody staining of third instar larval wing discs

The following protocol (Brennan ) was followed for the fixation, staining, and washing of imaginal discs. Discs were dissected in 0.1 M sodium phosphate buffer (pH 7.4), fixed (2% paraformaldehyde, 75 mM lysine, 0.25% sodium periodate, 50 mM sodium phosphate pH 7.4) for 45 min, and washed (0.1 M sodium phosphate, 0.1% Triton X-100, pH 7.4). They were blocked in wash buffer containing 10% normal goat serum (NGS) and incubated with primary antiserum for 60 min at 37°. The discs were then washed twice, blocked, and incubated with secondary antibodies overnight at 4°. After three final washes, the discs were mounted in Slowfade (Molecular Probes). Images were obtained using an MRC 1024 model confocal microscope (Bio-Rad) and assembled with Photoshop software (Adobe). The following antibodies and dilutions were used: Wg (1:20 dilution, mouse monoclonal; Developmental Studies Hybridoma Bank), Cut (1:20 dilution, mouse monoclonal; Developmental Studies Hybridoma Bank). Alexa 488 secondary antibodies were obtained from Invitrogen and used at a dilution of 1:200). Discs derived from and larvae were selected opposite a green fluorescent protein (GFP)-marked balancer.

Mounting of wings

Wings were dehydrated in isopropanol, mounted in Euparol, and photographed under a dissecting microscope (Hall ).

Results

Generation of a domino RNAi-based dominant wing phenotype

We cloned a segment of (Ruhf ) into a modified pUAST vector (sympUAST) to allow symmetrical transcription of sequences cloned in between two sets of UAS (Giordano ). The targeted sequence (see Materials and Methods ) is common to both major transcripts (Ruhf ) and was selected to minimize matches to other genomic sites, as well as CAN repeats (Ma ). We crossed transformants of the sympUAST construct (domR) with a panel of GAL4 lines that drive expression in various imaginal tissues. As shown in Figure 1, the domR construct elicits prominent phenotypic effects when driven in the wing, head, notum, and legs (Figure 1, F–J) compared to the controls (Figure 1, A–E) expressing GAL4 alone. Wing nicking via vg-GAL4 is consistent with our identification of as a Notch modifier (Hall ). These data are also consistent with the reported expression of in imaginal discs (Ruhf ).
Figure 1

GAL4-driven dom-RNAi construct produces adult phenotypes. (A–E) Control tissues derived from crosses of GAL4 lines to w; (F–J) results when the same GAL4 lines were crossed with the UAS-domR RNAi construct. (A and F) vg-GAL4 wing nicks; (B and G) ptc-GAL4 loss of anterior crossvein (arrow); (C and H) ptc-GAL4 loss of head bristles and fusion of ocelli (arrow); (D and I) pnr-GAL4 notum fusion incomplete; (E and J) blk-GAL4 loss of distal leg segments.

GAL4-driven dom-RNAi construct produces adult phenotypes. (A–E) Control tissues derived from crosses of GAL4 lines to w; (F–J) results when the same GAL4 lines were crossed with the UAS-domR RNAi construct. (A and F) vg-GAL4 wing nicks; (B and G) ptc-GAL4 loss of anterior crossvein (arrow); (C and H) ptc-GAL4 loss of head bristles and fusion of ocelli (arrow); (D and I) pnr-GAL4 notum fusion incomplete; (E and J) blk-GAL4 loss of distal leg segments. We also observed domR wing effects when driven with C96-GAL4 (Helms ), though to a lesser extent than with vg-GAL4. C96-GAL4 and domR transgenes were recombined on chromosome 3 (C96-domR) to perform genetic tests (Figure 2). The predominant effects in C96-domR heterozygotes occur along the anterior margin, whereas effects are widespread in homozygotes (Figure 2, B and C). We assayed the wing margin protein markers Cut and Wg (Helms ) in wing discs and observed minor stain depressions in heterozygotes (Figure 2, E and H) and substantial loss of staining in homozygotes (Figure 2, F and I).
Figure 2

dom RNAi expression affects wing margin formation. Panels show wings or wing imaginal discs stained for Cut or Wg from w (A, D, and G); C96-domR heterozygotes (B, E, and H); and C96-domR homozygotes (C, F, and I). C96-domR is a recombinant chromosome containing both C96-GAL4 and UAS-domR RNAi transgenes.

dom RNAi expression affects wing margin formation. Panels show wings or wing imaginal discs stained for Cut or Wg from w (A, D, and G); C96-domR heterozygotes (B, E, and H); and C96-domR homozygotes (C, F, and I). C96-domR is a recombinant chromosome containing both C96-GAL4 and UAS-domR RNAi transgenes. We also measured the effectiveness of domR relative to that of canonical loss-of-function (LOF) alleles in down-regulating the Cut protein. The weak allele is less severe than the moderate allele (Ruhf ; and see Table 1), and neither allele produces a wing phenotype as a heterozygote after outcross to (data not shown). As expected, transheterozygotes of C96-domR with show a weaker phenotype than transheterozygotes of C96-domR with (Figure 3, A and B). Staining of wing discs for these transheterozygotes reveals depressions in Cut expression, especially in sections of the future anterior margin (Figure 3, C and D). Homozygotes for and survive as larvae (Figure 3, E and F) and show wing margin levels of Cut that are higher than the transheterozygotes of C96-domR. Thus, one copy of the C96-domR construct appears to diminish function to a greater extent than these canonical alleles of , using Cut expression as the measure.
Table 1

Validation C96-domR RNAi phenotype

Tester Genotype% of Nicked WingsN Wings Scored
w111857%1756
dom184%492
dom398%140
dom972%116
dom237181%296
dom2371rev59%318
UAS-DomB20%644
dom RNAi 379%1139
dom RNAi TRiP76%939

Tester genotypes are transheterozygous for C96-domR chromosome. The dom revertant combined with C96-domR does not show wing nicking at a significantly higher frequency (59%) than w control combined with C96-domR (57%; P = 0.63, chi-square test). All remaining genotypes were highly significant (P < 0.001).

Figure 3

Effects of domR relative to canonical dom alleles. (A and C) Adult wing and wing disc derived from dom/+; C96-domR/+ heterozygotes. (B and D) Same, derived from dom/+; C96-domR/+ heterozygotes. Arrows show future anterior wing margin with gaps in staining. (E and F) Wing disc tissues from dom homozygotes and dom homozygotes, respectively. Wing discs were stained for Cut expression.

Tester genotypes are transheterozygous for C96-domR chromosome. The dom revertant combined with C96-domR does not show wing nicking at a significantly higher frequency (59%) than w control combined with C96-domR (57%; P = 0.63, chi-square test). All remaining genotypes were highly significant (P < 0.001). Effects of domR relative to canonical dom alleles. (A and C) Adult wing and wing disc derived from dom/+; C96-domR/+ heterozygotes. (B and D) Same, derived from dom/+; C96-domR/+ heterozygotes. Arrows show future anterior wing margin with gaps in staining. (E and F) Wing disc tissues from dom homozygotes and dom homozygotes, respectively. Wing discs were stained for Cut expression.

Validation of dom RNAi Effects

To validate domR RNAi effects (Ma ; Perrimon and Mathey-Prevot 2007) we performed a series of genetic tests (Table 1). The table shows the percent nicked wings in genotypes heterozygous for the C96-domR construct and various test chromosomes, including a control. C96-domR/w heterozygotes exhibit a 57% penetrant wing nicking effect (57% of wings show at least one anterior nick). When transheterozygous with strong or moderate LOF alleles for the penetrance rises, for example, dom (84%) and (98%), whereas less enhancement is evident with a weak allele, for example, (72%), that derives from the identical genetic background as dom and . The P element insertion allele dom also exhibits strong enhancement (81%), whereas a dom revertant chromosome (dom) eliminates the enhancement (59%). Moreover, when the normal Dom B (UAS-DomB) protein, which is highly expressed in imaginal discs (Ruhf ), is driven along with C96-domR, significant rescue is observed, as the penetrance of wing nicking drops to 20%. We also examined two independent RNAi constructs for enhancement of the C96-domR phenotype (dom RNAi 3 and dom RNAi TRiP), and both constructs produced significant enhancement. These data demonstrate that the C96-domR RNAi wing phenotype responds as expected to loss- or gain-of-function (GOF) for , verifying its effect on function. We also tested C96-domR for other predicted genetic interactions. Prior studies (Hall ; Eissenberg ) and Cut and Wg expression data (Figures 2 and 3) predict an effect on . Likewise, an interaction is predicted for LOF in loci encoding components of the Tip60 acetyltransferase complex, because Dom is a member of that complex (Kusch ). Alleles of canonical Notch pathway loci (Delta, , and ) and (Figure 4, F–I) exhibit strong phenotypic enhancement of C96-domR relative to that of wings from outcrosses to (Figure 4, A–D). Similarly, LOF for generated through RNAi exhibits no phenotype (Figure 4E). However, RNAi coexpression leads to strong enhancement of the C96-domR wing margin phenotype (Figure 4J). We tested mutations in several other loci that encode Tip60 complex components (Kusch ) and observed a significant increase in wing nicking penetrance (P < 0.01) for alleles of E(), , TRA1, and . Although the effects were not as strong as for , these data further validate the domR phenotype and also demonstrate that Tip60 complex components function at the wing margin.
Figure 4

dom RNAi expression modifies Notch pathway and Tip60 mutation phenotypes. (A–D) Wings from heterozygotes or hemizygotes for alleles of the Notch pathway loci. (A) Delta (Dl/+); (B) notchoid (nd/Y); (C) strawberry notch (sno/Y); and (D) mastermind (mam/+), each exhibits minor wing phenotypes. (F–I) When these genotypes were combined with C96-domR, the phenotypes exhibited significant enhancement: (F) Dl/C96-domR; (G) nd/Y; C96-domR/+; (H) sno /Y; C96-domR/+; and (I) mam/+; C96-domR/+. (E) Wings from flies expressing UAS-Tip60 RNAi across the margin under C96-GAL4 regulation exhibit a wild-type phenotype. (J) When the UAS-Tip60 RNAi construct is combined with C96-domR, very strong enhancement of the C96-domR wing phenotype is apparent.

dom RNAi expression modifies Notch pathway and Tip60 mutation phenotypes. (A–D) Wings from heterozygotes or hemizygotes for alleles of the Notch pathway loci. (A) Delta (Dl/+); (B) notchoid (nd/Y); (C) strawberry notch (sno/Y); and (D) mastermind (mam/+), each exhibits minor wing phenotypes. (F–I) When these genotypes were combined with C96-domR, the phenotypes exhibited significant enhancement: (F) Dl/C96-domR; (G) nd/Y; C96-domR/+; (H) sno /Y; C96-domR/+; and (I) mam/+; C96-domR/+. (E) Wings from flies expressing UAS-Tip60 RNAi across the margin under C96-GAL4 regulation exhibit a wild-type phenotype. (J) When the UAS-Tip60 RNAi construct is combined with C96-domR, very strong enhancement of the C96-domR wing phenotype is apparent.

Screen for dom modifiers

C96-domR heterozygosity creates a dominant but hypomorphic condition appropriate for genetic screening (Figure 2). We performed a screen for modifiers of this phenotype through mobilization of EP, a P transposon that creates both overexpression and LOF alleles (Rorth 1996; Thibault ). EP elements were mobilized, and each insertion was tested for phenotypic effects when combined with C96-domR. The C96-GAL4 element within C96-domR drives both RNAi and the sequence downstream of the EP insertion, potentially creating a modifier effect (Figure 5). For example, the wing phenotype of C96-domR/ (Figure 5F) can be either suppressed by overexpression of a normal Dom product (Figure 5A) or enhanced by a LOF allele (Figure 5B). Thus, the C96-domR wing phenotype allows detection of enhancers and suppressors. Figure 5, C and D, shows two modifiers from the screen, an enhancer (EP558) and a suppressor (EP1202).
Figure 5

dom modifier screen. (E) shows the recombinant chromosome C96-domR containing the C96-GAL4 and UAS-domR transgenes. It produces the weak wing nicking phenotype shown in (F; penetrance of ∼57%). (A and B) Controls demonstrating that the wing phenotype is affected by changes in the level of wild-type Dom expression, either through GAL4 coexpression of a wild-type Dom construct [UAS-DomB (A)] or through a LOF allele [dom (B)], as described in the text. The EP screen involves testing individual EP insertion chromosomes as transheterozygotes with C96-domR (E). In these genotypes, C96-GAL4 can drive both UAS-domR and a random sequence if the EP insertion is oriented appropriately. The EP element also generates LOF alleles. Wing modifications, such as enhancement [EP558 (C), 88% penetrance and increased severity] or suppression [EP1202 (D), 0% penetrance, total suppression] are scored.

dom modifier screen. (E) shows the recombinant chromosome C96-domR containing the C96-GAL4 and UAS-domR transgenes. It produces the weak wing nicking phenotype shown in (F; penetrance of ∼57%). (A and B) Controls demonstrating that the wing phenotype is affected by changes in the level of wild-type Dom expression, either through GAL4 coexpression of a wild-type Dom construct [UAS-DomB (A)] or through a LOF allele [dom (B)], as described in the text. The EP screen involves testing individual EP insertion chromosomes as transheterozygotes with C96-domR (E). In these genotypes, C96-GAL4 can drive both UAS-domR and a random sequence if the EP insertion is oriented appropriately. The EP element also generates LOF alleles. Wing modifications, such as enhancement [EP558 (C), 88% penetrance and increased severity] or suppression [EP1202 (D), 0% penetrance, total suppression] are scored. We tested 2500 transpositions and focused on 12, 9 enhancers and 3 suppressors (Table 2). Several additional modifiers were identified through complementation tests as canonical Notch pathway components and not characterized further. None of the EP strains exhibits a wing phenotype alone or when crossed with C96-GAL4. This demonstrates that phenotypes derive from a synergistic interaction due to expression of RNAi and consequent loss of function. Inverse PCR and DNA sequencing were performed to identify the most proximal locus and determine the EP orientation relative to the coding region. Predicted overexpression (GOF) or insertional knockout (LOF) effects are shown in Table 2. One suppressor and three enhancers are oriented for a GOF effect. Table 2 lists these modifiers along with the affected loci, sites of insertion, and effects on the penetrance of the C96-domR phenotype. We validated the genetic interactions of C96-domR with independent alleles of the targeted loci. These alleles were either GOF or LOF, matching the predicted nature of the EP modifier. As shown in Table 3, C96-domR exhibits parallel genetic interactions with these strains and the original EPs. Figure 6 shows representative wings from C96-domR as transheterozygotes with the 12 EP insertions.
Table 3

Corroboration of EP insertion alleles

EP#Corroborating AlleleC96-domR (% of Nicking)N Wings Scored
425tara1S (6%)300
558pabp201E (96%)361
573LK62E (95%)594
593P(EPg42)Tudor-SNEy07875E (79%)736
939EcRM554fsE (81%)144
1000lolaORE119E (97%)114
1037UAS-WdbS (48%)620
1202unc513 (atg1)S (36%)1126
1538lolaORE119E (97%)114
1561P{EPgy2}emcEY01657E (83%)262
1630P{EPgy2}lilliEY11976E (100%)283
16461(3)pum01688E (90%)392

The interaction between the corroborating allele for each EP and C96-domR is as described for Table 2. All wing nicking differences vs. w control (57%) were highly significant (P < 0.001, chi-square test). For the GOF alleles EPs 1630, 1561, 593, and 1037, we corroborated with overexpression strains. E, enhancement; S, suppression.

Figure 6

EP modifier effects on C96-domR wing phenotypes. Wing mounts were prepared from crosses of the C96-domR strain with the following EP modifiers: (A) EP 425 (tara); (B) EP 558 (pabp2); (C) EP 573 (Lk6); (D) EP 593 (Tudor-SN); (E) EP 939 (EcR); (F) EP 1000 (lola); (G) EP 1037 (wdb); (H) EP 1202 (atg1); (I) EP 1538 (lola); (J) EP 1561 (emc); (K) EP 1630 (lilli); (L) EP 1646 (pum). Note that the EPs are classified as enhancers or suppressors based upon the penetrance of wing nicking relative to that of w control crosses to C96-domR, rather than the severity of wing blade loss or nicking (see Materials and Methods). These data are summarized in Table 2.

The percentage of wing nicking is shown for crosses of C96-domR to EP modifiers in column labeled C96-domR. All wing nicking differences were highly significant (P < 0.001, chi-square test relative to w control; 57%, Table 1). All EP tests included w controls, and wing nicking percentages were normalized to 57% control value between experiments. EP 1000 was determined to be an allele of lola through a complementation test. The C96-MamH genotype produces 100% wing nicking when outcrossed to w control. Among this control class we determined the percent of wings with weak, moderate, and strong effects including extent of nicks and blade loss. We then compared the distribution of severity in the EP cross progeny to determine if there was suppression (S), strong suppression (S+), enhancement (E), strong enhancement (E+) or no effect (ne); these data are presented in column labeled C96-MamH. GOF, gain of function; LOF, loss of function. The interaction between the corroborating allele for each EP and C96-domR is as described for Table 2. All wing nicking differences vs. w control (57%) were highly significant (P < 0.001, chi-square test). For the GOF alleles EPs 1630, 1561, 593, and 1037, we corroborated with overexpression strains. E, enhancement; S, suppression. EP modifier effects on C96-domR wing phenotypes. Wing mounts were prepared from crosses of the C96-domR strain with the following EP modifiers: (A) EP 425 (tara); (B) EP 558 (pabp2); (C) EP 573 (Lk6); (D) EP 593 (Tudor-SN); (E) EP 939 (EcR); (F) EP 1000 (lola); (G) EP 1037 (wdb); (H) EP 1202 (atg1); (I) EP 1538 (lola); (J) EP 1561 (emc); (K) EP 1630 (lilli); (L) EP 1646 (pum). Note that the EPs are classified as enhancers or suppressors based upon the penetrance of wing nicking relative to that of w control crosses to C96-domR, rather than the severity of wing blade loss or nicking (see Materials and Methods). These data are summarized in Table 2. The 12 modifiers encode three classes of functions. The first two classes include transcription factors [ (), lilliputian (), (), Ecdysone Receptor (), and extramacrochaete ()] and proteins that regulate RNA function, including (), polyA binding protein 2 (pabp2), and . Members of both classes have been associated with wing formation and/or Notch signaling previously (Kankel ; Shalaby ). The third class encodes proteins linked to cell growth and autophagy pathways, and includes the Ser/Thr protein phosphatase (PP2A) regulator (; Vereshchagina ), the protein kinase (Arquier ), and atg1, a regulator of autophagy, which is a lysosomal degradation pathway that affects cell growth (Zirin and Perrimon 2010). Table 2 also summarizes interactions between the EP modifiers and a strain that drives truncated Mastermind across the wing margin (C96-MamH), which creates a Notch pathway LOF phenotype. Expression of truncated Mastermind has been shown to depress Notch signaling in multiple contexts including the wing margin (Helms ), where it leads to a 100% penetrant nicking phenotype. Most of the EP strains exhibit similar interactions between C96-domR and C96-MamH as enhancers or suppressors, as expected. However, for the case of the C96-domR enhancer EP 1561 () there was strong suppression of C96-MamH. This was validated with the canonical GOF allele (), which also suppressed, and two LOF alleles, which enhanced (data not shown). The C96-domR enhancer EP 573 () slightly suppressed C96-MamH. However, the LOF allele enhanced C96-MamH, matching its effect on C96-domR. The C96-domR enhancer strain EP 593 () did not affect C96-MamH, possibly reflecting activity directed at RNAi processing (see Discussion).

dom wing phenotype is sensitive to changes in growth and autophagy loci

The atg1 (unc51) gene regulates autophagy and growth pathways in numerous organisms including Drosophila (Zirin and Perrimon 2010). The EP 1202 (atg1) modifier allele, as well as its corroborating unc51 allele (Toda ), each behave as strong suppressors of C96-domR (Tables 2 and 3), indicating a link of function to these processes. Likewise, the EP 573 allele of and the corroborating allele (Tables 2 and 3) are both strong enhancers of the C96-domR phenotype. Lk6 is related to mammalian kinases that regulate cell growth and division (Arquier ). Finally, EP 1037 and the corroborating GOF UAS-Wdb strain are suppressors of C96-domR (Tables 2 and 3). Wdb, a regulatory subunit of PP2A has been associated with both cell growth regulation and autophagy (Arquier , Vereshchagina ; Banreti ). The isolation of three modifiers associated with these processes suggested that loss of function may enrich for this class of loci. Table 4 shows data from crosses of C96-domR with strains expressing RNAi directed against 10 different autophagy pathway loci, as well as one strain that overexpresses the normal atg1 product. Seven of the 10 assayed atg genes enhance the C96-domR wing phenotype when their function is depressed, indicating that normal autophagy activity can limit wing margin loss derived from depressed function (atg6, atg7, atg8A, atg8B, atg12, atg9, and atg5). Three RNAi strains, atg2, atg4 , and atg18 , do not show a significant effect, and these loci encode various functions within the autophagy pathway (Chang and Neufeld 2010). It is possible that these strains do not effectively down-regulate their target loci or that, alternatively, there may be genetic redundancy for certain loci. The enhancement effect of multiple atg RNAi strains contrasts with the atg1 effect, where LOF was observed to suppress C96-domR (Tables 2 and 3). Moreover, overexpression of atg1 across the wing margin strongly enhances the wing phenotype (Table 4), consistent with the LOF suppression effect. The differential effects of atg1 vs. other atg genes likely reflect the additional roles of atg1 in translational efficiency and growth regulation (Lee ), beyond its role in autophagy regulation (see Discussion).
Table 4

Additional genetic interactions of dom

GenotypeC96-domR (% of Nicking)N Wings Scored
UAS- atg1 (Unc51)E (86%)322
atg6, TRiPE (82%)2074
atg7, TRiPE (75%)1724
atg8A, TRiPE (73%)1645
atg8B, TRiPE (78%)2227
atg12, TRiPE (73%)2147
atg9, TRiPE (72%)1520
atg5, TRiPE (63%)1773
atg4, TRiPne (58%)2049
atg2, TRiPne (58%)1736
atg18, TRiPne (55%)1845
PP2A wdb7 RegulatoryE (70%)638
PP2A wdb, TRiP RegulatoryE (91%)236
PP2A tws, TRiP RegulatoryE (83%)1021
PP2A wrd, TRiP RegulatoryE (68%)1748
PP2A mts, TRiP CatalyticaE (100%)478
PP2A 29B, TRiP ScaffoldaE (100%)350
CK1, UAS-dcoK4E (90%)1028
CK1, dco TRiPS (40%)1390

Column labeled C96-domR shows the percentage of wing nicking from crosses of C96-domR to listed genotypes. All genotypes are UAS-regulated except for wdb. The interaction between these genotypes and C96-domR is as described for Table 2. All wing nicking differences were highly significant (P < 0.001, chi-square test), except for those labeled ne (no effect). Regulatory, catalytic and scaffold indicate the encoded function within the PP2A phosphatase complex. E, enhancer; S, suppressor.

