Literature DB >> 23533610

Characterization of an ancient lepidopteran lateral gene transfer.

David Wheeler1, Amanda J Redding, John H Werren.   

Abstract

Bacteria to eukaryote lateral gene transfers (LGT) are an important potential source of material for the evolution of novel genetic traits. The explosion in the number of newly sequenced genomes provides opportunities to identify and characterize examples of these lateral gene transfer events, and to assess their role in the evolution of new genes. In this paper, we describe an ancient lepidopteran LGT of a glycosyl hydrolase family 31 gene (GH31) from an Enterococcus bacteria. PCR amplification between the LGT and a flanking insect gene confirmed that the GH31 was integrated into the Bombyx mori genome and was not a result of an assembly error. Database searches in combination with degenerate PCR on a panel of 7 lepidopteran families confirmed that the GH31 LGT event occurred deep within the Order approximately 65-145 million years ago. The most basal species in which the LGT was found is Plutella xylostella (superfamily: Yponomeutoidea). Array data from Bombyx mori shows that GH31 is expressed, and low dN/dS ratios indicates the LGT coding sequence is under strong stabilizing selection. These findings provide further support for the proposition that bacterial LGTs are relatively common in insects and likely to be an underappreciated source of adaptive genetic material.

Entities:  

Mesh:

Year:  2013        PMID: 23533610      PMCID: PMC3606386          DOI: 10.1371/journal.pone.0059262

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

New coding genes can arise in genomes through several processes, including gene duplication, gene fusion, de novo formation from non-coding DNA, or lateral gene transfer (LGT) from another species. In bacteria, frequent LGT events play a major role in the plasticity of genomes and contribute to their characteristic adaptability [1]. In contrast, LGTs were previously thought to play only a minor role in the evolution of animal genomes, based on the paucity of known examples and the requirement that heritable changes must enter the germline. However, recent research, mostly in insects and nematodes, has highlighted that bacterial to animal LGTs may in fact be a much more important source of novel gene evolution than was originally thought [2], [3]. Once an LGT has occurred, it will either degrade through mutational processes (deletions and mutations) or, in some cases, evolve into a functional gene. The latter process is poorly understood, but several examples have been found, including actively transcribed Wolbachia LGTs in the parasitoid Nasonia vitripennis [4], fungal-origin genes for carotenoids in aphids and spider mites [5], [6], and bacterially derived plant cellulases in plant parasitic nematodes [7]. These and many other examples of LGTs can contribute to the adaptive potential of the recipient. This latter point was particularly well highlighted in a recent report that a mannanase gene in the genome of the coffee borer beetle (Hypothenemus hampei) is result of an LGT with a Bacillus bacterium [8]. Acuña et al. (2012) [8] posit that the H. hampei LGT may be responsible for processing galactomannan, which is the most common polysaccharide in coffee beans, thus facilitating specialization of this pest species on coffee plants. The insects have attracted much attention in the search for microbial LGTs, partially because many are infected by the endosymbiotic alpha-proteobacteria Wolbachia, whose close association with the germline provides opportunities for heritable cross-kingdom transfer of DNA. Putative LGTs involving Wolbachia have also been found in wasps, mosquitoes, aphids, beetles, filarial nematodes, and tsetse flies [2], [4], [9]–[14]. Other insect associated bacteria have also been donors in LGT events, with these transfers likely mediated through occupation of the bacteria in the gastrointestinal and reproductive tracts, as well as parasitic and/or intracellular life stages [15]–[17]. Recently, Li et al. (2011) [18] carried out a screen of LGTs in several insect species with a bioinformatic pipeline. Somewhat surprisingly, LGTs were only detected in B. mori, with a broad range of donor species encompassing 11 genera. A complicating factor in searches for LGTs is that many genomes contain contaminating DNA sequences from bacteria that were associated with the sequenced animal. Highlighting this problem Li et al. (2011) [18] identified 77 genes on contaminating bacterial scaffolds that remain part of the Official Gene Set release 2 for Apis mellifera. This latter point illustrates the importance of confirming the localization of the LGT in animal genomes, either by PCR and sequencing over insect bacteria boundaries or by in situ hybridization. The rapid expansion in newly sequenced genomes provides opportunities to identify additional examples of LGT events between bacteria and animals. In this study we make use of the recently completed Danaus plexippus genome to identify a bacterial LGT of a glycosyl hydrolase from Enterococcus, show that the LGT is ancient in Lepidoptera, and for one species provide molecular evidence for its insertion into the genome. The high conservation of the protein coding sequence for this LGT among Lepidoptera that have diverged over 65–145 million years ago (MYA) and evidence of its expression, provides strong support that this gene is functional.