These strains exhibited wing nicking at high penetrance with control crosses to C96-GAL4; all other UAS strains showed normal wings in the control cross.

Column labeled C96-domR shows the percentage of wing nicking from crosses of C96-domR to listed genotypes. All genotypes are UAS-regulated except for wdb. The interaction between these genotypes and C96-domR is as described for Table 2. All wing nicking differences were highly significant (P < 0.001, chi-square test), except for those labeled ne (no effect). Regulatory, catalytic and scaffold indicate the encoded function within the PP2A phosphatase complex. E, enhancer; S, suppressor. These strains exhibited wing nicking at high penetrance with control crosses to C96-GAL4; all other UAS strains showed normal wings in the control cross. The EP 1037 and corroborating UAS-Wdb strains appear to suppress C96-domR through overexpression of Wdb, a regulatory subunit of the PP2A phosphatase (Tables 2 and 3). We examined other strains with LOF for either or other regulatory, scaffold and catalytic subunits of the PP2A complex, and observed enhancement of C96-domR (Table 4). This is consistent with the suppression derived from Wdb overexpression. These data predict that a class of Ser/Thr kinases may act antagonistically to PP2A phosphatase. Casein kinase 1 (Ck1) overexpression strongly enhances the C96-domR wing phenotype, whereas LOF suppresses (Table 4). These effects are opposite to those derived from alterations in PP2A phosphatase. PP2A and CK1 have been shown to act antagonistically in other developmental contexts (Jia ).

dom and its modifiers interact genetically with a proliferation-defective genotype

Dom has been implicated in the regulation of cell proliferation (Braun ; Lu ). Therefore, we generated a strain with a dominant proliferation-defective phenotype at the wing margin, and tested for genetic interaction with C96-domR and its modifiers. The test utilizes a mutated version of the Rbf protein (Rbf-280), where four Cdk phosphorylation sites have been inactivated. This results in a constitutively active form of Rbf that blocks growth and proliferation in wing tissue (Xin ). We found that when UAS-Rbf280 is driven by C96-GAL4 at the margin (C96+Rbf280), it elicits a dominant, partially penetrant wing nicking phenotype and loss of a subset of anterior margin bristles (Figure 7A). As predicted for a proliferation defect, this phenotype is enhanced by a mutation in cycE and suppressed by overexpression of E2F (Figure 7, B and C). The combination of C96+Rbf280 with UAS-domR leads to enhanced penetrance and more severe loss of wing material (Figure 7D); enhancement was also observed with the canonical dom and alleles to a significant but lesser extent (data not shown).
Figure 7

Interactions of the C96+Rbf280 proliferation-defective genotype. In the descriptions below, numbers in parentheses indicate percentage of nicked wings and number of wings scored (N). (A) (30%, N = 440) shows that a constitutively active form of Rbf (Rbf-280) driven across the wing margin via C96-GAL4 (UAS-Rbf-280 + C96-GAL4/+, referred to here as C96+Rbf280) creates a partially penetrant, dominant wing nicking phenotype as a heterozygote with w. (B–O) Wings transheterozygous with C96+Rbf280. (B) (64%, N = 120) shows an enhanced wing phenotype via combination with cycE; (C) (18%, N = 86) shows partial rescue in combination with UAS-E2F. Both the UAS-domR RNAi transgene (D) (77%, N = 164) and the UAS-DomB transgene (E) (68%, N = 166) elicit strong enhancement. UAS-DomB did not elicit wing nicking in control crosses to C96-GAL4, data not shown (0%, N = 120). (F) (2%, N = 360) Nearly complete suppression of the wing phenotype by coexpression of an activated Notch construct, UAS-N, whereas depressed Notch signaling via UAS-MamH (G) (100%, N = 174) or the hemizygous viable nd allele (H) (100%, N = 274) strongly enhance. (I–O) C96+Rbf280 wings transheterozygous with EP modifiers from the screen: EP 425 tara (I) (10%, N = 124), EP 1202 atg1 (J) (2%, N = 56), EP 939 EcR (K) (92%, N = 52), EP 1630 lilli (L) (70%, N = 146), EP 1538 lola (M) (98%, N = 50), EP 1646 pum (N) (72%, N= 116), EP 558 pabp2 (O) (80%, N = 54). (P) (0%, N = 253) Complete suppression of the C96-domR wing nicking by coexpression of the activated Notch construct UAS-N. See Figure 2B legend for C96-domR wing phenotype. The penetrance of wing nicking in panels B–P is significantly different than w control crosses (P < 0.01, chi-square test).

Interactions of the C96+Rbf280 proliferation-defective genotype. In the descriptions below, numbers in parentheses indicate percentage of nicked wings and number of wings scored (N). (A) (30%, N = 440) shows that a constitutively active form of Rbf (Rbf-280) driven across the wing margin via C96-GAL4 (UAS-Rbf-280 + C96-GAL4/+, referred to here as C96+Rbf280) creates a partially penetrant, dominant wing nicking phenotype as a heterozygote with w. (B–O) Wings transheterozygous with C96+Rbf280. (B) (64%, N = 120) shows an enhanced wing phenotype via combination with cycE; (C) (18%, N = 86) shows partial rescue in combination with UAS-E2F. Both the UAS-domR RNAi transgene (D) (77%, N = 164) and the UAS-DomB transgene (E) (68%, N = 166) elicit strong enhancement. UAS-DomB did not elicit wing nicking in control crosses to C96-GAL4, data not shown (0%, N = 120). (F) (2%, N = 360) Nearly complete suppression of the wing phenotype by coexpression of an activated Notch construct, UAS-N, whereas depressed Notch signaling via UAS-MamH (G) (100%, N = 174) or the hemizygous viable nd allele (H) (100%, N = 274) strongly enhance. (I–O) C96+Rbf280 wings transheterozygous with EP modifiers from the screen: EP 425 tara (I) (10%, N = 124), EP 1202 atg1 (J) (2%, N = 56), EP 939 EcR (K) (92%, N = 52), EP 1630 lilli (L) (70%, N = 146), EP 1538 lola (M) (98%, N = 50), EP 1646 pum (N) (72%, N= 116), EP 558 pabp2 (O) (80%, N = 54). (P) (0%, N = 253) Complete suppression of the C96-domR wing nicking by coexpression of the activated Notch construct UAS-N. See Figure 2B legend for C96-domR wing phenotype. The penetrance of wing nicking in panels B–P is significantly different than w control crosses (P < 0.01, chi-square test). Paradoxically, we also observed C96+Rbf280 enhancement when Dom protein was overexpressed across the wing margin via the UAS-DomB transgene (Figure 7E). These results likely reflect pleiotropy of Dom function, because it is necessary for both Notch target expression (Figure 2) and repression of proliferation (Lu ). C96-domR RNAi-mediated down regulation of Notch signaling at the wing margin is predicted to depress proliferation (Baonza and Garcia-Bellido 2000; Ferres-Marco ) and thereby enhance the C96+Rbf280 phenotype. Consistent with this prediction, coexpression of activated Notch via UAS-N rescued nearly completely the C96+Rbf280 proliferation defect (Figure 7F); whereas depressions in Notch signaling strongly enhanced it (Figure 7, G and H). In contrast, Dom can also act as an inhibitor of cell proliferation through repression of E2F target genes (Lu ), and overexpression via UAS-DomB may act primarily by enhancing the cell proliferation-defective phenotype of C96+Rbf280. The effect of LOF on Notch signaling is also evident by complete rescue of the C96-domR phenotype through simultaneous expression of UAS-N (Figure 7P). Two of the C96-domR suppressors, EPs 425 () and 1202 (atg1), were found to be strong suppressors of C96+Rbf280 (Figure 7, I and J). Likewise, several of the C96-domR enhancers were also found to strongly enhance C96+Rbf280, including EPs 939 (), 1630 (), 1538 (), 1646 (), and 558 (pabp2) (Figure 7, K–O). The remaining modifiers showed much weaker interactions (data not shown).

Discussion

We have described a screen for loci that interact with at the wing margin. Based on the intersection of with Notch signaling, we expected to identify a broad array of loci, and most of the modifiers interact similarly with a strain defective in Notch signaling. Additionally, based on the association of both and with cell proliferation (Braun ; Baonza and Garcia-Bellido 2000; Ferres-Marco ; Lu ), it is not surprising that most of the modifiers have been linked to cell growth and division, and exhibit genetic interaction with a proliferation-defective genotype. Moreover, as LOF for has also been associated with cell death (Braun ), it is possible that this process also contributes to the phenotypes we describe here. Wing margin staining for key markers associated with cell death vs. cell cycling will be necessary to establish the basis for these effects. Nevertheless, the C96-domR phenotype appears pleiotropic, derived from effects on Notch signaling, growth, proliferation and likely other factors operating at the wing margin. Several modifiers encode transcription factors, such as , , and , which were identified in a prior screen targeted to the wing (Kankel ). Lilli, a protein of the fragile X/Burkitt’s lymphoma class (Su ), was also linked to wing margin formation by Bejarano . Tara, a member of the trithorax group, was isolated in a screen for modifiers of a homeotic phenotype (Calgaro ). functions opposite to with homeotic loci (Ruhf ; Calgaro ). Antagonism between and is consistent with our observation that loss of suppresses the wing nicking derived from loss of . The Tara protein shows sequence similarity to transcriptional regulators of cell cycle proteins (Calgaro ), and it is noteworthy that mutation also suppresses wing nicking associated with the proliferation-defective C96+Rbf280 strain (Figure 7C). Emc, a negative regulator of HLH transcription factors, has complex functions at the wing margin, affecting both cell proliferation and sensory organ formation (Baonza ). Thus, GOF for through EP 1561 may enhance margin effects through suppression of sensory bristle formation. Lola, related to the broad complex class of transcription factors is required for central nervous system development (Giniger ) and wing margin patterning through an interaction with (Krupp ). Lola has also been implicated in cell proliferation and oncogenesis through Notch-mediated repression of (Ferres-Marco ). Therefore, LOF alleles may derepress Rbf expression and inhibit cell proliferation. This is consistent with our observation that alleles enhance the C96-domR and C96+Rbf280 strains (Figures 6 and 7). Finally, ecdysone receptor (EcR) function is associated with sensory organ differentiation (Schubiger ), and Dom was identified as an EcR cofactor in cultured cells (Davis ). A second class of modifier encodes RNA regulatory proteins. Pabp2 regulates polyA tail length, and LOF of pabp2 is associated with aberrant levels of Cyclin B (Benoit ). Pumilio is an RNA-binding protein that mediates translational repression (Wharton ). Additionally, loss of Pumilio function has been associated with improper regulation of Cyclin B (Sonoda and Wharton 2001). Consistent with a cell cycle defect, EPs 558 (pabp2) and 1646 () strongly enhance the C96+Rbf280 wing phenotype (Figure 7). Tudor-SN has been implicated in transcription, processing, and RNA interference as a subunit of the RNA-induced silencing complex (Friberg ). The overexpression alleles EP 593 and P(EP)Tudor-SN (Tables 2 and 3) could act through enhanced production of RNAi. The observation that EP 593 does not modify C96-MamH or C96+Rbf280 phenotypes, which are both produced independently of RNAi, supports this idea. The third class of modifier links to antagonistic growth and autophagy pathways. During growth, the degradation of organelles and long-lived proteins associated with autophagy is suppressed through inactivation of Atg1, a serine/threonine kinase (Zirin and Perrimon 2010). In contrast, during conditions of cellular starvation or stress Atg1 is not suppressed. It is required for autophagy induction, thereby providing raw materials for cell survival. However, Atg1 has additional functions, including the down-regulation of growth through inactivation of S6 kinase. The S6 kinase normally phosphorylates ribosomal protein S6, and this activity is a hallmark of cell growth (Lee ). Thus, Atg1 functions at a key juncture, to both induce autophagy and prevent cell growth under conditions inappropriate for growth. Our data demonstrates that depressed atg1 function suppresses the C96-domR phenotype, whereas overexpression enhances it. Mutation of atg1 should lead to elevations in S6 kinase activity (Lee ) and increases in translation and cell division, and this could mediate the wing margin rescue we observe. Concomitantly, rescue derived from atg1 mutation should be associated with depressed autophagy induction. This atg1 effect would contradict our data on seven other atg loci, where LOF enhances the wing phenotype, rather than suppresses. The data from these seven loci suggest that normal levels of autophagy act to limit wing margin loss associated with C96-domR. This could occur, for example, if cells interpret loss as stress and launch autophagy as a response to provide the raw materials for repair. These conflicting data can be reconciled if, in the case of atg1 mutation, the resultant growth elevation is epistatic to effects of autophagy depression. During conditions favoring growth and cell division, autophagy may no longer be required for wing margin rescue. Our observation that EP 1202 (LOF atg1) suppresses the wing defects derived from both C96-domR and C96+Rbf280 favors this idea (Figures 6 and 7). The association of with atg mutations is consistent with an earlier report linking autophagy to Notch signaling in the wing (Thumm and Kadowaki 2001). Additional effects of loss on autophagy may contribute to the wing margin phenotype. Mammalian Tip60 protein, upon phosphorylation and activation by the GSK3 kinase, acetylates and activates Atg1 (ULK1) during autophagy induction (Lin ). This reveals a role for Tip60 acetyltransferase directly in autophagy regulation, rather than through genetic regulation. However, it is not known if this mechanism operates in Drosophila and, if it does, whether Dom or the remainder of the Tip60 complex also plays a role. A second link to growth and autophagy pathways derived from our screen was , which encodes a protein phosphatase (PP2A) regulatory subunit. Wdb regulates many functions, including protein kinase activity and growth (Vereshchagina ). Wdb was also implicated as a positive regulator of autophagy in Drosophila, targeting several Atg proteins (Banreti ). One of the postulated targets is Atg1, which has been shown to be a PP2A target in C. elegans (Ogura ). Alternatively, Wdb could covalently modify Dom protein and alter its activity. Wdb has been associated with Hedgehog signaling through dephosphorylation and down regulation of the cubitus interruptus protein (Jia ). That study showed opposite effects mediated by PP2A phosphatase vs. CK1 kinase, similar to our observations with the C96-domR phenotype (Table 4). Although we have no evidence supporting such modifications, the predicted Dom sequence contains consensus sites for CK1 phosphorylation (data not shown). Finally, we found that mutations in the locus affect the C96-domR phenotype (Tables 2 and 3). The Drosophila Lk6 protein is the functional homolog of mammalian Mnk kinases, which regulate the activity of translational initiation factor eIF4E and growth through phosphorylation. Mutation of has been associated with organismal growth depression and reduced wing size through reduced cell number (Arquier ). Contrasting effects of Lk6 on growth in Drosophila have also been reported, dependent on nutrient levels (Reiling ), indicating that regulation of Lk6 is sensitive to culture conditions. These links of to growth and autophagy are likely related to its effects on Notch signaling and cell proliferation, with some contribution due to a cell death effect also plausible. Our results (Figures 2 and 7), in conjunction with prior reports, indicate a Dom requirement for both Notch target expression and repression of cell proliferation (Hall ; Eissenberg ; Gause ; Lu ). Together, these results suggest a model where Dom contributes to positive regulation of Notch signaling, which in turn stimulates cell proliferation. Dom is subsequently involved in negative regulation of proliferation through repression of E2F-dependent loci. Although this model is consistent with most data, other work has implicated Dom as a positive effector during proliferation. Larvae homozygous for the most severe alleles were observed to be lacking imaginal discs and exhibited a reduction in brain neuroblasts (Ruhf ), and recently a study of larval tissues showed that Dom is required for expression of several cell cycle loci, including the cyclins E, B, B3, A, CDC2, and (Walker ). Additionally, Lu observed that Dom is resident at the promoter of numerous E2F target loci required for cell proliferation. However, contrary to its role in proliferation inhibition, they found that reduction of Dom levels is not associated with elevated expression of various S-phase loci, including cyclin E. An interesting possibility is that Dom functions at both inactive and active E2F target promoters, potentially contributing to a switch between negative and positive regulation of transcription and cell division. Notch signaling could contribute to the switch, in the same manner that the canonical pathway regulates targets such as E(spl) loci, through the displacement of a repression complex and recruitment of transcriptional activators (Lubman ). Under such circumstances, the phenotypic consequences of altered Dom levels could vary significantly, as previously observed (Braun ; Ruhf ; Lu ; Walker ). Additional biochemical assays of Dom and Notch function will be necessary to address such possibilities. In conclusion, we found that targeting LOF for to the wing margin created a sensitized genotype associated with a partially penetrant, dominant phenotype. This phenotype was scored for dosage-sensitive modifiers, allowing an efficient scan for other loci that function with . Our analysis demonstrated that modifiers are enriched for loci that contribute to the regulation of cell growth and proliferation, which is consistent with prior studies of function. This genetic system will facilitate screening for novel loci involved with growth regulatory mechanisms, and complement biochemical approaches to the same questions.
  52 in total

1.  Identification of genetic loci that interact with cut during Drosophila wing-margin development.

Authors:  Joshua J Krupp; Lauren E Yaich; Robert J Wessells; Rolf Bodmer
Journal:  Genetics       Date:  2005-06-14       Impact factor: 4.562

2.  Distinct expression patterns detected within individual tissues by the GAL4 enhancer trap technique.

Authors:  K Gustafson; G L Boulianne
Journal:  Genome       Date:  1996-02       Impact factor: 2.166

3.  Drosophila immunity: analysis of larval hemocytes by P-element-mediated enhancer trap.

Authors:  A Braun; B Lemaitre; R Lanot; D Zachary; M Meister
Journal:  Genetics       Date:  1997-10       Impact factor: 4.562

4.  A modular misexpression screen in Drosophila detecting tissue-specific phenotypes.

Authors:  P Rørth
Journal:  Proc Natl Acad Sci U S A       Date:  1996-10-29       Impact factor: 11.205

5.  Acetylation by Tip60 is required for selective histone variant exchange at DNA lesions.

Authors:  Thomas Kusch; Laurence Florens; W Hayes Macdonald; Selene K Swanson; Robert L Glaser; John R Yates; Susan M Abmayr; Michael P Washburn; Jerry L Workman
Journal:  Science       Date:  2004-11-04       Impact factor: 47.728

6.  Human SRCAP and Drosophila melanogaster DOM are homologs that function in the notch signaling pathway.

Authors:  Joel C Eissenberg; Madeline Wong; John C Chrivia
Journal:  Mol Cell Biol       Date:  2005-08       Impact factor: 4.272

7.  Drosophila Lk6 kinase controls phosphorylation of eukaryotic translation initiation factor 4E and promotes normal growth and development.

Authors:  Nathalie Arquier; Marc Bourouis; Julien Colombani; Pierre Léopold
Journal:  Curr Biol       Date:  2005-01-11       Impact factor: 10.834

8.  Diet-dependent effects of the Drosophila Mnk1/Mnk2 homolog Lk6 on growth via eIF4E.

Authors:  Jan H Reiling; Kathrin T Doepfner; Ernst Hafen; Hugo Stocker
Journal:  Curr Biol       Date:  2005-01-11       Impact factor: 10.834

9.  The Pumilio RNA-binding domain is also a translational regulator.

Authors:  R P Wharton; J Sonoda; T Lee; M Patterson; Y Murata
Journal:  Mol Cell       Date:  1998-05       Impact factor: 17.970

10.  Ecdysone pathway is required for furrow progression in the developing Drosophila eye.

Authors:  C A Brennan; M Ashburner; K Moses
Journal:  Development       Date:  1998-07       Impact factor: 6.868

View more
  14 in total

1.  Ral GTPase and the exocyst regulate autophagy in a tissue-specific manner.

Authors:  Kirsten Tracy; Panagiotis D Velentzas; Eric H Baehrecke
Journal:  EMBO Rep       Date:  2015-11-23       Impact factor: 8.807

2.  DNA Repair Interacts with Autophagy To Regulate Inflammatory Responses to Pulmonary Hyperoxia.

Authors:  Yan Ye; Ping Lin; Weidong Zhang; Shirui Tan; Xikun Zhou; Rongpeng Li; Qinqin Pu; Jonathan L Koff; Archana Dhasarathy; Feng Ma; Xin Deng; Jianxin Jiang; Min Wu
Journal:  J Immunol       Date:  2017-02-15       Impact factor: 5.422

3.  The domino SWI2/SNF2 Gene Product Represses Cell Death in Drosophila melanogaster.

Authors:  Kaitlyn Ellis; Joanna Wardwell-Ozgo; Kenneth H Moberg; Barry Yedvobnick
Journal:  G3 (Bethesda)       Date:  2018-07-02       Impact factor: 3.154

4.  SWI/SNF chromatin remodeling controls Notch-responsive enhancer accessibility.

Authors:  Zoe Pillidge; Sarah J Bray
Journal:  EMBO Rep       Date:  2019-03-26       Impact factor: 8.807

5.  Microbiota-derived acetate activates intestinal innate immunity via the Tip60 histone acetyltransferase complex.

Authors:  Bat-Erdene Jugder; Layla Kamareddine; Paula I Watnick
Journal:  Immunity       Date:  2021-06-08       Impact factor: 43.474

6.  Guidelines for the use and interpretation of assays for monitoring autophagy (4th edition)1.

Authors:  Daniel J Klionsky; Amal Kamal Abdel-Aziz; Sara Abdelfatah; Mahmoud Abdellatif; Asghar Abdoli; Steffen Abel; Hagai Abeliovich; Marie H Abildgaard; Yakubu Princely Abudu; Abraham Acevedo-Arozena; Iannis E Adamopoulos; Khosrow Adeli; Timon E Adolph; Annagrazia Adornetto; Elma Aflaki; Galila Agam; Anupam Agarwal; Bharat B Aggarwal; Maria Agnello; Patrizia Agostinis; Javed N Agrewala; Alexander Agrotis; Patricia V Aguilar; S Tariq Ahmad; Zubair M Ahmed; Ulises Ahumada-Castro; Sonja Aits; Shu Aizawa; Yunus Akkoc; Tonia Akoumianaki; Hafize Aysin Akpinar; Ahmed M Al-Abd; Lina Al-Akra; Abeer Al-Gharaibeh; Moulay A Alaoui-Jamali; Simon Alberti; Elísabet Alcocer-Gómez; Cristiano Alessandri; Muhammad Ali; M Abdul Alim Al-Bari; Saeb Aliwaini; Javad Alizadeh; Eugènia Almacellas; Alexandru Almasan; Alicia Alonso; Guillermo D Alonso; Nihal Altan-Bonnet; Dario C Altieri; Élida M C Álvarez; Sara Alves; Cristine Alves da Costa; Mazen M Alzaharna; Marialaura Amadio; Consuelo Amantini; Cristina Amaral; Susanna Ambrosio; Amal O Amer; Veena Ammanathan; Zhenyi An; Stig U Andersen; Shaida A Andrabi; Magaiver Andrade-Silva; Allen M Andres; Sabrina Angelini; David Ann; Uche C Anozie; Mohammad Y Ansari; Pedro Antas; Adam Antebi; Zuriñe Antón; Tahira Anwar; Lionel Apetoh; Nadezda Apostolova; Toshiyuki Araki; Yasuhiro Araki; Kohei Arasaki; Wagner L Araújo; Jun Araya; Catherine Arden; Maria-Angeles Arévalo; Sandro Arguelles; Esperanza Arias; Jyothi Arikkath; Hirokazu Arimoto; Aileen R Ariosa; Darius Armstrong-James; Laetitia Arnauné-Pelloquin; Angeles Aroca; Daniela S Arroyo; Ivica Arsov; Rubén Artero; Dalia Maria Lucia Asaro; Michael Aschner; Milad Ashrafizadeh; Osnat Ashur-Fabian; Atanas G Atanasov; Alicia K Au; Patrick Auberger; Holger W Auner; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Yenniffer Ávalos; Sanja Aveic; Célia Alexandra Aveleira; Tamar Avin-Wittenberg; Yucel Aydin; Scott Ayton; Srinivas Ayyadevara; Maria Azzopardi; Misuzu Baba; Jonathan M Backer; Steven K Backues; Dong-Hun Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Ahruem Baek; Seung-Hoon Baek; Sung Hee Baek; Giacinto Bagetta; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xiyuan Bai; Yidong Bai; Nandadulal Bairagi; Shounak Baksi; Teresa Balbi; Cosima T Baldari; Walter Balduini; Andrea Ballabio; Maria Ballester; Salma Balazadeh; Rena Balzan; Rina Bandopadhyay; Sreeparna Banerjee; Sulagna Banerjee; Ágnes Bánréti; Yan Bao; Mauricio S Baptista; Alessandra Baracca; Cristiana Barbati; Ariadna Bargiela; Daniela Barilà; Peter G Barlow; Sami J Barmada; Esther Barreiro; George E Barreto; Jiri Bartek; Bonnie Bartel; Alberto Bartolome; Gaurav R Barve; Suresh H Basagoudanavar; Diane C Bassham; Robert C Bast; Alakananda Basu; Henri Batoko; Isabella Batten; Etienne E Baulieu; Bradley L Baumgarner; Jagadeesh Bayry; Rupert Beale; Isabelle Beau; Florian Beaumatin; Luiz R G Bechara; George R Beck; Michael F Beers; Jakob Begun; Christian Behrends; Georg M N Behrens; Roberto Bei; Eloy Bejarano; Shai Bel; Christian Behl; Amine Belaid; Naïma Belgareh-Touzé; Cristina Bellarosa; Francesca Belleudi; Melissa Belló Pérez; Raquel Bello-Morales; Jackeline Soares de Oliveira Beltran; Sebastián Beltran; Doris Mangiaracina Benbrook; Mykolas Bendorius; Bruno A Benitez; Irene Benito-Cuesta; Julien Bensalem; Martin W Berchtold; Sabina Berezowska; Daniele Bergamaschi; Matteo Bergami; Andreas Bergmann; Laura Berliocchi; Clarisse Berlioz-Torrent; Amélie Bernard; Lionel Berthoux; Cagri G Besirli; Sebastien Besteiro; Virginie M Betin; Rudi Beyaert; Jelena S Bezbradica; Kiran Bhaskar; Ingrid Bhatia-Kissova; Resham Bhattacharya; Sujoy Bhattacharya; Shalmoli Bhattacharyya; Md Shenuarin Bhuiyan; Sujit Kumar Bhutia; Lanrong Bi; Xiaolin Bi; Trevor J Biden; Krikor Bijian; Viktor A Billes; Nadine Binart; Claudia Bincoletto; Asa B Birgisdottir; Geir Bjorkoy; Gonzalo Blanco; Ana Blas-Garcia; Janusz Blasiak; Robert Blomgran; Klas Blomgren; Janice S Blum; Emilio Boada-Romero; Mirta Boban; Kathleen Boesze-Battaglia; Philippe Boeuf; Barry Boland; Pascale Bomont; Paolo Bonaldo; Srinivasa Reddy Bonam; Laura Bonfili; Juan S Bonifacino; Brian A Boone; Martin D Bootman; Matteo Bordi; Christoph Borner; Beat C Bornhauser; Gautam Borthakur; Jürgen Bosch; Santanu Bose; Luis M Botana; Juan Botas; Chantal M Boulanger; Michael E Boulton; Mathieu Bourdenx; Benjamin Bourgeois; Nollaig M Bourke; Guilhem Bousquet; Patricia Boya; Peter V Bozhkov; Luiz H M Bozi; Tolga O Bozkurt; Doug E Brackney; Christian H Brandts; Ralf J Braun; Gerhard H Braus; Roberto Bravo-Sagua; José M Bravo-San Pedro; Patrick Brest; Marie-Agnès Bringer; Alfredo Briones-Herrera; V Courtney Broaddus; Peter Brodersen; Jeffrey L Brodsky; Steven L Brody; Paola G Bronson; Jeff M Bronstein; Carolyn N Brown; Rhoderick E Brown; Patricia C Brum; John H Brumell; Nicola Brunetti-Pierri; Daniele Bruno; Robert J Bryson-Richardson; Cecilia Bucci; Carmen Buchrieser; Marta Bueno; Laura Elisa Buitrago-Molina; Simone Buraschi; Shilpa Buch; J Ross Buchan; Erin M Buckingham; Hikmet Budak; Mauricio Budini; Geert Bultynck; Florin Burada; Joseph R Burgoyne; M Isabel Burón; Victor Bustos; Sabrina Büttner; Elena Butturini; Aaron Byrd; Isabel Cabas; Sandra Cabrera-Benitez; Ken Cadwell; Jingjing Cai; Lu Cai; Qian Cai; Montserrat Cairó; Jose A Calbet; Guy A Caldwell; Kim A Caldwell; Jarrod A Call; Riccardo Calvani; Ana C Calvo; Miguel Calvo-Rubio Barrera; Niels Os Camara; Jacques H Camonis; Nadine Camougrand; Michelangelo Campanella; Edward M Campbell; François-Xavier Campbell-Valois; Silvia Campello; Ilaria Campesi; Juliane C Campos; Olivier Camuzard; Jorge Cancino; Danilo Candido de Almeida; Laura Canesi; Isabella Caniggia; Barbara Canonico; Carles Cantí; Bin Cao; Michele Caraglia; Beatriz Caramés; Evie H Carchman; Elena Cardenal-Muñoz; Cesar Cardenas; Luis Cardenas; Sandra M Cardoso; Jennifer S Carew; Georges F Carle; Gillian Carleton; Silvia Carloni; Didac Carmona-Gutierrez; Leticia A Carneiro; Oliana Carnevali; Julian M Carosi; Serena Carra; Alice Carrier; Lucie Carrier; Bernadette Carroll; A Brent Carter; Andreia Neves Carvalho; Magali Casanova; Caty Casas; Josefina Casas; Chiara Cassioli; Eliseo F Castillo; Karen Castillo; Sonia Castillo-Lluva; Francesca Castoldi; Marco Castori; Ariel F Castro; Margarida Castro-Caldas; Javier Castro-Hernandez; Susana Castro-Obregon; Sergio D Catz; Claudia Cavadas; Federica Cavaliere; Gabriella Cavallini; Maria Cavinato; Maria L Cayuela; Paula Cebollada Rica; Valentina Cecarini; Francesco Cecconi; Marzanna Cechowska-Pasko; Simone Cenci; Victòria Ceperuelo-Mallafré; João J Cerqueira; Janete M Cerutti; Davide Cervia; Vildan Bozok Cetintas; Silvia Cetrullo; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Oishee Chakrabarti; Tapas Chakraborty; Trinad Chakraborty; Mounia Chami; Georgios Chamilos; David W Chan; Edmond Y W Chan; Edward D Chan; H Y Edwin Chan; Helen H Chan; Hung Chan; Matthew T V Chan; Yau Sang Chan; Partha K Chandra; Chih-Peng Chang; Chunmei Chang; Hao-Chun Chang; Kai Chang; Jie Chao; Tracey Chapman; Nicolas Charlet-Berguerand; Samrat Chatterjee; Shail K Chaube; Anu Chaudhary; Santosh Chauhan; Edward Chaum; Frédéric Checler; Michael E Cheetham; Chang-Shi Chen; Guang-Chao Chen; Jian-Fu Chen; Liam L Chen; Leilei Chen; Lin Chen; Mingliang Chen; Mu-Kuan Chen; Ning Chen; Quan Chen; Ruey-Hwa Chen; Shi Chen; Wei Chen; Weiqiang Chen; Xin-Ming Chen; Xiong-Wen Chen; Xu Chen; Yan Chen; Ye-Guang Chen; Yingyu Chen; Yongqiang Chen; Yu-Jen Chen; Yue-Qin Chen; Zhefan Stephen Chen; Zhi Chen; Zhi-Hua Chen; Zhijian J Chen; Zhixiang Chen; Hanhua Cheng; Jun Cheng; Shi-Yuan Cheng; Wei Cheng; Xiaodong Cheng; Xiu-Tang Cheng; Yiyun Cheng; Zhiyong Cheng; Zhong Chen; Heesun Cheong; Jit Kong Cheong; Boris V Chernyak; Sara Cherry; Chi Fai Randy Cheung; Chun Hei Antonio Cheung; King-Ho Cheung; Eric Chevet; Richard J Chi; Alan Kwok Shing Chiang; Ferdinando Chiaradonna; Roberto Chiarelli; Mario Chiariello; Nathalia Chica; Susanna Chiocca; Mario Chiong; Shih-Hwa Chiou; Abhilash I Chiramel; Valerio Chiurchiù; Dong-Hyung Cho; Seong-Kyu Choe; Augustine M K Choi; Mary E Choi; Kamalika Roy Choudhury; Norman S Chow; Charleen T Chu; Jason P Chua; John Jia En Chua; Hyewon Chung; Kin Pan Chung; Seockhoon Chung; So-Hyang Chung; Yuen-Li Chung; Valentina Cianfanelli; Iwona A Ciechomska; Mariana Cifuentes; Laura Cinque; Sebahattin Cirak; Mara Cirone; Michael J Clague; Robert Clarke; Emilio Clementi; Eliana M Coccia; Patrice Codogno; Ehud Cohen; Mickael M Cohen; Tania Colasanti; Fiorella Colasuonno; Robert A Colbert; Anna Colell; Miodrag Čolić; Nuria S Coll; Mark O Collins; María I Colombo; Daniel A Colón-Ramos; Lydie Combaret; Sergio Comincini; Márcia R Cominetti; Antonella Consiglio; Andrea Conte; Fabrizio Conti; Viorica Raluca Contu; Mark R Cookson; Kevin M Coombs; Isabelle Coppens; Maria Tiziana Corasaniti; Dale P Corkery; Nils Cordes; Katia Cortese; Maria do Carmo Costa; Sarah Costantino; Paola Costelli; Ana Coto-Montes; Peter J Crack; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Riccardo Cristofani; Tamas Csizmadia; Antonio Cuadrado; Bing Cui; Jun Cui; Yixian Cui; Yong Cui; Emmanuel Culetto; Andrea C Cumino; Andrey V Cybulsky; Mark J Czaja; Stanislaw J Czuczwar; Stefania D'Adamo; Marcello D'Amelio; Daniela D'Arcangelo; Andrew C D'Lugos; Gabriella D'Orazi; James A da Silva; Hormos Salimi Dafsari; Ruben K Dagda; Yasin Dagdas; Maria Daglia; Xiaoxia Dai; Yun Dai; Yuyuan Dai; Jessica Dal Col; Paul Dalhaimer; Luisa Dalla Valle; Tobias Dallenga; Guillaume Dalmasso; Markus Damme; Ilaria Dando; Nico P Dantuma; April L Darling; Hiranmoy Das; Srinivasan Dasarathy; Santosh K Dasari; Srikanta Dash; Oliver Daumke; Adrian N Dauphinee; Jeffrey S Davies; Valeria A Dávila; Roger J Davis; Tanja Davis; Sharadha Dayalan Naidu; Francesca De Amicis; Karolien De Bosscher; Francesca De Felice; Lucia De Franceschi; Chiara De Leonibus; Mayara G de Mattos Barbosa; Guido R Y De Meyer; Angelo De Milito; Cosimo De Nunzio; Clara De Palma; Mauro De Santi; Claudio De Virgilio; Daniela De Zio; Jayanta Debnath; Brian J DeBosch; Jean-Paul Decuypere; Mark A Deehan; Gianluca Deflorian; James DeGregori; Benjamin Dehay; Gabriel Del Rio; Joe R Delaney; Lea M D Delbridge; Elizabeth Delorme-Axford; M Victoria Delpino; Francesca Demarchi; Vilma Dembitz; Nicholas D Demers; Hongbin Deng; Zhiqiang Deng; Joern Dengjel; Paul Dent; Donna Denton; Melvin L DePamphilis; Channing J Der; Vojo Deretic; Albert Descoteaux; Laura Devis; Sushil Devkota; Olivier Devuyst; Grant Dewson; Mahendiran Dharmasivam; Rohan Dhiman; Diego di Bernardo; Manlio Di Cristina; Fabio Di Domenico; Pietro Di Fazio; Alessio Di Fonzo; Giovanni Di Guardo; Gianni M Di Guglielmo; Luca Di Leo; Chiara Di Malta; Alessia Di Nardo; Martina Di Rienzo; Federica Di Sano; George Diallinas; Jiajie Diao; Guillermo Diaz-Araya; Inés Díaz-Laviada; Jared M Dickinson; Marc Diederich; Mélanie Dieudé; Ivan Dikic; Shiping Ding; Wen-Xing Ding; Luciana Dini; Jelena Dinić; Miroslav Dinic; Albena T Dinkova-Kostova; Marc S Dionne; Jörg H W Distler; Abhinav Diwan; Ian M C Dixon; Mojgan Djavaheri-Mergny; Ina Dobrinski; Oxana Dobrovinskaya; Radek Dobrowolski; Renwick C J Dobson; Jelena Đokić; Serap Dokmeci Emre; Massimo Donadelli; Bo Dong; Xiaonan Dong; Zhiwu Dong; Gerald W Dorn Ii; Volker Dotsch; Huan Dou; Juan Dou; Moataz Dowaidar; Sami Dridi; Liat Drucker; Ailian Du; Caigan Du; Guangwei Du; Hai-Ning Du; Li-Lin Du; André du Toit; Shao-Bin Duan; Xiaoqiong Duan; Sónia P Duarte; Anna Dubrovska; Elaine A Dunlop; Nicolas Dupont; Raúl V Durán; Bilikere S Dwarakanath; Sergey A Dyshlovoy; Darius Ebrahimi-Fakhari; Leopold Eckhart; Charles L Edelstein; Thomas Efferth; Eftekhar Eftekharpour; Ludwig Eichinger; Nabil Eid; Tobias Eisenberg; N Tony Eissa; Sanaa Eissa; Miriam Ejarque; Abdeljabar El Andaloussi; Nazira El-Hage; Shahenda El-Naggar; Anna Maria Eleuteri; Eman S El-Shafey; Mohamed Elgendy; Aristides G Eliopoulos; María M Elizalde; Philip M Elks; Hans-Peter Elsasser; Eslam S Elsherbiny; Brooke M Emerling; N C Tolga Emre; Christina H Eng; Nikolai Engedal; Anna-Mart Engelbrecht; Agnete S T Engelsen; Jorrit M Enserink; Ricardo Escalante; Audrey Esclatine; Mafalda Escobar-Henriques; Eeva-Liisa Eskelinen; Lucile Espert; Makandjou-Ola Eusebio; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Francesco Facchiano; Bengt Fadeel; Claudio Fader; Alex C Faesen; W Douglas Fairlie; Alberto Falcó; Bjorn H Falkenburger; Daping Fan; Jie Fan; Yanbo Fan; Evandro F Fang; Yanshan Fang; Yognqi Fang; Manolis Fanto; Tamar Farfel-Becker; Mathias Faure; Gholamreza Fazeli; Anthony O Fedele; Arthur M Feldman; Du Feng; Jiachun Feng; Lifeng Feng; Yibin Feng; Yuchen Feng; Wei Feng; Thais Fenz Araujo; Thomas A Ferguson; Álvaro F Fernández; Jose C Fernandez-Checa; Sonia Fernández-Veledo; Alisdair R Fernie; Anthony W Ferrante; Alessandra Ferraresi; Merari F Ferrari; Julio C B Ferreira; Susan Ferro-Novick; Antonio Figueras; Riccardo Filadi; Nicoletta Filigheddu; Eduardo Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; Vittorio Fineschi; Francesca Finetti; Steven Finkbeiner; Edward A Fisher; Paul B Fisher; Flavio Flamigni; Steven J Fliesler; Trude H Flo; Ida Florance; Oliver Florey; Tullio Florio; Erika Fodor; Carlo Follo; Edward A Fon; Antonella Forlino; Francesco Fornai; Paola Fortini; Anna Fracassi; Alessandro Fraldi; Brunella Franco; Rodrigo Franco; Flavia Franconi; Lisa B Frankel; Scott L Friedman; Leopold F Fröhlich; Gema Frühbeck; Jose M Fuentes; Yukio Fujiki; Naonobu Fujita; Yuuki Fujiwara; Mitsunori Fukuda; Simone Fulda; Luc Furic; Norihiko Furuya; Carmela Fusco; Michaela U Gack; Lidia Gaffke; Sehamuddin Galadari; Alessia Galasso; Maria F Galindo; Sachith Gallolu Kankanamalage; Lorenzo Galluzzi; Vincent Galy; Noor Gammoh; Boyi Gan; Ian G Ganley; Feng Gao; Hui Gao; Minghui Gao; Ping Gao; Shou-Jiang Gao; Wentao Gao; Xiaobo Gao; Ana Garcera; Maria Noé Garcia; Verónica E Garcia; Francisco García-Del Portillo; Vega Garcia-Escudero; Aracely Garcia-Garcia; Marina Garcia-Macia; Diana García-Moreno; Carmen Garcia-Ruiz; Patricia García-Sanz; Abhishek D Garg; Ricardo Gargini; Tina Garofalo; Robert F Garry; Nils C Gassen; Damian Gatica; Liang Ge; Wanzhong Ge; Ruth Geiss-Friedlander; Cecilia Gelfi; Pascal Genschik; Ian E Gentle; Valeria Gerbino; Christoph Gerhardt; Kyla Germain; Marc Germain; David A Gewirtz; Elham Ghasemipour Afshar; Saeid Ghavami; Alessandra Ghigo; Manosij Ghosh; Georgios Giamas; Claudia Giampietri; Alexandra Giatromanolaki; Gary E Gibson; Spencer B Gibson; Vanessa Ginet; Edward Giniger; Carlotta Giorgi; Henrique Girao; Stephen E Girardin; Mridhula Giridharan; Sandy Giuliano; Cecilia Giulivi; Sylvie Giuriato; Julien Giustiniani; Alexander Gluschko; Veit Goder; Alexander Goginashvili; Jakub Golab; David C Goldstone; Anna Golebiewska; Luciana R Gomes; Rodrigo Gomez; Rubén Gómez-Sánchez; Maria Catalina Gomez-Puerto; Raquel Gomez-Sintes; Qingqiu Gong; Felix M Goni; Javier González-Gallego; Tomas Gonzalez-Hernandez; Rosa A Gonzalez-Polo; Jose A Gonzalez-Reyes; Patricia González-Rodríguez; Ing Swie Goping; Marina S Gorbatyuk; Nikolai V Gorbunov; Kıvanç Görgülü; Roxana M Gorojod; Sharon M Gorski; Sandro Goruppi; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Martin Graef; Markus H Gräler; Veronica Granatiero; Daniel Grasso; Joshua P Gray; Douglas R Green; Alexander Greenhough; Stephen L Gregory; Edward F Griffin; Mark W Grinstaff; Frederic Gros; Charles Grose; Angelina S Gross; Florian Gruber; Paolo Grumati; Tilman Grune; Xueyan Gu; Jun-Lin Guan; Carlos M Guardia; Kishore Guda; Flora Guerra; Consuelo Guerri; Prasun Guha; Carlos Guillén; Shashi Gujar; Anna Gukovskaya; Ilya Gukovsky; Jan Gunst; Andreas Günther; Anyonya R Guntur; Chuanyong Guo; Chun Guo; Hongqing Guo; Lian-Wang Guo; Ming Guo; Pawan Gupta; Shashi Kumar Gupta; Swapnil Gupta; Veer Bala Gupta; Vivek Gupta; Asa B Gustafsson; David D Gutterman; Ranjitha H B; Annakaisa Haapasalo; James E Haber; Aleksandra Hać; Shinji Hadano; Anders J Hafrén; Mansour Haidar; Belinda S Hall; Gunnel Halldén; Anne Hamacher-Brady; Andrea Hamann; Maho Hamasaki; Weidong Han; Malene Hansen; Phyllis I Hanson; Zijian Hao; Masaru Harada; Ljubica Harhaji-Trajkovic; Nirmala Hariharan; Nigil Haroon; James Harris; Takafumi Hasegawa; Noor Hasima Nagoor; Jeffrey A Haspel; Volker Haucke; Wayne D Hawkins; Bruce A Hay; Cole M Haynes; Soren B Hayrabedyan; Thomas S Hays; Congcong He; Qin He; Rong-Rong He; You-Wen He; Yu-Ying He; Yasser Heakal; Alexander M Heberle; J Fielding Hejtmancik; Gudmundur Vignir Helgason; Vanessa Henkel; Marc Herb; Alexander Hergovich; Anna Herman-Antosiewicz; Agustín Hernández; Carlos Hernandez; Sergio Hernandez-Diaz; Virginia Hernandez-Gea; Amaury Herpin; Judit Herreros; Javier H Hervás; Daniel Hesselson; Claudio Hetz; Volker T Heussler; Yujiro Higuchi; Sabine Hilfiker; Joseph A Hill; William S Hlavacek; Emmanuel A Ho; Idy H T Ho; Philip Wing-Lok Ho; Shu-Leong Ho; Wan Yun Ho; G Aaron Hobbs; Mark Hochstrasser; Peter H M Hoet; Daniel Hofius; Paul Hofman; Annika Höhn; Carina I Holmberg; Jose R Hombrebueno; Chang-Won Hong Yi-Ren Hong; Lora V Hooper; Thorsten Hoppe; Rastislav Horos; Yujin Hoshida; I-Lun Hsin; Hsin-Yun Hsu; Bing Hu; Dong Hu; Li-Fang Hu; Ming Chang Hu; Ronggui Hu; Wei Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Jinlian Hua; Yingqi Hua; Chongmin Huan; Canhua Huang; Chuanshu Huang; Chuanxin Huang; Chunling Huang; Haishan Huang; Kun Huang; Michael L H Huang; Rui Huang; Shan Huang; Tianzhi Huang; Xing Huang; Yuxiang Jack Huang; Tobias B Huber; Virginie Hubert; Christian A Hubner; Stephanie M Hughes; William E Hughes; Magali Humbert; Gerhard Hummer; James H Hurley; Sabah Hussain; Salik Hussain; Patrick J Hussey; Martina Hutabarat; Hui-Yun Hwang; Seungmin Hwang; Antonio Ieni; Fumiyo Ikeda; Yusuke Imagawa; Yuzuru Imai; Carol Imbriano; Masaya Imoto; Denise M Inman; Ken Inoki; Juan Iovanna; Renato V Iozzo; Giuseppe Ippolito; Javier E Irazoqui; Pablo Iribarren; Mohd Ishaq; Makoto Ishikawa; Nestor Ishimwe; Ciro Isidoro; Nahed Ismail; Shohreh Issazadeh-Navikas; Eisuke Itakura; Daisuke Ito; Davor Ivankovic; Saška Ivanova; Anand Krishnan V Iyer; José M Izquierdo; Masanori Izumi; Marja Jäättelä; Majid Sakhi Jabir; William T Jackson; Nadia Jacobo-Herrera; Anne-Claire Jacomin; Elise Jacquin; Pooja Jadiya; Hartmut Jaeschke; Chinnaswamy Jagannath; Arjen J Jakobi; Johan Jakobsson; Bassam Janji; Pidder Jansen-Dürr; Patric J Jansson; Jonathan Jantsch; Sławomir Januszewski; Alagie Jassey; Steve Jean; Hélène Jeltsch-David; Pavla Jendelova; Andreas Jenny; Thomas E Jensen; Niels Jessen; Jenna L Jewell; Jing Ji; Lijun Jia; Rui Jia; Liwen Jiang; Qing Jiang; Richeng Jiang; Teng Jiang; Xuejun Jiang; Yu Jiang; Maria Jimenez-Sanchez; Eun-Jung Jin; Fengyan Jin; Hongchuan Jin; Li Jin; Luqi Jin; Meiyan Jin; Si Jin; Eun-Kyeong Jo; Carine Joffre; Terje Johansen; Gail V W Johnson; Simon A Johnston; Eija Jokitalo; Mohit Kumar Jolly; Leo A B Joosten; Joaquin Jordan; Bertrand Joseph; Dianwen Ju; Jeong-Sun Ju; Jingfang Ju; Esmeralda Juárez; Delphine Judith; Gábor Juhász; Youngsoo Jun; Chang Hwa Jung; Sung-Chul Jung; Yong Keun Jung; Heinz Jungbluth; Johannes Jungverdorben; Steffen Just; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Daniel Kaganovich; Alon Kahana; Renate Kain; Shinjo Kajimura; Maria Kalamvoki; Manjula Kalia; Danuta S Kalinowski; Nina Kaludercic; Ioanna Kalvari; Joanna Kaminska; Vitaliy O Kaminskyy; Hiromitsu Kanamori; Keizo Kanasaki; Chanhee Kang; Rui Kang; Sang Sun Kang; Senthilvelrajan Kaniyappan; Tomotake Kanki; Thirumala-Devi Kanneganti; Anumantha G Kanthasamy; Arthi Kanthasamy; Marc Kantorow; Orsolya Kapuy; Michalis V Karamouzis; Md Razaul Karim; Parimal Karmakar; Rajesh G Katare; Masaru Kato; Stefan H E Kaufmann; Anu Kauppinen; Gur P Kaushal; Susmita Kaushik; Kiyoshi Kawasaki; Kemal Kazan; Po-Yuan Ke; Damien J Keating; Ursula Keber; John H Kehrl; Kate E Keller; Christian W Keller; Jongsook Kim Kemper; Candia M Kenific; Oliver Kepp; Stephanie Kermorgant; Andreas Kern; Robin Ketteler; Tom G Keulers; Boris Khalfin; Hany Khalil; Bilon Khambu; Shahid Y Khan; Vinoth Kumar Megraj Khandelwal; Rekha Khandia; Widuri Kho; Noopur V Khobrekar; Sataree Khuansuwan; Mukhran Khundadze; Samuel A Killackey; Dasol Kim; Deok Ryong Kim; Do-Hyung Kim; Dong-Eun Kim; Eun Young Kim; Eun-Kyoung Kim; Hak-Rim Kim; Hee-Sik Kim; Jeong Hun Kim; Jin Kyung Kim; Jin-Hoi Kim; Joungmok Kim; Ju Hwan Kim; Keun Il Kim; Peter K Kim; Seong-Jun Kim; Scot R Kimball; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Matthew A King; Kerri J Kinghorn; Conan G Kinsey; Vladimir Kirkin; Lorrie A Kirshenbaum; Sergey L Kiselev; Shuji Kishi; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Richard N Kitsis; Josef T Kittler; Ole Kjaerulff; Peter S Klein; Thomas Klopstock; Jochen Klucken; Helene Knævelsrud; Roland L Knorr; Ben C B Ko; Fred Ko; Jiunn-Liang Ko; Hotaka Kobayashi; Satoru Kobayashi; Ina Koch; Jan C Koch; Ulrich Koenig; Donat Kögel; Young Ho Koh; Masato Koike; Sepp D Kohlwein; Nur M Kocaturk; Masaaki Komatsu; Jeannette König; Toru Kono; Benjamin T Kopp; Tamas Korcsmaros; Gözde Korkmaz; Viktor I Korolchuk; Mónica Suárez Korsnes; Ali Koskela; Janaiah Kota; Yaichiro Kotake; Monica L Kotler; Yanjun Kou; Michael I Koukourakis; Evangelos Koustas; Attila L Kovacs; Tibor Kovács; Daisuke Koya; Tomohiro Kozako; Claudine Kraft; Dimitri Krainc; Helmut Krämer; Anna D Krasnodembskaya; Carole Kretz-Remy; Guido Kroemer; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Sabine Kuenen; Lars Kuerschner; Thomas Kukar; Ajay Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Sharad Kumar; Shinji Kume; Caroline Kumsta; Chanakya N Kundu; Mondira Kundu; Ajaikumar B Kunnumakkara; Lukasz Kurgan; Tatiana G Kutateladze; Ozlem Kutlu; SeongAe Kwak; Ho Jeong Kwon; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert La Spada; Patrick Labonté; Sylvain Ladoire; Ilaria Laface; Frank Lafont; Diane C Lagace; Vikramjit Lahiri; Zhibing Lai; Angela S Laird; Aparna Lakkaraju; Trond Lamark; Sheng-Hui Lan; Ane Landajuela; Darius J R Lane; Jon D Lane; Charles H Lang; Carsten Lange; Ülo Langel; Rupert Langer; Pierre Lapaquette; Jocelyn Laporte; Nicholas F LaRusso; Isabel Lastres-Becker; Wilson Chun Yu Lau; Gordon W Laurie; Sergio Lavandero; Betty Yuen Kwan Law; Helen Ka-Wai Law; Rob Layfield; Weidong Le; Herve Le Stunff; Alexandre Y Leary; Jean-Jacques Lebrun; Lionel Y W Leck; Jean-Philippe Leduc-Gaudet; Changwook Lee; Chung-Pei Lee; Da-Hye Lee; Edward B Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Heung Kyu Lee; Jae Man Lee; Jason S Lee; Jin-A Lee; Joo-Yong Lee; Jun Hee Lee; Michael Lee; Min Goo Lee; Min Jae Lee; Myung-Shik Lee; Sang Yoon Lee; Seung-Jae Lee; Stella Y Lee; Sung Bae Lee; Won Hee Lee; Ying-Ray Lee; Yong-Ho Lee; Youngil Lee; Christophe Lefebvre; Renaud Legouis; Yu L Lei; Yuchen Lei; Sergey Leikin; Gerd Leitinger; Leticia Lemus; Shuilong Leng; Olivia Lenoir; Guido Lenz; Heinz Josef Lenz; Paola Lenzi; Yolanda León; Andréia M Leopoldino; Christoph Leschczyk; Stina Leskelä; Elisabeth Letellier; Chi-Ting Leung; Po Sing Leung; Jeremy S Leventhal; Beth Levine; Patrick A Lewis; Klaus Ley; Bin Li; Da-Qiang Li; Jianming Li; Jing Li; Jiong Li; Ke Li; Liwu Li; Mei Li; Min Li; Min Li; Ming Li; Mingchuan Li; Pin-Lan Li; Ming-Qing Li; Qing Li; Sheng Li; Tiangang Li; Wei Li; Wenming Li; Xue Li; Yi-Ping Li; Yuan Li; Zhiqiang Li; Zhiyong Li; Zhiyuan Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Weicheng Liang; Yongheng Liang; YongTian Liang; Guanghong Liao; Lujian Liao; Mingzhi Liao; Yung-Feng Liao; Mariangela Librizzi; Pearl P Y Lie; Mary A Lilly; Hyunjung J Lim; Thania R R Lima; Federica Limana; Chao Lin; Chih-Wen Lin; Dar-Shong Lin; Fu-Cheng Lin; Jiandie D Lin; Kurt M Lin; Kwang-Huei Lin; Liang-Tzung Lin; Pei-Hui Lin; Qiong Lin; Shaofeng Lin; Su-Ju Lin; Wenyu Lin; Xueying Lin; Yao-Xin Lin; Yee-Shin Lin; Rafael Linden; Paula Lindner; Shuo-Chien Ling; Paul Lingor; Amelia K Linnemann; Yih-Cherng Liou; Marta M Lipinski; Saška Lipovšek; Vitor A Lira; Natalia Lisiak; Paloma B Liton; Chao Liu; Ching-Hsuan Liu; Chun-Feng Liu; Cui Hua Liu; Fang Liu; Hao Liu; Hsiao-Sheng Liu; Hua-Feng Liu; Huifang Liu; Jia Liu; Jing Liu; Julia Liu; Leyuan Liu; Longhua Liu; Meilian Liu; Qin Liu; Wei Liu; Wende Liu; Xiao-Hong Liu; Xiaodong Liu; Xingguo Liu; Xu Liu; Xuedong Liu; Yanfen Liu; Yang Liu; Yang Liu; Yueyang Liu; Yule Liu; J Andrew Livingston; Gerard Lizard; Jose M Lizcano; Senka Ljubojevic-Holzer; Matilde E LLeonart; David Llobet-Navàs; Alicia Llorente; Chih Hung Lo; Damián Lobato-Márquez; Qi Long; Yun Chau Long; Ben Loos; Julia A Loos; Manuela G López; Guillermo López-Doménech; José Antonio López-Guerrero; Ana T López-Jiménez; Óscar López-Pérez; Israel López-Valero; Magdalena J Lorenowicz; Mar Lorente; Peter Lorincz; Laura Lossi; Sophie Lotersztajn; Penny E Lovat; Jonathan F Lovell; Alenka Lovy; Péter Lőw; Guang Lu; Haocheng Lu; Jia-Hong Lu; Jin-Jian Lu; Mengji Lu; Shuyan Lu; Alessandro Luciani; John M Lucocq; Paula Ludovico; Micah A Luftig; Morten Luhr; Diego Luis-Ravelo; Julian J Lum; Liany Luna-Dulcey; Anders H Lund; Viktor K Lund; Jan D Lünemann; Patrick Lüningschrör; Honglin Luo; Rongcan Luo; Shouqing Luo; Zhi Luo; Claudio Luparello; Bernhard Lüscher; Luan Luu; Alex Lyakhovich; Konstantin G Lyamzaev; Alf Håkon Lystad; Lyubomyr Lytvynchuk; Alvin C Ma; Changle Ma; Mengxiao Ma; Ning-Fang Ma; Quan-Hong Ma; Xinliang Ma; Yueyun Ma; Zhenyi Ma; Ormond A MacDougald; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; Sandra Maday; Frank Madeo; Muniswamy Madesh; Tobias Madl; Julio Madrigal-Matute; Akiko Maeda; Yasuhiro Maejima; Marta Magarinos; Poornima Mahavadi; Emiliano Maiani; Kenneth Maiese; Panchanan Maiti; Maria Chiara Maiuri; Barbara Majello; Michael B Major; Elena Makareeva; Fayaz Malik; Karthik Mallilankaraman; Walter Malorni; Alina Maloyan; Najiba Mammadova; Gene Chi Wai Man; Federico Manai; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Masoud H Manjili; Ravi Manjithaya; Patricio Manque; Bella B Manshian; Raquel Manzano; Claudia Manzoni; Kai Mao; Cinzia Marchese; Sandrine Marchetti; Anna Maria Marconi; Fabrizio Marcucci; Stefania Mardente; Olga A Mareninova; Marta Margeta; Muriel Mari; Sara Marinelli; Oliviero Marinelli; Guillermo Mariño; Sofia Mariotto; Richard S Marshall; Mark R Marten; Sascha Martens; Alexandre P J Martin; Katie R Martin; Sara Martin; Shaun Martin; Adrián Martín-Segura; Miguel A Martín-Acebes; Inmaculada Martin-Burriel; Marcos Martin-Rincon; Paloma Martin-Sanz; José A Martina; Wim Martinet; Aitor Martinez; Ana Martinez; Jennifer Martinez; Moises Martinez Velazquez; Nuria Martinez-Lopez; Marta Martinez-Vicente; Daniel O Martins; Joilson O Martins; Waleska K Martins; Tania Martins-Marques; Emanuele Marzetti; Shashank Masaldan; Celine Masclaux-Daubresse; Douglas G Mashek; Valentina Massa; Lourdes Massieu; Glenn R Masson; Laura Masuelli; Anatoliy I Masyuk; Tetyana V Masyuk; Paola Matarrese; Ander Matheu; Satoaki Matoba; Sachiko Matsuzaki; Pamela Mattar; Alessandro Matte; Domenico Mattoscio; José L Mauriz; Mario Mauthe; Caroline Mauvezin; Emanual Maverakis; Paola Maycotte; Johanna Mayer; Gianluigi Mazzoccoli; Cristina Mazzoni; Joseph R Mazzulli; Nami McCarty; Christine McDonald; Mitchell R McGill; Sharon L McKenna; BethAnn McLaughlin; Fionn McLoughlin; Mark A McNiven; Thomas G McWilliams; Fatima Mechta-Grigoriou; Tania Catarina Medeiros; Diego L Medina; Lynn A Megeney; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Alfred J Meijer; Annemarie H Meijer; Jakob Mejlvang; Alicia Meléndez; Annette Melk; Gonen Memisoglu; Alexandrina F Mendes; Delong Meng; Fei Meng; Tian Meng; Rubem Menna-Barreto; Manoj B Menon; Carol Mercer; Anne E Mercier; Jean-Louis Mergny; Adalberto Merighi; Seth D Merkley; Giuseppe Merla; Volker Meske; Ana Cecilia Mestre; Shree Padma Metur; Christian Meyer; Hemmo Meyer; Wenyi Mi; Jeanne Mialet-Perez; Junying Miao; Lucia Micale; Yasuo Miki; Enrico Milan; Małgorzata Milczarek; Dana L Miller; Samuel I Miller; Silke Miller; Steven W Millward; Ira Milosevic; Elena A Minina; Hamed Mirzaei; Hamid Reza Mirzaei; Mehdi Mirzaei; Amit Mishra; Nandita Mishra; Paras Kumar Mishra; Maja Misirkic Marjanovic; Roberta Misasi; Amit Misra; Gabriella Misso; Claire Mitchell; Geraldine Mitou; Tetsuji Miura; Shigeki Miyamoto; Makoto Miyazaki; Mitsunori Miyazaki; Taiga Miyazaki; Keisuke Miyazawa; Noboru Mizushima; Trine H Mogensen; Baharia Mograbi; Reza Mohammadinejad; Yasir Mohamud; Abhishek Mohanty; Sipra Mohapatra; Torsten Möhlmann; Asif Mohmmed; Anna Moles; Kelle H Moley; Maurizio Molinari; Vincenzo Mollace; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Costanza Montagna; Mervyn J Monteiro; Andrea Montella; L Ruth Montes; Barbara Montico; Vinod K Mony; Giacomo Monzio Compagnoni; Michael N Moore; Mohammad A Moosavi; Ana L Mora; Marina Mora; David Morales-Alamo; Rosario Moratalla; Paula I Moreira; Elena Morelli; Sandra Moreno; Daniel Moreno-Blas; Viviana Moresi; Benjamin Morga; Alwena H Morgan; Fabrice Morin; Hideaki Morishita; Orson L Moritz; Mariko Moriyama; Yuji Moriyasu; Manuela Morleo; Eugenia Morselli; Jose F Moruno-Manchon; Jorge Moscat; Serge Mostowy; Elisa Motori; Andrea Felinto Moura; Naima Moustaid-Moussa; Maria Mrakovcic; Gabriel Muciño-Hernández; Anupam Mukherjee; Subhadip Mukhopadhyay; Jean M Mulcahy Levy; Victoriano Mulero; Sylviane Muller; Christian Münch; Ashok Munjal; Pura Munoz-Canoves; Teresa Muñoz-Galdeano; Christian Münz; Tomokazu Murakawa; Claudia Muratori; Brona M Murphy; J Patrick Murphy; Aditya Murthy; Timo T Myöhänen; Indira U Mysorekar; Jennifer Mytych; Seyed Mohammad Nabavi; Massimo Nabissi; Péter Nagy; Jihoon Nah; Aimable Nahimana; Ichiro Nakagawa; Ken Nakamura; Hitoshi Nakatogawa; Shyam S Nandi; Meera Nanjundan; Monica Nanni; Gennaro Napolitano; Roberta Nardacci; Masashi Narita; Melissa Nassif; Ilana Nathan; Manabu Natsumeda; Ryno J Naude; Christin Naumann; Olaia Naveiras; Fatemeh Navid; Steffan T Nawrocki; Taras Y Nazarko; Francesca Nazio; Florentina Negoita; Thomas Neill; Amanda L Neisch; Luca M Neri; Mihai G Netea; Patrick Neubert; Thomas P Neufeld; Dietbert Neumann; Albert Neutzner; Phillip T Newton; Paul A Ney; Ioannis P Nezis; Charlene C W Ng; Tzi Bun Ng; Hang T T Nguyen; Long T Nguyen; Hong-Min Ni; Clíona Ní Cheallaigh; Zhenhong Ni; M Celeste Nicolao; Francesco Nicoli; Manuel Nieto-Diaz; Per Nilsson; Shunbin Ning; Rituraj Niranjan; Hiroshi Nishimune; Mireia Niso-Santano; Ralph A Nixon; Annalisa Nobili; Clevio Nobrega; Takeshi Noda; Uxía Nogueira-Recalde; Trevor M Nolan; Ivan Nombela; Ivana Novak; Beatriz Novoa; Takashi Nozawa; Nobuyuki Nukina; Carmen Nussbaum-Krammer; Jesper Nylandsted; Tracey R O'Donovan; Seónadh M O'Leary; Eyleen J O'Rourke; Mary P O'Sullivan; Timothy E O'Sullivan; Salvatore Oddo; Ina Oehme; Michinaga Ogawa; Eric Ogier-Denis; Margret H Ogmundsdottir; Besim Ogretmen; Goo Taeg Oh; Seon-Hee Oh; Young J Oh; Takashi Ohama; Yohei Ohashi; Masaki Ohmuraya; Vasileios Oikonomou; Rani Ojha; Koji Okamoto; Hitoshi Okazawa; Masahide Oku; Sara Oliván; Jorge M A Oliveira; Michael Ollmann; James A Olzmann; Shakib Omari; M Bishr Omary; Gizem Önal; Martin Ondrej; Sang-Bing Ong; Sang-Ging Ong; Anna Onnis; Juan A Orellana; Sara Orellana-Muñoz; Maria Del Mar Ortega-Villaizan; Xilma R Ortiz-Gonzalez; Elena Ortona; Heinz D Osiewacz; Abdel-Hamid K Osman; Rosario Osta; Marisa S Otegui; Kinya Otsu; Christiane Ott; Luisa Ottobrini; Jing-Hsiung James Ou; Tiago F Outeiro; Inger Oynebraten; Melek Ozturk; Gilles Pagès; Susanta Pahari; Marta Pajares; Utpal B Pajvani; Rituraj Pal; Simona Paladino; Nicolas Pallet; Michela Palmieri; Giuseppe Palmisano; Camilla Palumbo; Francesco Pampaloni; Lifeng Pan; Qingjun Pan; Wenliang Pan; Xin Pan; Ganna Panasyuk; Rahul Pandey; Udai B Pandey; Vrajesh Pandya; Francesco Paneni; Shirley Y Pang; Elisa Panzarini; Daniela L Papademetrio; Elena Papaleo; Daniel Papinski; Diana Papp; Eun Chan Park; Hwan Tae Park; Ji-Man Park; Jong-In Park; Joon Tae Park; Junsoo Park; Sang Chul Park; Sang-Youel Park; Abraham H Parola; Jan B Parys; Adrien Pasquier; Benoit Pasquier; João F Passos; Nunzia Pastore; Hemal H Patel; Daniel Patschan; Sophie Pattingre; Gustavo Pedraza-Alva; Jose Pedraza-Chaverri; Zully Pedrozo; Gang Pei; Jianming Pei; Hadas Peled-Zehavi; Joaquín M Pellegrini; Joffrey Pelletier; Miguel A Peñalva; Di Peng; Ying Peng; Fabio Penna; Maria Pennuto; Francesca Pentimalli; Cláudia Mf Pereira; Gustavo J S Pereira; Lilian C Pereira; Luis Pereira de Almeida; Nirma D Perera; Ángel Pérez-Lara; Ana B Perez-Oliva; María Esther Pérez-Pérez; Palsamy Periyasamy; Andras Perl; Cristiana Perrotta; Ida Perrotta; Richard G Pestell; Morten Petersen; Irina Petrache; Goran Petrovski; Thorsten Pfirrmann; Astrid S Pfister; Jennifer A Philips; Huifeng Pi; Anna Picca; Alicia M Pickrell; Sandy Picot; Giovanna M Pierantoni; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Karolina Pierzynowska; Federico Pietrocola; Miroslawa Pietruczuk; Claudio Pignata; Felipe X Pimentel-Muiños; Mario Pinar; Roberta O Pinheiro; Ronit Pinkas-Kramarski; Paolo Pinton; Karolina Pircs; Sujan Piya; Paola Pizzo; Theo S Plantinga; Harald W Platta; Ainhoa Plaza-Zabala; Markus Plomann; Egor Y Plotnikov; Helene Plun-Favreau; Ryszard Pluta; Roger Pocock; Stefanie Pöggeler; Christian Pohl; Marc Poirot; Angelo Poletti; Marisa Ponpuak; Hana Popelka; Blagovesta Popova; Helena Porta; Soledad Porte Alcon; Eliana Portilla-Fernandez; Martin Post; Malia B Potts; Joanna Poulton; Ted Powers; Veena Prahlad; Tomasz K Prajsnar; Domenico Praticò; Rosaria Prencipe; Muriel Priault; Tassula Proikas-Cezanne; Vasilis J Promponas; Christopher G Proud; Rosa Puertollano; Luigi Puglielli; Thomas Pulinilkunnil; Deepika Puri; Rajat Puri; Julien Puyal; Xiaopeng Qi; Yongmei Qi; Wenbin Qian; Lei Qiang; Yu Qiu; Joe Quadrilatero; Jorge Quarleri; Nina Raben; Hannah Rabinowich; Debora Ragona; Michael J Ragusa; Nader Rahimi; Marveh Rahmati; Valeria Raia; Nuno Raimundo; Namakkal-Soorappan Rajasekaran; Sriganesh Ramachandra Rao; Abdelhaq Rami; Ignacio Ramírez-Pardo; David B Ramsden; Felix Randow; Pundi N Rangarajan; Danilo Ranieri; Hai Rao; Lang Rao; Rekha Rao; Sumit Rathore; J Arjuna Ratnayaka; Edward A Ratovitski; Palaniyandi Ravanan; Gloria Ravegnini; Swapan K Ray; Babak Razani; Vito Rebecca; Fulvio Reggiori; Anne Régnier-Vigouroux; Andreas S Reichert; David Reigada; Jan H Reiling; Theo Rein; Siegfried Reipert; Rokeya Sultana Rekha; Hongmei Ren; Jun Ren; Weichao Ren; Tristan Renault; Giorgia Renga; Karen Reue; Kim Rewitz; Bruna Ribeiro de Andrade Ramos; S Amer Riazuddin; Teresa M Ribeiro-Rodrigues; Jean-Ehrland Ricci; Romeo Ricci; Victoria Riccio; Des R Richardson; Yasuko Rikihisa; Makarand V Risbud; Ruth M Risueño; Konstantinos Ritis; Salvatore Rizza; Rosario Rizzuto; Helen C Roberts; Luke D Roberts; Katherine J Robinson; Maria Carmela Roccheri; Stephane Rocchi; George G Rodney; Tiago Rodrigues; Vagner Ramon Rodrigues Silva; Amaia Rodriguez; Ruth Rodriguez-Barrueco; Nieves Rodriguez-Henche; Humberto Rodriguez-Rocha; Jeroen Roelofs; Robert S Rogers; Vladimir V Rogov; Ana I Rojo; Krzysztof Rolka; Vanina Romanello; Luigina Romani; Alessandra Romano; Patricia S Romano; David Romeo-Guitart; Luis C Romero; Montserrat Romero; Joseph C Roney; Christopher Rongo; Sante Roperto; Mathias T Rosenfeldt; Philip Rosenstiel; Anne G Rosenwald; Kevin A Roth; Lynn Roth; Steven Roth; Kasper M A Rouschop; Benoit D Roussel; Sophie Roux; Patrizia Rovere-Querini; Ajit Roy; Aurore Rozieres; Diego Ruano; David C Rubinsztein; Maria P Rubtsova; Klaus Ruckdeschel; Christoph Ruckenstuhl; Emil Rudolf; Rüdiger Rudolf; Alessandra Ruggieri; Avnika Ashok Ruparelia; Paola Rusmini; Ryan R Russell; Gian Luigi Russo; Maria Russo; Rossella Russo; Oxana O Ryabaya; Kevin M Ryan; Kwon-Yul Ryu; Maria Sabater-Arcis; Ulka Sachdev; Michael Sacher; Carsten Sachse; Abhishek Sadhu; Junichi Sadoshima; Nathaniel Safren; Paul Saftig; Antonia P Sagona; Gaurav Sahay; Amirhossein Sahebkar; Mustafa Sahin; Ozgur Sahin; Sumit Sahni; Nayuta Saito; Shigeru Saito; Tsunenori Saito; Ryohei Sakai; Yasuyoshi Sakai; Jun-Ichi Sakamaki; Kalle Saksela; Gloria Salazar; Anna Salazar-Degracia; Ghasem H Salekdeh; Ashok K Saluja; Belém Sampaio-Marques; Maria Cecilia Sanchez; Jose A Sanchez-Alcazar; Victoria Sanchez-Vera; Vanessa Sancho-Shimizu; J Thomas Sanderson; Marco Sandri; Stefano Santaguida; Laura Santambrogio; Magda M Santana; Giorgio Santoni; Alberto Sanz; Pascual Sanz; Shweta Saran; Marco Sardiello; Timothy J Sargeant; Apurva Sarin; Chinmoy Sarkar; Sovan Sarkar; Maria-Rosa Sarrias; Surajit Sarkar; Dipanka Tanu Sarmah; Jaakko Sarparanta; Aishwarya Sathyanarayan; Ranganayaki Sathyanarayanan; K Matthew Scaglione; Francesca Scatozza; Liliana Schaefer; Zachary T Schafer; Ulrich E Schaible; Anthony H V Schapira; Michael Scharl; Hermann M Schatzl; Catherine H Schein; Wiep Scheper; David Scheuring; Maria Vittoria Schiaffino; Monica Schiappacassi; Rainer Schindl; Uwe Schlattner; Oliver Schmidt; Roland Schmitt; Stephen D Schmidt; Ingo Schmitz; Eran Schmukler; Anja Schneider; Bianca E Schneider; Romana Schober; Alejandra C Schoijet; Micah B Schott; Michael Schramm; Bernd Schröder; Kai Schuh; Christoph Schüller; Ryan J Schulze; Lea Schürmanns; Jens C Schwamborn; Melanie Schwarten; Filippo Scialo; Sebastiano Sciarretta; Melanie J Scott; Kathleen W Scotto; A Ivana Scovassi; Andrea Scrima; Aurora Scrivo; David Sebastian; Salwa Sebti; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Iban Seiliez; Ekihiro Seki; Scott B Selleck; Frank W Sellke; Joshua T Selsby; Michael Sendtner; Serif Senturk; Elena Seranova; Consolato Sergi; Ruth Serra-Moreno; Hiromi Sesaki; Carmine Settembre; Subba Rao Gangi Setty; Gianluca Sgarbi; Ou Sha; John J Shacka; Javeed A Shah; Dantong Shang; Changshun Shao; Feng Shao; Soroush Sharbati; Lisa M Sharkey; Dipali Sharma; Gaurav Sharma; Kulbhushan Sharma; Pawan Sharma; Surendra Sharma; Han-Ming Shen; Hongtao Shen; Jiangang Shen; Ming Shen; Weili Shen; Zheni Shen; Rui Sheng; Zhi Sheng; Zu-Hang Sheng; Jianjian Shi; Xiaobing Shi; Ying-Hong Shi; Kahori Shiba-Fukushima; Jeng-Jer Shieh; Yohta Shimada; Shigeomi Shimizu; Makoto Shimozawa; Takahiro Shintani; Christopher J Shoemaker; Shahla Shojaei; Ikuo Shoji; Bhupendra V Shravage; Viji Shridhar; Chih-Wen Shu; Hong-Bing Shu; Ke Shui; Arvind K Shukla; Timothy E Shutt; Valentina Sica; Aleem Siddiqui; Amanda Sierra; Virginia Sierra-Torre; Santiago Signorelli; Payel Sil; Bruno J de Andrade Silva; Johnatas D Silva; Eduardo Silva-Pavez; Sandrine Silvente-Poirot; Rachel E Simmonds; Anna Katharina Simon; Hans-Uwe Simon; Matias Simons; Anurag Singh; Lalit P Singh; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Sudha B Singh; Sunaina Singh; Surinder Pal Singh; Debasish Sinha; Rohit Anthony Sinha; Sangita Sinha; Agnieszka Sirko; Kapil Sirohi; Efthimios L Sivridis; Panagiotis Skendros; Aleksandra Skirycz; Iva Slaninová; Soraya S Smaili; Andrei Smertenko; Matthew D Smith; Stefaan J Soenen; Eun Jung Sohn; Sophia P M Sok; Giancarlo Solaini; Thierry Soldati; Scott A Soleimanpour; Rosa M Soler; Alexei Solovchenko; Jason A Somarelli; Avinash Sonawane; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Kunhua Song; Zhiyin Song; Leandro R Soria; Maurizio Sorice; Alexander A Soukas; Sandra-Fausia Soukup; Diana Sousa; Nadia Sousa; Paul A Spagnuolo; Stephen A Spector; M M Srinivas Bharath; Daret St Clair; Venturina Stagni; Leopoldo Staiano; Clint A Stalnecker; Metodi V Stankov; Peter B Stathopulos; Katja Stefan; Sven Marcel Stefan; Leonidas Stefanis; Joan S Steffan; Alexander Steinkasserer; Harald Stenmark; Jared Sterneckert; Craig Stevens; Veronika Stoka; Stephan Storch; Björn Stork; Flavie Strappazzon; Anne Marie Strohecker; Dwayne G Stupack; Huanxing Su; Ling-Yan Su; Longxiang Su; Ana M Suarez-Fontes; Carlos S Subauste; Selvakumar Subbian; Paula V Subirada; Ganapasam Sudhandiran; Carolyn M Sue; Xinbing Sui; Corey Summers; Guangchao Sun; Jun Sun; Kang Sun; Meng-Xiang Sun; Qiming Sun; Yi Sun; Zhongjie Sun; Karen K S Sunahara; Eva Sundberg; Katalin Susztak; Peter Sutovsky; Hidekazu Suzuki; Gary Sweeney; J David Symons; Stephen Cho Wing Sze; Nathaniel J Szewczyk; Anna Tabęcka-Łonczynska; Claudio Tabolacci; Frank Tacke; Heinrich Taegtmeyer; Marco Tafani; Mitsuo Tagaya; Haoran Tai; Stephen W G Tait; Yoshinori Takahashi; Szabolcs Takats; Priti Talwar; Chit Tam; Shing Yau Tam; Davide Tampellini; Atsushi Tamura; Chong Teik Tan; Eng-King Tan; Ya-Qin Tan; Masaki Tanaka; Motomasa Tanaka; Daolin Tang; Jingfeng Tang; Tie-Shan Tang; Isei Tanida; Zhipeng Tao; Mohammed Taouis; Lars Tatenhorst; Nektarios Tavernarakis; Allen Taylor; Gregory A Taylor; Joan M Taylor; Elena Tchetina; Andrew R Tee; Irmgard Tegeder; David Teis; Natercia Teixeira; Fatima Teixeira-Clerc; Kumsal A Tekirdag; Tewin Tencomnao; Sandra Tenreiro; Alexei V Tepikin; Pilar S Testillano; Gianluca Tettamanti; Pierre-Louis Tharaux; Kathrin Thedieck; Arvind A Thekkinghat; Stefano Thellung; Josephine W Thinwa; V P Thirumalaikumar; Sufi Mary Thomas; Paul G Thomes; Andrew Thorburn; Lipi Thukral; Thomas Thum; Michael Thumm; Ling Tian; Ales Tichy; Andreas Till; Vincent Timmerman; Vladimir I Titorenko; Sokol V Todi; Krassimira Todorova; Janne M Toivonen; Luana Tomaipitinca; Dhanendra Tomar; Cristina Tomas-Zapico; Sergej Tomić; Benjamin Chun-Kit Tong; Chao Tong; Xin Tong; Sharon A Tooze; Maria L Torgersen; Satoru Torii; Liliana Torres-López; Alicia Torriglia; Christina G Towers; Roberto Towns; Shinya Toyokuni; Vladimir Trajkovic; Donatella Tramontano; Quynh-Giao Tran; Leonardo H Travassos; Charles B Trelford; Shirley Tremel; Ioannis P Trougakos; Betty P Tsao; Mario P Tschan; Hung-Fat Tse; Tak Fu Tse; Hitoshi Tsugawa; Andrey S Tsvetkov; David A Tumbarello; Yasin Tumtas; María J Tuñón; Sandra Turcotte; Boris Turk; Vito Turk; Bradley J Turner; Richard I Tuxworth; Jessica K Tyler; Elena V Tyutereva; Yasuo Uchiyama; Aslihan Ugun-Klusek; Holm H Uhlig; Marzena Ułamek-Kozioł; Ilya V Ulasov; Midori Umekawa; Christian Ungermann; Rei Unno; Sylvie Urbe; Elisabet Uribe-Carretero; Suayib Üstün; Vladimir N Uversky; Thomas Vaccari; Maria I Vaccaro; Björn F Vahsen; Helin Vakifahmetoglu-Norberg; Rut Valdor; Maria J Valente; Ayelén Valko; Richard B Vallee; Angela M Valverde; Greet Van den Berghe; Stijn van der Veen; Luc Van Kaer; Jorg van Loosdregt; Sjoerd J L van Wijk; Wim Vandenberghe; Ilse Vanhorebeek; Marcos A Vannier-Santos; Nicola Vannini; M Cristina Vanrell; Chiara Vantaggiato; Gabriele Varano; Isabel Varela-Nieto; Máté Varga; M Helena Vasconcelos; Somya Vats; Demetrios G Vavvas; Ignacio Vega-Naredo; Silvia Vega-Rubin-de-Celis; Guillermo Velasco; Ariadna P Velázquez; Tibor Vellai; Edo Vellenga; Francesca Velotti; Mireille Verdier; Panayotis Verginis; Isabelle Vergne; Paul Verkade; Manish Verma; Patrik Verstreken; Tim Vervliet; Jörg Vervoorts; Alexandre T Vessoni; Victor M Victor; Michel Vidal; Chiara Vidoni; Otilia V Vieira; Richard D Vierstra; Sonia Viganó; Helena Vihinen; Vinoy Vijayan; Miquel Vila; Marçal Vilar; José M Villalba; Antonio Villalobo; Beatriz Villarejo-Zori; Francesc Villarroya; Joan Villarroya; Olivier Vincent; Cecile Vindis; Christophe Viret; Maria Teresa Viscomi; Dora Visnjic; Ilio Vitale; David J Vocadlo; Olga V Voitsekhovskaja; Cinzia Volonté; Mattia Volta; Marta Vomero; Clarissa Von Haefen; Marc A Vooijs; Wolfgang Voos; Ljubica Vucicevic; Richard Wade-Martins; Satoshi Waguri; Kenrick A Waite; Shuji Wakatsuki; David W Walker; Mark J Walker; Simon A Walker; Jochen Walter; Francisco G Wandosell; Bo Wang; Chao-Yung Wang; Chen Wang; Chenran Wang; Chenwei Wang; Cun-Yu Wang; Dong Wang; Fangyang Wang; Feng Wang; Fengming Wang; Guansong Wang; Han Wang; Hao Wang; Hexiang Wang; Hong-Gang Wang; Jianrong Wang; Jigang Wang; Jiou Wang; Jundong Wang; Kui Wang; Lianrong Wang; Liming Wang; Maggie Haitian Wang; Meiqing Wang; Nanbu Wang; Pengwei Wang; Peipei Wang; Ping Wang; Ping Wang; Qing Jun Wang; Qing Wang; Qing Kenneth Wang; Qiong A Wang; Wen-Tao Wang; Wuyang Wang; Xinnan Wang; Xuejun Wang; Yan Wang; Yanchang Wang; Yanzhuang Wang; Yen-Yun Wang; Yihua Wang; Yipeng Wang; Yu Wang; Yuqi Wang; Zhe Wang; Zhenyu Wang; Zhouguang Wang; Gary Warnes; Verena Warnsmann; Hirotaka Watada; Eizo Watanabe; Maxinne Watchon; Anna Wawrzyńska; Timothy E Weaver; Grzegorz Wegrzyn; Ann M Wehman; Huafeng Wei; Lei Wei; Taotao Wei; Yongjie Wei; Oliver H Weiergräber; Conrad C Weihl; Günther Weindl; Ralf Weiskirchen; Alan Wells; Runxia H Wen; Xin Wen; Antonia Werner; Beatrice Weykopf; Sally P Wheatley; J Lindsay Whitton; Alexander J Whitworth; Katarzyna Wiktorska; Manon E Wildenberg; Tom Wileman; Simon Wilkinson; Dieter Willbold; Brett Williams; Robin S B Williams; Roger L Williams; Peter R Williamson; Richard A Wilson; Beate Winner; Nathaniel J Winsor; Steven S Witkin; Harald Wodrich; Ute Woehlbier; Thomas Wollert; Esther Wong; Jack Ho Wong; Richard W Wong; Vincent Kam Wai Wong; W Wei-Lynn Wong; An-Guo Wu; Chengbiao Wu; Jian Wu; Junfang Wu; Kenneth K Wu; Min Wu; Shan-Ying Wu; Shengzhou Wu; Shu-Yan Wu; Shufang Wu; William K K Wu; Xiaohong Wu; Xiaoqing Wu; Yao-Wen Wu; Yihua Wu; Ramnik J Xavier; Hongguang Xia; Lixin Xia; Zhengyuan Xia; Ge Xiang; Jin Xiang; Mingliang Xiang; Wei Xiang; Bin Xiao; Guozhi Xiao; Hengyi Xiao; Hong-Tao Xiao; Jian Xiao; Lan Xiao; Shi Xiao; Yin Xiao; Baoming Xie; Chuan-Ming Xie; Min Xie; Yuxiang Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Congfeng Xu; En Xu; Haoxing Xu; Jing Xu; JinRong Xu; Liang Xu; Wen Wen Xu; Xiulong Xu; Yu Xue; Sokhna M S Yakhine-Diop; Masamitsu Yamaguchi; Osamu Yamaguchi; Ai Yamamoto; Shunhei Yamashina; Shengmin Yan; Shian-Jang Yan; Zhen Yan; Yasuo Yanagi; Chuanbin Yang; Dun-Sheng Yang; Huan Yang; Huang-Tian Yang; Hui Yang; Jin-Ming Yang; Jing Yang; Jingyu Yang; Ling Yang; Liu Yang; Ming Yang; Pei-Ming Yang; Qian Yang; Seungwon Yang; Shu Yang; Shun-Fa Yang; Wannian Yang; Wei Yuan Yang; Xiaoyong Yang; Xuesong Yang; Yi Yang; Ying Yang; Honghong Yao; Shenggen Yao; Xiaoqiang Yao; Yong-Gang Yao; Yong-Ming Yao; Takahiro Yasui; Meysam Yazdankhah; Paul M Yen; Cong Yi; Xiao-Ming Yin; Yanhai Yin; Zhangyuan Yin; Ziyi Yin; Meidan Ying; Zheng Ying; Calvin K Yip; Stephanie Pei Tung Yiu; Young H Yoo; Kiyotsugu Yoshida; Saori R Yoshii; Tamotsu Yoshimori; Bahman Yousefi; Boxuan Yu; Haiyang Yu; Jun Yu; Jun Yu; Li Yu; Ming-Lung Yu; Seong-Woon Yu; Victor C Yu; W Haung Yu; Zhengping Yu; Zhou Yu; Junying Yuan; Ling-Qing Yuan; Shilin Yuan; Shyng-Shiou F Yuan; Yanggang Yuan; Zengqiang Yuan; Jianbo Yue; Zhenyu Yue; Jeanho Yun; Raymond L Yung; David N Zacks; Gabriele Zaffagnini; Vanessa O Zambelli; Isabella Zanella; Qun S Zang; Sara Zanivan; Silvia Zappavigna; Pilar Zaragoza; Konstantinos S Zarbalis; Amir Zarebkohan; Amira Zarrouk; Scott O Zeitlin; Jialiu Zeng; Ju-Deng Zeng; Eva Žerovnik; Lixuan Zhan; Bin Zhang; Donna D Zhang; Hanlin Zhang; Hong Zhang; Hong Zhang; Honghe Zhang; Huafeng Zhang; Huaye Zhang; Hui Zhang; Hui-Ling Zhang; Jianbin Zhang; Jianhua Zhang; Jing-Pu Zhang; Kalin Y B Zhang; Leshuai W Zhang; Lin Zhang; Lisheng Zhang; Lu Zhang; Luoying Zhang; Menghuan Zhang; Peng Zhang; Sheng Zhang; Wei Zhang; Xiangnan Zhang; Xiao-Wei Zhang; Xiaolei Zhang; Xiaoyan Zhang; Xin Zhang; Xinxin Zhang; Xu Dong Zhang; Yang Zhang; Yanjin Zhang; Yi Zhang; Ying-Dong Zhang; Yingmei Zhang; Yuan-Yuan Zhang; Yuchen Zhang; Zhe Zhang; Zhengguang Zhang; Zhibing Zhang; Zhihai Zhang; Zhiyong Zhang; Zili Zhang; Haobin Zhao; Lei Zhao; Shuang Zhao; Tongbiao Zhao; Xiao-Fan Zhao; Ying Zhao; Yongchao Zhao; Yongliang Zhao; Yuting Zhao; Guoping Zheng; Kai Zheng; Ling Zheng; Shizhong Zheng; Xi-Long Zheng; Yi Zheng; Zu-Guo Zheng; Boris Zhivotovsky; Qing Zhong; Ao Zhou; Ben Zhou; Cefan Zhou; Gang Zhou; Hao Zhou; Hong Zhou; Hongbo Zhou; Jie Zhou; Jing Zhou; Jing Zhou; Jiyong Zhou; Kailiang Zhou; Rongjia Zhou; Xu-Jie Zhou; Yanshuang Zhou; Yinghong Zhou; Yubin Zhou; Zheng-Yu Zhou; Zhou Zhou; Binglin Zhu; Changlian Zhu; Guo-Qing Zhu; Haining Zhu; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Yanping Zhu; Yushan Zhu; Haixia Zhuang; Xiaohong Zhuang; Katarzyna Zientara-Rytter; Christine M Zimmermann; Elena Ziviani; Teresa Zoladek; Wei-Xing Zong; Dmitry B Zorov; Antonio Zorzano; Weiping Zou; Zhen Zou; Zhengzhi Zou; Steven Zuryn; Werner Zwerschke; Beate Brand-Saberi; X Charlie Dong; Chandra Shekar Kenchappa; Zuguo Li; Yong Lin; Shigeru Oshima; Yueguang Rong; Judith C Sluimer; Christina L Stallings; Chun-Kit Tong
Journal:  Autophagy       Date:  2021-02-08       Impact factor: 13.391

7.  A genetic screen and transcript profiling reveal a shared regulatory program for Drosophila linker histone H1 and chromatin remodeler CHD1.

Authors:  Harsh Kavi; Xingwu Lu; Na Xu; Boris A Bartholdy; Elena Vershilova; Arthur I Skoultchi; Dmitry V Fyodorov
Journal:  G3 (Bethesda)       Date:  2015-01-27       Impact factor: 3.154

Review 8.  How to take autophagy and endocytosis up a notch.

Authors:  Julia M I Barth; Katja Köhler
Journal:  Biomed Res Int       Date:  2014-04-22       Impact factor: 3.411

9.  Guidelines for the use and interpretation of assays for monitoring autophagy (3rd edition).

Authors:  Daniel J Klionsky; Kotb Abdelmohsen; Akihisa Abe; Md Joynal Abedin; Hagai Abeliovich; Abraham Acevedo Arozena; Hiroaki Adachi; Christopher M Adams; Peter D Adams; Khosrow Adeli; Peter J Adhihetty; Sharon G Adler; Galila Agam; Rajesh Agarwal; Manish K Aghi; Maria Agnello; Patrizia Agostinis; Patricia V Aguilar; Julio Aguirre-Ghiso; Edoardo M Airoldi; Slimane Ait-Si-Ali; Takahiko Akematsu; Emmanuel T Akporiaye; Mohamed Al-Rubeai; Guillermo M Albaiceta; Chris Albanese; Diego Albani; Matthew L Albert; Jesus Aldudo; Hana Algül; Mehrdad Alirezaei; Iraide Alloza; Alexandru Almasan; Maylin Almonte-Beceril; Emad S Alnemri; Covadonga Alonso; Nihal Altan-Bonnet; Dario C Altieri; Silvia Alvarez; Lydia Alvarez-Erviti; Sandro Alves; Giuseppina Amadoro; Atsuo Amano; Consuelo Amantini; Santiago Ambrosio; Ivano Amelio; Amal O Amer; Mohamed Amessou; Angelika Amon; Zhenyi An; Frank A Anania; Stig U Andersen; Usha P Andley; Catherine K Andreadi; Nathalie Andrieu-Abadie; Alberto Anel; David K Ann; Shailendra Anoopkumar-Dukie; Manuela Antonioli; Hiroshi Aoki; Nadezda Apostolova; Saveria Aquila; Katia Aquilano; Koichi Araki; Eli Arama; Agustin Aranda; Jun Araya; Alexandre Arcaro; Esperanza Arias; Hirokazu Arimoto; Aileen R Ariosa; Jane L Armstrong; Thierry Arnould; Ivica Arsov; Katsuhiko Asanuma; Valerie Askanas; Eric Asselin; Ryuichiro Atarashi; Sally S Atherton; Julie D Atkin; Laura D Attardi; Patrick Auberger; Georg Auburger; Laure Aurelian; Riccardo Autelli; Laura Avagliano; Maria Laura Avantaggiati; Limor Avrahami; Suresh Awale; Neelam Azad; Tiziana Bachetti; Jonathan M Backer; Dong-Hun Bae; Jae-Sung Bae; Ok-Nam Bae; Soo Han Bae; Eric H Baehrecke; Seung-Hoon Baek; Stephen Baghdiguian; Agnieszka Bagniewska-Zadworna; Hua Bai; Jie Bai; Xue-Yuan Bai; Yannick Bailly; Kithiganahalli Narayanaswamy Balaji; Walter Balduini; Andrea Ballabio; Rena Balzan; Rajkumar Banerjee; Gábor Bánhegyi; Haijun Bao; Benoit Barbeau; Maria D Barrachina; Esther Barreiro; Bonnie Bartel; Alberto Bartolomé; Diane C Bassham; Maria Teresa Bassi; Robert C Bast; Alakananda Basu; Maria Teresa Batista; Henri Batoko; Maurizio Battino; Kyle Bauckman; Bradley L Baumgarner; K Ulrich Bayer; Rupert Beale; Jean-François Beaulieu; George R Beck; Christoph Becker; J David Beckham; Pierre-André Bédard; Patrick J Bednarski; Thomas J Begley; Christian Behl; Christian Behrends; Georg Mn Behrens; Kevin E Behrns; Eloy Bejarano; Amine Belaid; Francesca Belleudi; Giovanni Bénard; Guy Berchem; Daniele Bergamaschi; Matteo Bergami; Ben Berkhout; Laura Berliocchi; Amélie Bernard; Monique Bernard; Francesca Bernassola; Anne Bertolotti; Amanda S Bess; Sébastien Besteiro; Saverio Bettuzzi; Savita Bhalla; Shalmoli Bhattacharyya; Sujit K Bhutia; Caroline Biagosch; Michele Wolfe Bianchi; Martine Biard-Piechaczyk; Viktor Billes; Claudia Bincoletto; Baris Bingol; Sara W Bird; Marc Bitoun; Ivana Bjedov; Craig Blackstone; Lionel Blanc; Guillermo A Blanco; Heidi Kiil Blomhoff; Emilio Boada-Romero; Stefan Böckler; Marianne Boes; Kathleen Boesze-Battaglia; Lawrence H Boise; Alessandra Bolino; Andrea Boman; Paolo Bonaldo; Matteo Bordi; Jürgen Bosch; Luis M Botana; Joelle Botti; German Bou; Marina Bouché; Marion Bouchecareilh; Marie-Josée Boucher; Michael E Boulton; Sebastien G Bouret; Patricia Boya; Michaël Boyer-Guittaut; Peter V Bozhkov; Nathan Brady; Vania Mm Braga; Claudio Brancolini; Gerhard H Braus; José M Bravo-San Pedro; Lisa A Brennan; Emery H Bresnick; Patrick Brest; Dave Bridges; Marie-Agnès Bringer; Marisa Brini; Glauber C Brito; Bertha Brodin; Paul S Brookes; Eric J Brown; Karen Brown; Hal E Broxmeyer; Alain Bruhat; Patricia Chakur Brum; John H Brumell; Nicola Brunetti-Pierri; Robert J Bryson-Richardson; Shilpa Buch; Alastair M Buchan; Hikmet Budak; Dmitry V Bulavin; Scott J Bultman; Geert Bultynck; Vladimir Bumbasirevic; Yan Burelle; Robert E Burke; Margit Burmeister; Peter Bütikofer; Laura Caberlotto; Ken Cadwell; Monika Cahova; Dongsheng Cai; Jingjing Cai; Qian Cai; Sara Calatayud; Nadine Camougrand; Michelangelo Campanella; Grant R Campbell; Matthew Campbell; Silvia Campello; Robin Candau; Isabella Caniggia; Lavinia Cantoni; Lizhi Cao; Allan B Caplan; Michele Caraglia; Claudio Cardinali; Sandra Morais Cardoso; Jennifer S Carew; Laura A Carleton; Cathleen R Carlin; Silvia Carloni; Sven R Carlsson; Didac Carmona-Gutierrez; Leticia Am Carneiro; Oliana Carnevali; Serena Carra; Alice Carrier; Bernadette Carroll; Caty Casas; Josefina Casas; Giuliana Cassinelli; Perrine Castets; Susana Castro-Obregon; Gabriella Cavallini; Isabella Ceccherini; Francesco Cecconi; Arthur I Cederbaum; Valentín Ceña; Simone Cenci; Claudia Cerella; Davide Cervia; Silvia Cetrullo; Hassan Chaachouay; Han-Jung Chae; Andrei S Chagin; Chee-Yin Chai; Gopal Chakrabarti; Georgios Chamilos; Edmond Yw Chan; Matthew Tv Chan; Dhyan Chandra; Pallavi Chandra; Chih-Peng Chang; Raymond Chuen-Chung Chang; Ta Yuan Chang; John C Chatham; Saurabh Chatterjee; Santosh Chauhan; Yongsheng Che; Michael E Cheetham; Rajkumar Cheluvappa; Chun-Jung Chen; Gang Chen; Guang-Chao Chen; Guoqiang Chen; Hongzhuan Chen; Jeff W Chen; Jian-Kang Chen; Min Chen; Mingzhou Chen; Peiwen Chen; Qi Chen; Quan Chen; Shang-Der Chen; Si Chen; Steve S-L Chen; Wei Chen; Wei-Jung Chen; Wen Qiang Chen; Wenli Chen; Xiangmei Chen; Yau-Hung Chen; Ye-Guang Chen; Yin Chen; Yingyu Chen; Yongshun Chen; Yu-Jen Chen; Yue-Qin Chen; Yujie Chen; Zhen Chen; Zhong Chen; Alan Cheng; Christopher Hk Cheng; Hua Cheng; Heesun Cheong; Sara Cherry; Jason Chesney; Chun Hei Antonio Cheung; Eric Chevet; Hsiang Cheng Chi; Sung-Gil Chi; Fulvio Chiacchiera; Hui-Ling Chiang; Roberto Chiarelli; Mario Chiariello; Marcello Chieppa; Lih-Shen Chin; Mario Chiong; Gigi Nc Chiu; Dong-Hyung Cho; Ssang-Goo Cho; William C Cho; Yong-Yeon Cho; Young-Seok Cho; Augustine Mk Choi; Eui-Ju Choi; Eun-Kyoung Choi; Jayoung Choi; Mary E Choi; Seung-Il Choi; Tsui-Fen Chou; Salem Chouaib; Divaker Choubey; Vinay Choubey; Kuan-Chih Chow; Kamal Chowdhury; Charleen T Chu; Tsung-Hsien Chuang; Taehoon Chun; Hyewon Chung; Taijoon Chung; Yuen-Li Chung; Yong-Joon Chwae; Valentina Cianfanelli; Roberto Ciarcia; Iwona A Ciechomska; Maria Rosa Ciriolo; Mara Cirone; Sofie Claerhout; Michael J Clague; Joan Clària; Peter Gh Clarke; Robert Clarke; Emilio Clementi; Cédric Cleyrat; Miriam Cnop; Eliana M Coccia; Tiziana Cocco; Patrice Codogno; Jörn Coers; Ezra Ew Cohen; David Colecchia; Luisa Coletto; Núria S Coll; Emma Colucci-Guyon; Sergio Comincini; Maria Condello; Katherine L Cook; Graham H Coombs; Cynthia D Cooper; J Mark Cooper; Isabelle Coppens; Maria Tiziana Corasaniti; Marco Corazzari; Ramon Corbalan; Elisabeth Corcelle-Termeau; Mario D Cordero; Cristina Corral-Ramos; Olga Corti; Andrea Cossarizza; Paola Costelli; Safia Costes; Susan L Cotman; Ana Coto-Montes; Sandra Cottet; Eduardo Couve; Lori R Covey; L Ashley Cowart; Jeffery S Cox; Fraser P Coxon; Carolyn B Coyne; Mark S Cragg; Rolf J Craven; Tiziana Crepaldi; Jose L Crespo; Alfredo Criollo; Valeria Crippa; Maria Teresa Cruz; Ana Maria Cuervo; Jose M Cuezva; Taixing Cui; Pedro R Cutillas; Mark J Czaja; Maria F Czyzyk-Krzeska; Ruben K Dagda; Uta Dahmen; Chunsun Dai; Wenjie Dai; Yun Dai; Kevin N Dalby; Luisa Dalla Valle; Guillaume Dalmasso; Marcello D'Amelio; Markus Damme; Arlette Darfeuille-Michaud; Catherine Dargemont; Victor M Darley-Usmar; Srinivasan Dasarathy; Biplab Dasgupta; Srikanta Dash; Crispin R Dass; Hazel Marie Davey; Lester M Davids; David Dávila; Roger J Davis; Ted M Dawson; Valina L Dawson; Paula Daza; Jackie de Belleroche; Paul de Figueiredo; Regina Celia Bressan Queiroz de Figueiredo; José de la Fuente; Luisa De Martino; Antonella De Matteis; Guido Ry De Meyer; Angelo De Milito; Mauro De Santi; Wanderley de Souza; Vincenzo De Tata; Daniela De Zio; Jayanta Debnath; Reinhard Dechant; Jean-Paul Decuypere; Shane Deegan; Benjamin Dehay; Barbara Del Bello; Dominic P Del Re; Régis Delage-Mourroux; Lea Md Delbridge; Louise Deldicque; Elizabeth Delorme-Axford; Yizhen Deng; Joern Dengjel; Melanie Denizot; Paul Dent; Channing J Der; Vojo Deretic; Benoît Derrien; Eric Deutsch; Timothy P Devarenne; Rodney J Devenish; Sabrina Di Bartolomeo; Nicola Di Daniele; Fabio Di Domenico; Alessia Di Nardo; Simone Di Paola; Antonio Di Pietro; Livia Di Renzo; Aaron DiAntonio; Guillermo Díaz-Araya; Ines Díaz-Laviada; Maria T Diaz-Meco; Javier Diaz-Nido; Chad A Dickey; Robert C Dickson; Marc Diederich; Paul Digard; Ivan Dikic; Savithrama P Dinesh-Kumar; Chan Ding; Wen-Xing Ding; Zufeng Ding; Luciana Dini; Jörg Hw Distler; Abhinav Diwan; Mojgan Djavaheri-Mergny; Kostyantyn Dmytruk; Renwick Cj Dobson; Volker Doetsch; Karol Dokladny; Svetlana Dokudovskaya; Massimo Donadelli; X Charlie Dong; Xiaonan Dong; Zheng Dong; Terrence M Donohue; Kelly S Doran; Gabriella D'Orazi; Gerald W Dorn; Victor Dosenko; Sami Dridi; Liat Drucker; Jie Du; Li-Lin Du; Lihuan Du; André du Toit; Priyamvada Dua; Lei Duan; Pu Duann; Vikash Kumar Dubey; Michael R Duchen; Michel A Duchosal; Helene Duez; Isabelle Dugail; Verónica I Dumit; Mara C Duncan; Elaine A Dunlop; William A Dunn; Nicolas Dupont; Luc Dupuis; Raúl V Durán; Thomas M Durcan; Stéphane Duvezin-Caubet; Umamaheswar Duvvuri; Vinay Eapen; Darius Ebrahimi-Fakhari; Arnaud Echard; Leopold Eckhart; Charles L Edelstein; Aimee L Edinger; Ludwig Eichinger; Tobias Eisenberg; Avital Eisenberg-Lerner; N Tony Eissa; Wafik S El-Deiry; Victoria El-Khoury; Zvulun Elazar; Hagit Eldar-Finkelman; Chris Jh Elliott; Enzo Emanuele; Urban Emmenegger; Nikolai Engedal; Anna-Mart Engelbrecht; Simone Engelender; Jorrit M Enserink; Ralf Erdmann; Jekaterina Erenpreisa; Rajaraman Eri; Jason L Eriksen; Andreja Erman; Ricardo Escalante; Eeva-Liisa Eskelinen; Lucile Espert; Lorena Esteban-Martínez; Thomas J Evans; Mario Fabri; Gemma Fabrias; Cinzia Fabrizi; Antonio Facchiano; Nils J Færgeman; Alberto Faggioni; W Douglas Fairlie; Chunhai Fan; Daping Fan; Jie Fan; Shengyun Fang; Manolis Fanto; Alessandro Fanzani; Thomas Farkas; Mathias Faure; Francois B Favier; Howard Fearnhead; Massimo Federici; Erkang Fei; Tania C Felizardo; Hua Feng; Yibin Feng; Yuchen Feng; Thomas A Ferguson; Álvaro F Fernández; Maite G Fernandez-Barrena; Jose C Fernandez-Checa; Arsenio Fernández-López; Martin E Fernandez-Zapico; Olivier Feron; Elisabetta Ferraro; Carmen Veríssima Ferreira-Halder; Laszlo Fesus; Ralph Feuer; Fabienne C Fiesel; Eduardo C Filippi-Chiela; Giuseppe Filomeni; Gian Maria Fimia; John H Fingert; Steven Finkbeiner; Toren Finkel; Filomena Fiorito; Paul B Fisher; Marc Flajolet; Flavio Flamigni; Oliver Florey; Salvatore Florio; R Andres Floto; Marco Folini; Carlo Follo; Edward A Fon; Francesco Fornai; Franco Fortunato; Alessandro Fraldi; Rodrigo Franco; Arnaud Francois; Aurélie François; Lisa B Frankel; Iain Dc Fraser; Norbert Frey; Damien G Freyssenet; Christian Frezza; Scott L Friedman; Daniel E Frigo; Dongxu Fu; José M Fuentes; Juan Fueyo; Yoshio Fujitani; Yuuki Fujiwara; Mikihiro Fujiya; Mitsunori Fukuda; Simone Fulda; Carmela Fusco; Bozena Gabryel; Matthias Gaestel; Philippe Gailly; Malgorzata Gajewska; Sehamuddin Galadari; Gad Galili; Inmaculada Galindo; Maria F Galindo; Giovanna Galliciotti; Lorenzo Galluzzi; Luca Galluzzi; Vincent Galy; Noor Gammoh; Sam Gandy; Anand K Ganesan; Swamynathan Ganesan; Ian G Ganley; Monique Gannagé; Fen-Biao Gao; Feng Gao; Jian-Xin Gao; Lorena García Nannig; Eleonora García Véscovi; Marina Garcia-Macía; Carmen Garcia-Ruiz; Abhishek D Garg; Pramod Kumar Garg; Ricardo Gargini; Nils Christian Gassen; Damián Gatica; Evelina Gatti; Julie Gavard; Evripidis Gavathiotis; Liang Ge; Pengfei Ge; Shengfang Ge; Po-Wu Gean; Vania Gelmetti; Armando A Genazzani; Jiefei Geng; Pascal Genschik; Lisa Gerner; Jason E Gestwicki; David A Gewirtz; Saeid Ghavami; Eric Ghigo; Debabrata Ghosh; Anna Maria Giammarioli; Francesca Giampieri; Claudia Giampietri; Alexandra Giatromanolaki; Derrick J Gibbings; Lara Gibellini; Spencer B Gibson; Vanessa Ginet; Antonio Giordano; Flaviano Giorgini; Elisa Giovannetti; Stephen E Girardin; Suzana Gispert; Sandy Giuliano; Candece L Gladson; Alvaro Glavic; Martin Gleave; Nelly Godefroy; Robert M Gogal; Kuppan Gokulan; Gustavo H Goldman; Delia Goletti; Michael S Goligorsky; Aldrin V Gomes; Ligia C Gomes; Hernando Gomez; Candelaria Gomez-Manzano; Rubén Gómez-Sánchez; Dawit Ap Gonçalves; Ebru Goncu; Qingqiu Gong; Céline Gongora; Carlos B Gonzalez; Pedro Gonzalez-Alegre; Pilar Gonzalez-Cabo; Rosa Ana González-Polo; Ing Swie Goping; Carlos Gorbea; Nikolai V Gorbunov; Daphne R Goring; Adrienne M Gorman; Sharon M Gorski; Sandro Goruppi; Shino Goto-Yamada; Cecilia Gotor; Roberta A Gottlieb; Illana Gozes; Devrim Gozuacik; Yacine Graba; Martin Graef; Giovanna E Granato; Gary Dean Grant; Steven Grant; Giovanni Luca Gravina; Douglas R Green; Alexander Greenhough; Michael T Greenwood; Benedetto Grimaldi; Frédéric Gros; Charles Grose; Jean-Francois Groulx; Florian Gruber; Paolo Grumati; Tilman Grune; Jun-Lin Guan; Kun-Liang Guan; Barbara Guerra; Carlos Guillen; Kailash Gulshan; Jan Gunst; Chuanyong Guo; Lei Guo; Ming Guo; Wenjie Guo; Xu-Guang Guo; Andrea A Gust; Åsa B Gustafsson; Elaine Gutierrez; Maximiliano G Gutierrez; Ho-Shin Gwak; Albert Haas; James E Haber; Shinji Hadano; Monica Hagedorn; David R Hahn; Andrew J Halayko; Anne Hamacher-Brady; Kozo Hamada; Ahmed Hamai; Andrea Hamann; Maho Hamasaki; Isabelle Hamer; Qutayba Hamid; Ester M Hammond; Feng Han; Weidong Han; James T Handa; John A Hanover; Malene Hansen; Masaru Harada; Ljubica Harhaji-Trajkovic; J Wade Harper; Abdel Halim Harrath; Adrian L Harris; James Harris; Udo Hasler; Peter Hasselblatt; Kazuhisa Hasui; Robert G Hawley; Teresa S Hawley; Congcong He; Cynthia Y He; Fengtian He; Gu He; Rong-Rong He; Xian-Hui He; You-Wen He; Yu-Ying He; Joan K Heath; Marie-Josée Hébert; Robert A Heinzen; Gudmundur Vignir Helgason; Michael Hensel; Elizabeth P Henske; Chengtao Her; Paul K Herman; Agustín Hernández; Carlos Hernandez; Sonia Hernández-Tiedra; Claudio Hetz; P Robin Hiesinger; Katsumi Higaki; Sabine Hilfiker; Bradford G Hill; Joseph A Hill; William D Hill; Keisuke Hino; Daniel Hofius; Paul Hofman; Günter U Höglinger; Jörg Höhfeld; Marina K Holz; Yonggeun Hong; David A Hood; Jeroen Jm Hoozemans; Thorsten Hoppe; Chin Hsu; Chin-Yuan Hsu; Li-Chung Hsu; Dong Hu; Guochang Hu; Hong-Ming Hu; Hongbo Hu; Ming Chang Hu; Yu-Chen Hu; Zhuo-Wei Hu; Fang Hua; Ya Hua; Canhua Huang; Huey-Lan Huang; Kuo-How Huang; Kuo-Yang Huang; Shile Huang; Shiqian Huang; Wei-Pang Huang; Yi-Ran Huang; Yong Huang; Yunfei Huang; Tobias B Huber; Patricia Huebbe; Won-Ki Huh; Juha J Hulmi; Gang Min Hur; James H Hurley; Zvenyslava Husak; Sabah Na Hussain; Salik Hussain; Jung Jin Hwang; Seungmin Hwang; Thomas Is Hwang; Atsuhiro Ichihara; Yuzuru Imai; Carol Imbriano; Megumi Inomata; Takeshi Into; Valentina Iovane; Juan L Iovanna; Renato V Iozzo; Nancy Y Ip; Javier E Irazoqui; Pablo Iribarren; Yoshitaka Isaka; Aleksandra J Isakovic; Harry Ischiropoulos; Jeffrey S Isenberg; Mohammad Ishaq; Hiroyuki Ishida; Isao Ishii; Jane E Ishmael; Ciro Isidoro; Ken-Ichi Isobe; Erika Isono; Shohreh Issazadeh-Navikas; Koji Itahana; Eisuke Itakura; Andrei I Ivanov; Anand Krishnan V Iyer; José M Izquierdo; Yotaro Izumi; Valentina Izzo; Marja Jäättelä; Nadia Jaber; Daniel John Jackson; William T Jackson; Tony George Jacob; Thomas S Jacques; Chinnaswamy Jagannath; Ashish Jain; Nihar Ranjan Jana; Byoung Kuk Jang; Alkesh Jani; Bassam Janji; Paulo Roberto Jannig; Patric J Jansson; Steve Jean; Marina Jendrach; Ju-Hong Jeon; Niels Jessen; Eui-Bae Jeung; Kailiang Jia; Lijun Jia; Hong Jiang; Hongchi Jiang; Liwen Jiang; Teng Jiang; Xiaoyan Jiang; Xuejun Jiang; Xuejun Jiang; Ying Jiang; Yongjun Jiang; Alberto Jiménez; Cheng Jin; Hongchuan Jin; Lei Jin; Meiyan Jin; Shengkan Jin; Umesh Kumar Jinwal; Eun-Kyeong Jo; Terje Johansen; Daniel E Johnson; Gail Vw Johnson; James D Johnson; Eric Jonasch; Chris Jones; Leo Ab Joosten; Joaquin Jordan; Anna-Maria Joseph; Bertrand Joseph; Annie M Joubert; Dianwen Ju; Jingfang Ju; Hsueh-Fen Juan; Katrin Juenemann; Gábor Juhász; Hye Seung Jung; Jae U Jung; Yong-Keun Jung; Heinz Jungbluth; Matthew J Justice; Barry Jutten; Nadeem O Kaakoush; Kai Kaarniranta; Allen Kaasik; Tomohiro Kabuta; Bertrand Kaeffer; Katarina Kågedal; Alon Kahana; Shingo Kajimura; Or Kakhlon; Manjula Kalia; Dhan V Kalvakolanu; Yoshiaki Kamada; Konstantinos Kambas; Vitaliy O Kaminskyy; Harm H Kampinga; Mustapha Kandouz; Chanhee Kang; Rui Kang; Tae-Cheon Kang; Tomotake Kanki; Thirumala-Devi Kanneganti; Haruo Kanno; Anumantha G Kanthasamy; Marc Kantorow; Maria Kaparakis-Liaskos; Orsolya Kapuy; Vassiliki Karantza; Md Razaul Karim; Parimal Karmakar; Arthur Kaser; Susmita Kaushik; Thomas Kawula; A Murat Kaynar; Po-Yuan Ke; Zun-Ji Ke; John H Kehrl; Kate E Keller; Jongsook Kim Kemper; Anne K Kenworthy; Oliver Kepp; Andreas Kern; Santosh Kesari; David Kessel; Robin Ketteler; Isis do Carmo Kettelhut; Bilon Khambu; Muzamil Majid Khan; Vinoth Km Khandelwal; Sangeeta Khare; Juliann G Kiang; Amy A Kiger; Akio Kihara; Arianna L Kim; Cheol Hyeon Kim; Deok Ryong Kim; Do-Hyung Kim; Eung Kweon Kim; Hye Young Kim; Hyung-Ryong Kim; Jae-Sung Kim; Jeong Hun Kim; Jin Cheon Kim; Jin Hyoung Kim; Kwang Woon Kim; Michael D Kim; Moon-Moo Kim; Peter K Kim; Seong Who Kim; Soo-Youl Kim; Yong-Sun Kim; Yonghyun Kim; Adi Kimchi; Alec C Kimmelman; Tomonori Kimura; Jason S King; Karla Kirkegaard; Vladimir Kirkin; Lorrie A Kirshenbaum; Shuji Kishi; Yasuo Kitajima; Katsuhiko Kitamoto; Yasushi Kitaoka; Kaio Kitazato; Rudolf A Kley; Walter T Klimecki; Michael Klinkenberg; Jochen Klucken; Helene Knævelsrud; Erwin Knecht; Laura Knuppertz; Jiunn-Liang Ko; Satoru Kobayashi; Jan C Koch; Christelle Koechlin-Ramonatxo; Ulrich Koenig; Young Ho Koh; Katja Köhler; Sepp D Kohlwein; Masato Koike; Masaaki Komatsu; Eiki Kominami; Dexin Kong; Hee Jeong Kong; Eumorphia G Konstantakou; Benjamin T Kopp; Tamas Korcsmaros; Laura Korhonen; Viktor I Korolchuk; Nadya V Koshkina; Yanjun Kou; Michael I Koukourakis; Constantinos Koumenis; Attila L Kovács; Tibor Kovács; Werner J Kovacs; Daisuke Koya; Claudine Kraft; Dimitri Krainc; Helmut Kramer; Tamara Kravic-Stevovic; Wilhelm Krek; Carole Kretz-Remy; Roswitha Krick; Malathi Krishnamurthy; Janos Kriston-Vizi; Guido Kroemer; Michael C Kruer; Rejko Kruger; Nicholas T Ktistakis; Kazuyuki Kuchitsu; Christian Kuhn; Addanki Pratap Kumar; Anuj Kumar; Ashok Kumar; Deepak Kumar; Dhiraj Kumar; Rakesh Kumar; Sharad Kumar; Mondira Kundu; Hsing-Jien Kung; Atsushi Kuno; Sheng-Han Kuo; Jeff Kuret; Tino Kurz; Terry Kwok; Taeg Kyu Kwon; Yong Tae Kwon; Irene Kyrmizi; Albert R La Spada; Frank Lafont; Tim Lahm; Aparna Lakkaraju; Truong Lam; Trond Lamark; Steve Lancel; Terry H Landowski; Darius J R Lane; Jon D Lane; Cinzia Lanzi; Pierre Lapaquette; Louis R Lapierre; Jocelyn Laporte; Johanna Laukkarinen; Gordon W Laurie; Sergio Lavandero; Lena Lavie; Matthew J LaVoie; Betty Yuen Kwan Law; Helen Ka-Wai Law; Kelsey B Law; Robert Layfield; Pedro A Lazo; Laurent Le Cam; Karine G Le Roch; Hervé Le Stunff; Vijittra Leardkamolkarn; Marc Lecuit; Byung-Hoon Lee; Che-Hsin Lee; Erinna F Lee; Gyun Min Lee; He-Jin Lee; Hsinyu Lee; Jae Keun Lee; Jongdae Lee; Ju-Hyun Lee; Jun Hee Lee; Michael Lee; Myung-Shik Lee; Patty J Lee; Sam W Lee; Seung-Jae Lee; Shiow-Ju Lee; Stella Y Lee; Sug Hyung Lee; Sung Sik Lee; Sung-Joon Lee; Sunhee Lee; Ying-Ray Lee; Yong J Lee; Young H Lee; Christiaan Leeuwenburgh; Sylvain Lefort; Renaud Legouis; Jinzhi Lei; Qun-Ying Lei; David A Leib; Gil Leibowitz; Istvan Lekli; Stéphane D Lemaire; John J Lemasters; Marius K Lemberg; Antoinette Lemoine; Shuilong Leng; Guido Lenz; Paola Lenzi; Lilach O Lerman; Daniele Lettieri Barbato; Julia I-Ju Leu; Hing Y Leung; Beth Levine; Patrick A Lewis; Frank Lezoualc'h; Chi Li; Faqiang Li; Feng-Jun Li; Jun Li; Ke Li; Lian Li; Min Li; Min Li; Qiang Li; Rui Li; Sheng Li; Wei Li; Wei Li; Xiaotao Li; Yumin Li; Jiqin Lian; Chengyu Liang; Qiangrong Liang; Yulin Liao; Joana Liberal; Pawel P Liberski; Pearl Lie; Andrew P Lieberman; Hyunjung Jade Lim; Kah-Leong Lim; Kyu Lim; Raquel T Lima; Chang-Shen Lin; Chiou-Feng Lin; Fang Lin; Fangming Lin; Fu-Cheng Lin; Kui Lin; Kwang-Huei Lin; Pei-Hui Lin; Tianwei Lin; Wan-Wan Lin; Yee-Shin Lin; Yong Lin; Rafael Linden; Dan Lindholm; Lisa M Lindqvist; Paul Lingor; Andreas Linkermann; Lance A Liotta; Marta M Lipinski; Vitor A Lira; Michael P Lisanti; Paloma B Liton; Bo Liu; Chong Liu; Chun-Feng Liu; Fei Liu; Hung-Jen Liu; Jianxun Liu; Jing-Jing Liu; Jing-Lan Liu; Ke Liu; Leyuan Liu; Liang Liu; Quentin Liu; Rong-Yu Liu; Shiming Liu; Shuwen Liu; Wei Liu; Xian-De Liu; Xiangguo Liu; Xiao-Hong Liu; Xinfeng Liu; Xu Liu; Xueqin Liu; Yang Liu; Yule Liu; Zexian Liu; Zhe Liu; Juan P Liuzzi; Gérard Lizard; Mila Ljujic; Irfan J Lodhi; Susan E Logue; Bal L Lokeshwar; Yun Chau Long; Sagar Lonial; Benjamin Loos; Carlos López-Otín; Cristina López-Vicario; Mar Lorente; Philip L Lorenzi; Péter Lõrincz; Marek Los; Michael T Lotze; Penny E Lovat; Binfeng Lu; Bo Lu; Jiahong Lu; Qing Lu; She-Min Lu; Shuyan Lu; Yingying Lu; Frédéric Luciano; Shirley Luckhart; John Milton Lucocq; Paula Ludovico; Aurelia Lugea; Nicholas W Lukacs; Julian J Lum; Anders H Lund; Honglin Luo; Jia Luo; Shouqing Luo; Claudio Luparello; Timothy Lyons; Jianjie Ma; Yi Ma; Yong Ma; Zhenyi Ma; Juliano Machado; Glaucia M Machado-Santelli; Fernando Macian; Gustavo C MacIntosh; Jeffrey P MacKeigan; Kay F Macleod; John D MacMicking; Lee Ann MacMillan-Crow; Frank Madeo; Muniswamy Madesh; Julio Madrigal-Matute; Akiko Maeda; Tatsuya Maeda; Gustavo Maegawa; Emilia Maellaro; Hannelore Maes; Marta Magariños; Kenneth Maiese; Tapas K Maiti; Luigi Maiuri; Maria Chiara Maiuri; Carl G Maki; Roland Malli; Walter Malorni; Alina Maloyan; Fathia Mami-Chouaib; Na Man; Joseph D Mancias; Eva-Maria Mandelkow; Michael A Mandell; Angelo A Manfredi; Serge N Manié; Claudia Manzoni; Kai Mao; Zixu Mao; Zong-Wan Mao; Philippe Marambaud; Anna Maria Marconi; Zvonimir Marelja; Gabriella Marfe; Marta Margeta; Eva Margittai; Muriel Mari; Francesca V Mariani; Concepcio Marin; Sara Marinelli; Guillermo Mariño; Ivanka Markovic; Rebecca Marquez; Alberto M Martelli; Sascha Martens; Katie R Martin; Seamus J Martin; Shaun Martin; Miguel A Martin-Acebes; Paloma Martín-Sanz; Camille Martinand-Mari; Wim Martinet; Jennifer Martinez; Nuria Martinez-Lopez; Ubaldo Martinez-Outschoorn; Moisés Martínez-Velázquez; Marta Martinez-Vicente; Waleska Kerllen Martins; Hirosato Mashima; James A Mastrianni; Giuseppe Matarese; Paola Matarrese; Roberto Mateo; Satoaki Matoba; Naomichi Matsumoto; Takehiko Matsushita; Akira Matsuura; Takeshi Matsuzawa; Mark P Mattson; Soledad Matus; Norma Maugeri; Caroline Mauvezin; Andreas Mayer; Dusica Maysinger; Guillermo D Mazzolini; Mary Kate McBrayer; Kimberly McCall; Craig McCormick; Gerald M McInerney; Skye C McIver; Sharon McKenna; John J McMahon; Iain A McNeish; Fatima Mechta-Grigoriou; Jan Paul Medema; Diego L Medina; Klara Megyeri; Maryam Mehrpour; Jawahar L Mehta; Yide Mei; Ute-Christiane Meier; Alfred J Meijer; Alicia Meléndez; Gerry Melino; Sonia Melino; Edesio Jose Tenorio de Melo; Maria A Mena; Marc D Meneghini; Javier A Menendez; Regina Menezes; Liesu Meng; Ling-Hua Meng; Songshu Meng; Rossella Menghini; A Sue Menko; Rubem Fs Menna-Barreto; Manoj B Menon; Marco A Meraz-Ríos; Giuseppe Merla; Luciano Merlini; Angelica M Merlot; Andreas Meryk; Stefania Meschini; Joel N Meyer; Man-Tian Mi; Chao-Yu Miao; Lucia Micale; Simon Michaeli; Carine Michiels; Anna Rita Migliaccio; Anastasia Susie Mihailidou; Dalibor Mijaljica; Katsuhiko Mikoshiba; Enrico Milan; Leonor Miller-Fleming; Gordon B Mills; Ian G Mills; Georgia Minakaki; Berge A Minassian; Xiu-Fen Ming; Farida Minibayeva; Elena A Minina; Justine D Mintern; Saverio Minucci; Antonio Miranda-Vizuete; Claire H Mitchell; Shigeki Miyamoto; Keisuke Miyazawa; Noboru Mizushima; Katarzyna Mnich; Baharia Mograbi; Simin Mohseni; Luis Ferreira Moita; Marco Molinari; Maurizio Molinari; Andreas Buch Møller; Bertrand Mollereau; Faustino Mollinedo; Marco Mongillo; Martha M Monick; Serena Montagnaro; Craig Montell; Darren J Moore; Michael N Moore; Rodrigo Mora-Rodriguez; Paula I Moreira; Etienne Morel; Maria Beatrice Morelli; Sandra Moreno; Michael J Morgan; Arnaud Moris; Yuji Moriyasu; Janna L Morrison; Lynda A Morrison; Eugenia Morselli; Jorge Moscat; Pope L Moseley; Serge Mostowy; Elisa Motori; Denis Mottet; Jeremy C Mottram; Charbel E-H Moussa; Vassiliki E Mpakou; Hasan Mukhtar; Jean M Mulcahy Levy; Sylviane Muller; Raquel Muñoz-Moreno; Cristina Muñoz-Pinedo; Christian Münz; Maureen E Murphy; James T Murray; Aditya Murthy; Indira U Mysorekar; Ivan R Nabi; Massimo Nabissi; Gustavo A Nader; Yukitoshi Nagahara; Yoshitaka Nagai; Kazuhiro Nagata; Anika Nagelkerke; Péter Nagy; Samisubbu R Naidu; Sreejayan Nair; Hiroyasu Nakano; Hitoshi Nakatogawa; Meera Nanjundan; Gennaro Napolitano; Naweed I Naqvi; Roberta Nardacci; Derek P Narendra; Masashi Narita; Anna Chiara Nascimbeni; Ramesh Natarajan; Luiz C Navegantes; Steffan T Nawrocki; Taras Y Nazarko; Volodymyr Y Nazarko; Thomas Neill; Luca M Neri; Mihai G Netea; Romana T Netea-Maier; Bruno M Neves; Paul A Ney; Ioannis P Nezis; Hang Tt Nguyen; Huu Phuc Nguyen; Anne-Sophie Nicot; Hilde Nilsen; Per Nilsson; Mikio Nishimura; Ichizo Nishino; Mireia Niso-Santano; Hua Niu; Ralph A Nixon; Vincent Co Njar; Takeshi Noda; Angelika A Noegel; Elsie Magdalena Nolte; Erik Norberg; Koenraad K Norga; Sakineh Kazemi Noureini; Shoji Notomi; Lucia Notterpek; Karin Nowikovsky; Nobuyuki Nukina; Thorsten Nürnberger; Valerie B O'Donnell; Tracey O'Donovan; Peter J O'Dwyer; Ina Oehme; Clara L Oeste; Michinaga Ogawa; Besim Ogretmen; Yuji Ogura; Young J Oh; Masaki Ohmuraya; Takayuki Ohshima; Rani Ojha; Koji Okamoto; Toshiro Okazaki; F Javier Oliver; Karin Ollinger; Stefan Olsson; Daniel P Orban; Paulina Ordonez; Idil Orhon; Laszlo Orosz; Eyleen J O'Rourke; Helena Orozco; Angel L Ortega; Elena Ortona; Laura D Osellame; Junko Oshima; Shigeru Oshima; Heinz D Osiewacz; Takanobu Otomo; Kinya Otsu; Jing-Hsiung James Ou; Tiago F Outeiro; Dong-Yun Ouyang; Hongjiao Ouyang; Michael Overholtzer; Michelle A Ozbun; P Hande Ozdinler; Bulent Ozpolat; Consiglia Pacelli; Paolo Paganetti; Guylène Page; Gilles Pages; Ugo Pagnini; Beata Pajak; Stephen C Pak; Karolina Pakos-Zebrucka; Nazzy Pakpour; Zdena Palková; Francesca Palladino; Kathrin Pallauf; Nicolas Pallet; Marta Palmieri; Søren R Paludan; Camilla Palumbo; Silvia Palumbo; Olatz Pampliega; Hongming Pan; Wei Pan; Theocharis Panaretakis; Aseem Pandey; Areti Pantazopoulou; Zuzana Papackova; Daniela L Papademetrio; Issidora Papassideri; Alessio Papini; Nirmala Parajuli; Julian Pardo; Vrajesh V Parekh; Giancarlo Parenti; Jong-In Park; Junsoo Park; Ohkmae K Park; Roy Parker; Rosanna Parlato; Jan B Parys; Katherine R Parzych; Jean-Max Pasquet; Benoit Pasquier; Kishore Bs Pasumarthi; Daniel Patschan; Cam Patterson; Sophie Pattingre; Scott Pattison; Arnim Pause; Hermann Pavenstädt; Flaminia Pavone; Zully Pedrozo; Fernando J Peña; Miguel A Peñalva; Mario Pende; Jianxin Peng; Fabio Penna; Josef M Penninger; Anna Pensalfini; Salvatore Pepe; Gustavo Js Pereira; Paulo C Pereira; Verónica Pérez-de la Cruz; María Esther Pérez-Pérez; Diego Pérez-Rodríguez; Dolores Pérez-Sala; Celine Perier; Andras Perl; David H Perlmutter; Ida Perrotta; Shazib Pervaiz; Maija Pesonen; Jeffrey E Pessin; Godefridus J Peters; Morten Petersen; Irina Petrache; Basil J Petrof; Goran Petrovski; James M Phang; Mauro Piacentini; Marina Pierdominici; Philippe Pierre; Valérie Pierrefite-Carle; Federico Pietrocola; Felipe X Pimentel-Muiños; Mario Pinar; Benjamin Pineda; Ronit Pinkas-Kramarski; Marcello Pinti; Paolo Pinton; Bilal Piperdi; James M Piret; Leonidas C Platanias; Harald W Platta; Edward D Plowey; Stefanie Pöggeler; Marc Poirot; Peter Polčic; Angelo Poletti; Audrey H Poon; Hana Popelka; Blagovesta Popova; Izabela Poprawa; Shibu M Poulose; Joanna Poulton; Scott K Powers; Ted Powers; Mercedes Pozuelo-Rubio; Krisna Prak; Reinhild Prange; Mark Prescott; Muriel Priault; Sharon Prince; Richard L Proia; Tassula Proikas-Cezanne; Holger Prokisch; Vasilis J Promponas; Karin Przyklenk; Rosa Puertollano; Subbiah Pugazhenthi; Luigi Puglielli; Aurora Pujol; Julien Puyal; Dohun Pyeon; Xin Qi; Wen-Bin Qian; Zheng-Hong Qin; Yu Qiu; Ziwei Qu; Joe Quadrilatero; Frederick Quinn; Nina Raben; Hannah Rabinowich; Flavia Radogna; Michael J Ragusa; Mohamed Rahmani; Komal Raina; Sasanka Ramanadham; Rajagopal Ramesh; Abdelhaq Rami; Sarron Randall-Demllo; Felix Randow; Hai Rao; V Ashutosh Rao; Blake B Rasmussen; Tobias M Rasse; Edward A Ratovitski; Pierre-Emmanuel Rautou; Swapan K Ray; Babak Razani; Bruce H Reed; Fulvio Reggiori; Markus Rehm; Andreas S Reichert; Theo Rein; David J Reiner; Eric Reits; Jun Ren; Xingcong Ren; Maurizio Renna; Jane Eb Reusch; Jose L Revuelta; Leticia Reyes; Alireza R Rezaie; Robert I Richards; Des R Richardson; Clémence Richetta; Michael A Riehle; Bertrand H Rihn; Yasuko Rikihisa; Brigit E Riley; Gerald Rimbach; Maria Rita Rippo; Konstantinos Ritis; Federica Rizzi; Elizete Rizzo; Peter J Roach; Jeffrey Robbins; Michel Roberge; Gabriela Roca; Maria Carmela Roccheri; Sonia Rocha; Cecilia Mp Rodrigues; Clara I Rodríguez; Santiago Rodriguez de Cordoba; Natalia Rodriguez-Muela; Jeroen Roelofs; Vladimir V Rogov; Troy T Rohn; Bärbel Rohrer; Davide Romanelli; Luigina Romani; Patricia Silvia Romano; M Isabel G Roncero; Jose Luis Rosa; Alicia Rosello; Kirill V Rosen; Philip Rosenstiel; Magdalena Rost-Roszkowska; Kevin A Roth; Gael Roué; Mustapha Rouis; Kasper M Rouschop; Daniel T Ruan; Diego Ruano; David C Rubinsztein; Edmund B Rucker; Assaf Rudich; Emil Rudolf; Ruediger Rudolf; Markus A Ruegg; Carmen Ruiz-Roldan; Avnika Ashok Ruparelia; Paola Rusmini; David W Russ; Gian Luigi Russo; Giuseppe Russo; Rossella Russo; Tor Erik Rusten; Victoria Ryabovol; Kevin M Ryan; Stefan W Ryter; David M Sabatini; Michael Sacher; Carsten Sachse; Michael N Sack; Junichi Sadoshima; Paul Saftig; Ronit Sagi-Eisenberg; Sumit Sahni; Pothana Saikumar; Tsunenori Saito; Tatsuya Saitoh; Koichi Sakakura; Machiko Sakoh-Nakatogawa; Yasuhito Sakuraba; María Salazar-Roa; Paolo Salomoni; Ashok K Saluja; Paul M Salvaterra; Rosa Salvioli; Afshin Samali; Anthony Mj Sanchez; José A Sánchez-Alcázar; Ricardo Sanchez-Prieto; Marco Sandri; Miguel A Sanjuan; Stefano Santaguida; Laura Santambrogio; Giorgio Santoni; Claudia Nunes Dos Santos; Shweta Saran; Marco Sardiello; Graeme Sargent; Pallabi Sarkar; Sovan Sarkar; Maria Rosa Sarrias; Minnie M Sarwal; Chihiro Sasakawa; Motoko Sasaki; Miklos Sass; Ken Sato; Miyuki Sato; Joseph Satriano; Niramol Savaraj; Svetlana Saveljeva; Liliana Schaefer; Ulrich E Schaible; Michael Scharl; Hermann M Schatzl; Randy Schekman; Wiep Scheper; Alfonso Schiavi; Hyman M Schipper; Hana Schmeisser; Jens Schmidt; Ingo Schmitz; Bianca E Schneider; E Marion Schneider; Jaime L Schneider; Eric A Schon; Miriam J Schönenberger; Axel H Schönthal; Daniel F Schorderet; Bernd Schröder; Sebastian Schuck; Ryan J Schulze; Melanie Schwarten; Thomas L Schwarz; Sebastiano Sciarretta; Kathleen Scotto; A Ivana Scovassi; Robert A Screaton; Mark Screen; Hugo Seca; Simon Sedej; Laura Segatori; Nava Segev; Per O Seglen; Jose M Seguí-Simarro; Juan Segura-Aguilar; Ekihiro Seki; Christian Sell; Iban Seiliez; Clay F Semenkovich; Gregg L Semenza; Utpal Sen; Andreas L Serra; Ana Serrano-Puebla; Hiromi Sesaki; Takao Setoguchi; Carmine Settembre; John J Shacka; Ayesha N Shajahan-Haq; Irving M Shapiro; Shweta Sharma; Hua She; C-K James Shen; Chiung-Chyi Shen; Han-Ming Shen; Sanbing Shen; Weili Shen; Rui Sheng; Xianyong Sheng; Zu-Hang Sheng; Trevor G Shepherd; Junyan Shi; Qiang Shi; Qinghua Shi; Yuguang Shi; Shusaku Shibutani; Kenichi Shibuya; Yoshihiro Shidoji; Jeng-Jer Shieh; Chwen-Ming Shih; Yohta Shimada; Shigeomi Shimizu; Dong Wook Shin; Mari L Shinohara; Michiko Shintani; Takahiro Shintani; Tetsuo Shioi; Ken Shirabe; Ronit Shiri-Sverdlov; Orian Shirihai; Gordon C Shore; Chih-Wen Shu; Deepak Shukla; Andriy A Sibirny; Valentina Sica; Christina J Sigurdson; Einar M Sigurdsson; Puran Singh Sijwali; Beata Sikorska; Wilian A Silveira; Sandrine Silvente-Poirot; Gary A Silverman; Jan Simak; Thomas Simmet; Anna Katharina Simon; Hans-Uwe Simon; Cristiano Simone; Matias Simons; Anne Simonsen; Rajat Singh; Shivendra V Singh; Shrawan K Singh; Debasish Sinha; Sangita Sinha; Frank A Sinicrope; Agnieszka Sirko; Kapil Sirohi; Balindiwe Jn Sishi; Annie Sittler; Parco M Siu; Efthimios Sivridis; Anna Skwarska; Ruth Slack; Iva Slaninová; Nikolai Slavov; Soraya S Smaili; Keiran Sm Smalley; Duncan R Smith; Stefaan J Soenen; Scott A Soleimanpour; Anita Solhaug; Kumaravel Somasundaram; Jin H Son; Avinash Sonawane; Chunjuan Song; Fuyong Song; Hyun Kyu Song; Ju-Xian Song; Wei Song; Kai Y Soo; Anil K Sood; Tuck Wah Soong; Virawudh Soontornniyomkij; Maurizio Sorice; Federica Sotgia; David R Soto-Pantoja; Areechun Sotthibundhu; Maria João Sousa; Herman P Spaink; Paul N Span; Anne Spang; Janet D Sparks; Peter G Speck; Stephen A Spector; Claudia D Spies; Wolfdieter Springer; Daret St Clair; Alessandra Stacchiotti; Bart Staels; Michael T Stang; Daniel T Starczynowski; Petro Starokadomskyy; Clemens Steegborn; John W Steele; Leonidas Stefanis; Joan Steffan; Christine M Stellrecht; Harald Stenmark; Tomasz M Stepkowski; Stęphan T Stern; Craig Stevens; Brent R Stockwell; Veronika Stoka; Zuzana Storchova; Björn Stork; Vassilis Stratoulias; Dimitrios J Stravopodis; Pavel Strnad; Anne Marie Strohecker; Anna-Lena Ström; Per Stromhaug; Jiri Stulik; Yu-Xiong Su; Zhaoliang Su; Carlos S Subauste; Srinivasa Subramaniam; Carolyn M Sue; Sang Won Suh; Xinbing Sui; Supawadee Sukseree; David Sulzer; Fang-Lin Sun; Jiaren Sun; Jun Sun; Shi-Yong Sun; Yang Sun; Yi Sun; Yingjie Sun; Vinod Sundaramoorthy; Joseph Sung; Hidekazu Suzuki; Kuninori Suzuki; Naoki Suzuki; Tadashi Suzuki; Yuichiro J Suzuki; Michele S Swanson; Charles Swanton; Karl Swärd; Ghanshyam Swarup; Sean T Sweeney; Paul W Sylvester; Zsuzsanna Szatmari; Eva Szegezdi; Peter W Szlosarek; Heinrich Taegtmeyer; Marco Tafani; Emmanuel Taillebourg; Stephen Wg Tait; Krisztina Takacs-Vellai; Yoshinori Takahashi; Szabolcs Takáts; Genzou Takemura; Nagio Takigawa; Nicholas J Talbot; Elena Tamagno; Jerome Tamburini; Cai-Ping Tan; Lan Tan; Mei Lan Tan; Ming Tan; Yee-Joo Tan; Keiji Tanaka; Masaki Tanaka; Daolin Tang; Dingzhong Tang; Guomei Tang; Isei Tanida; Kunikazu Tanji; Bakhos A Tannous; Jose A Tapia; Inmaculada Tasset-Cuevas; Marc Tatar; Iman Tavassoly; Nektarios Tavernarakis; Allen Taylor; Graham S Taylor; Gregory A Taylor; J Paul Taylor; Mark J Taylor; Elena V Tchetina; Andrew R Tee; Fatima Teixeira-Clerc; Sucheta Telang; Tewin Tencomnao; Ba-Bie Teng; Ru-Jeng Teng; Faraj Terro; Gianluca Tettamanti; Arianne L Theiss; Anne E Theron; Kelly Jean Thomas; Marcos P Thomé; Paul G Thomes; Andrew Thorburn; Jeremy Thorner; Thomas Thum; Michael Thumm; Teresa Lm Thurston; Ling Tian; Andreas Till; Jenny Pan-Yun Ting; Vladimir I Titorenko; Lilach Toker; Stefano Toldo; Sharon A Tooze; Ivan Topisirovic; Maria Lyngaas Torgersen; Liliana Torosantucci; Alicia Torriglia; Maria Rosaria Torrisi; Cathy Tournier; Roberto Towns; Vladimir Trajkovic; Leonardo H Travassos; Gemma Triola; Durga Nand Tripathi; Daniela Trisciuoglio; Rodrigo Troncoso; Ioannis P Trougakos; Anita C Truttmann; Kuen-Jer Tsai; Mario P Tschan; Yi-Hsin Tseng; Takayuki Tsukuba; Allan Tsung; Andrey S Tsvetkov; Shuiping Tu; Hsing-Yu Tuan; Marco Tucci; David A Tumbarello; Boris Turk; Vito Turk; Robin Fb Turner; Anders A Tveita; Suresh C Tyagi; Makoto Ubukata; Yasuo Uchiyama; Andrej Udelnow; Takashi Ueno; Midori Umekawa; Rika Umemiya-Shirafuji; Benjamin R Underwood; Christian Ungermann; Rodrigo P Ureshino; Ryo Ushioda; Vladimir N Uversky; Néstor L Uzcátegui; Thomas Vaccari; Maria I Vaccaro; Libuše Váchová; Helin Vakifahmetoglu-Norberg; Rut Valdor; Enza Maria Valente; Francois Vallette; Angela M Valverde; Greet Van den Berghe; Ludo Van Den Bosch; Gijs R van den Brink; F Gisou van der Goot; Ida J van der Klei; Luc Jw van der Laan; Wouter G van Doorn; Marjolein van Egmond; Kenneth L van Golen; Luc Van Kaer; Menno van Lookeren Campagne; Peter Vandenabeele; Wim Vandenberghe; Ilse Vanhorebeek; Isabel Varela-Nieto; M Helena Vasconcelos; Radovan Vasko; Demetrios G Vavvas; Ignacio Vega-Naredo; Guillermo Velasco; Athanassios D Velentzas; Panagiotis D Velentzas; Tibor Vellai; Edo Vellenga; Mikkel Holm Vendelbo; Kartik Venkatachalam; Natascia Ventura; Salvador Ventura; Patrícia St Veras; Mireille Verdier; Beata G Vertessy; Andrea Viale; Michel Vidal; Helena L A Vieira; Richard D Vierstra; Nadarajah Vigneswaran; Neeraj Vij; Miquel Vila; Margarita Villar; Victor H Villar; Joan Villarroya; Cécile Vindis; Giampietro Viola; Maria Teresa Viscomi; Giovanni Vitale; Dan T Vogl; Olga V Voitsekhovskaja; Clarissa von Haefen; Karin von Schwarzenberg; Daniel E Voth; Valérie Vouret-Craviari; Kristina Vuori; Jatin M Vyas; Christian Waeber; Cheryl Lyn Walker; Mark J Walker; Jochen Walter; Lei Wan; Xiangbo Wan; Bo Wang; Caihong Wang; Chao-Yung Wang; Chengshu Wang; Chenran Wang; Chuangui Wang; Dong Wang; Fen Wang; Fuxin Wang; Guanghui Wang; Hai-Jie Wang; Haichao Wang; Hong-Gang Wang; Hongmin Wang; Horng-Dar Wang; Jing Wang; Junjun Wang; Mei Wang; Mei-Qing Wang; Pei-Yu Wang; Peng Wang; Richard C Wang; Shuo Wang; Ting-Fang Wang; Xian Wang; Xiao-Jia Wang; Xiao-Wei Wang; Xin Wang; Xuejun Wang; Yan Wang; Yanming Wang; Ying Wang; Ying-Jan Wang; Yipeng Wang; Yu Wang; Yu Tian Wang; Yuqing Wang; Zhi-Nong Wang; Pablo Wappner; Carl Ward; Diane McVey Ward; Gary Warnes; Hirotaka Watada; Yoshihisa Watanabe; Kei Watase; Timothy E Weaver; Colin D Weekes; Jiwu Wei; Thomas Weide; Conrad C Weihl; Günther Weindl; Simone Nardin Weis; Longping Wen; Xin Wen; Yunfei Wen; Benedikt Westermann; Cornelia M Weyand; Anthony R White; Eileen White; J Lindsay Whitton; Alexander J Whitworth; Joëlle Wiels; Franziska Wild; Manon E Wildenberg; Tom Wileman; Deepti Srinivas Wilkinson; Simon Wilkinson; Dieter Willbold; Chris Williams; Katherine Williams; Peter R Williamson; Konstanze F Winklhofer; Steven S Witkin; Stephanie E Wohlgemuth; Thomas Wollert; Ernst J Wolvetang; Esther Wong; G William Wong; Richard W Wong; Vincent Kam Wai Wong; Elizabeth A Woodcock; Karen L Wright; Chunlai Wu; Defeng Wu; Gen Sheng Wu; Jian Wu; Junfang Wu; Mian Wu; Min Wu; Shengzhou Wu; William Kk Wu; Yaohua Wu; Zhenlong Wu; Cristina Pr Xavier; Ramnik J Xavier; Gui-Xian Xia; Tian Xia; Weiliang Xia; Yong Xia; Hengyi Xiao; Jian Xiao; Shi Xiao; Wuhan Xiao; Chuan-Ming Xie; Zhiping Xie; Zhonglin Xie; Maria Xilouri; Yuyan Xiong; Chuanshan Xu; Congfeng Xu; Feng Xu; Haoxing Xu; Hongwei Xu; Jian Xu; Jianzhen Xu; Jinxian Xu; Liang Xu; Xiaolei Xu; Yangqing Xu; Ye Xu; Zhi-Xiang Xu; Ziheng Xu; Yu Xue; Takahiro Yamada; Ai Yamamoto; Koji Yamanaka; Shunhei Yamashina; Shigeko Yamashiro; Bing Yan; Bo Yan; Xianghua Yan; Zhen Yan; Yasuo Yanagi; Dun-Sheng Yang; Jin-Ming Yang; Liu Yang; Minghua Yang; Pei-Ming Yang; Peixin Yang; Qian Yang; Wannian Yang; Wei Yuan Yang; Xuesong Yang; Yi Yang; Ying Yang; Zhifen Yang; Zhihong Yang; Meng-Chao Yao; Pamela J Yao; Xiaofeng Yao; Zhenyu Yao; Zhiyuan Yao; Linda S Yasui; Mingxiang Ye; Barry Yedvobnick; Behzad Yeganeh; Elizabeth S Yeh; Patricia L Yeyati; Fan Yi; Long Yi; Xiao-Ming Yin; Calvin K Yip; Yeong-Min Yoo; Young Hyun Yoo; Seung-Yong Yoon; Ken-Ichi Yoshida; Tamotsu Yoshimori; Ken H Young; Huixin Yu; Jane J Yu; Jin-Tai Yu; Jun Yu; Li Yu; W Haung Yu; Xiao-Fang Yu; Zhengping Yu; Junying Yuan; Zhi-Min Yuan; Beatrice Yjt Yue; Jianbo Yue; Zhenyu Yue; David N Zacks; Eldad Zacksenhaus; Nadia Zaffaroni; Tania Zaglia; Zahra Zakeri; Vincent Zecchini; Jinsheng Zeng; Min Zeng; Qi Zeng; Antonis S Zervos; Donna D Zhang; Fan Zhang; Guo Zhang; Guo-Chang Zhang; Hao Zhang; Hong Zhang; Hong Zhang; Hongbing Zhang; Jian Zhang; Jian Zhang; Jiangwei Zhang; Jianhua Zhang; Jing-Pu Zhang; Li Zhang; Lin Zhang; Lin Zhang; Long Zhang; Ming-Yong Zhang; Xiangnan Zhang; Xu Dong Zhang; Yan Zhang; Yang Zhang; Yanjin Zhang; Yingmei Zhang; Yunjiao Zhang; Mei Zhao; Wei-Li Zhao; Xiaonan Zhao; Yan G Zhao; Ying Zhao; Yongchao Zhao; Yu-Xia Zhao; Zhendong Zhao; Zhizhuang J Zhao; Dexian Zheng; Xi-Long Zheng; Xiaoxiang Zheng; Boris Zhivotovsky; Qing Zhong; Guang-Zhou Zhou; Guofei Zhou; Huiping Zhou; Shu-Feng Zhou; Xu-Jie Zhou; Hongxin Zhu; Hua Zhu; Wei-Guo Zhu; Wenhua Zhu; Xiao-Feng Zhu; Yuhua Zhu; Shi-Mei Zhuang; Xiaohong Zhuang; Elio Ziparo; Christos E Zois; Teresa Zoladek; Wei-Xing Zong; Antonio Zorzano; Susu M Zughaier
Journal:  Autophagy       Date:  2016       Impact factor: 16.016

10.  Drosophila domino Exhibits Genetic Interactions with a Wide Spectrum of Chromatin Protein-Encoding Loci.

Authors:  Kaitlyn Ellis; Chloe Friedman; Barry Yedvobnick
Journal:  PLoS One       Date:  2015-11-10       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.