Materials and Methods

Bioinformatics

The D. plexippus genomic scaffolds and gene model information (OGS1) were downloaded from MonarchBase (http://monarchbase.umassmed.edu/home.html). To identity potential recent LGT events we used BLASTN to compare the D. plexippus genomic scaffolds against a bacterial database containing 1,097 complete bacterial genome sequences downloaded from the National Center for Biotechnology Information (NCBI). Regions with significant bacterial identity (E value<1e−5) were then compared to a second database containing representative animal genomes (Homo sapiens, Mus musculus, Rattus rattus, Monodelphis domestica, Gallus gallus, Xenopus laevis, Drosophila melanogaster, Anopheles gambiae, N. vitripennis, A. mellifera, Daphnia magna) to obtain a corresponding “animal” BLASTN E value score. If the animal E value score was less than the original E value score the sequence was excluded as a slowly evolving highly conserved gene. As smaller genomic scaffolds tend to be over-represented by DNA from environmental sources (DW unpublished observation) we also conservatively excluded any candidate region that was located in a scaffold smaller than 5 Kb in length. One to one BLAST orthologs were identified by reciprocal BLASTP searches between D. plexippus and the B. mori OGS peptides (downloaded from SilkDB http://silkworm.genomics.org.cn/silkdb). The P. xylostella OGS peptides were downloaded from the diamondback moth genome database (http:://iae.fafu.edu.cn/DBM).

Evolutionary Techniques

Non- synonymous to synonymous (dNdS) ratios were derived from a DNA alignment of the BmGH31, DpGH31, and PxGH13 coding regions using PAML [19]. The parameters used in the calculations of dNdS were runmode = −2, allow unequal codon frequencies (CodonFreq = 2) and estimate transition to transversion rate ratio (fix_kappa = 0). For Bayesian phylogenetic analysis putative homologs of the DpGH31 were identified using BLASTP searches of the NR database at NCBI. Sequences were aligned using CLUSTALW (www.ebi.ac.uk/Tools/msa/clustalw2) using the default options. The resulting CLUSTALW alignment was manually trimmed to include the GH31 super family domain (Conserved domain database: cl11402) that contained the strongest homology amongst these divergent sequences. Phylogenetics was performed using MrBayes (version 3.2.1) [20] with four independent runs of 3 million generations with sampling every 1000 generations and 25% of samples discarded as a ‘burnin’. The models of sequence evolution used for the trees where were WAG+I+G (Evolution of Prokaryote and Eukaroyote GH31 sequences), WAG+G (bacterial source of LGT), and CpREV+I+G (Lepidopteran GH31 orthologs), as selected by PROTEST (version 2.4) [21]. Branching arrangements of parsimony trees estimated using PHYLIP (version 3.69) [22] were the same as those in the Bayesian tree at nodes with strong bootstrap support (>80% Bootstrap values based on 1000 pseudoreplicates of the data). To identify possible sources of the lepidopteran LGT we downloaded the pre-compiled bacterial protein databases from PATRIC (www.patricbrc.org) and used BLASTP with the BmGH31 and DpGH31 protein sequences to identify homologs. To reduce the size of the alignment we filtered candidates based on a maximum of 5 representatives per species. A protein alignment, generated using CLUSTALW, was then used to derive a Bayesian tree in MrBayes using the run parameters described above.

Degenerate PCR and Sequencing

The degenerate primers DM1 (5′TTTGGRGGNGGNATGCARAAYGG3′) and DM2 (5′CCRTCRTTNGGDATRAACCA3′) were designed to bind to highly conserved regions found in an alignment between DpGH31 and BmGH31 sequences. PCR conditions were 1×PCR reaction buffer, 0.4 uM each primer, 0.2 mM dNTPs, 2.0 mM MgCl2 and 1 unit of Taq polymerase (Invitrogen). The species tested were Ceratomia catalpae (Hesperiidae), Atrytonopsis edwardsi (Hesperiidae), Saturnia pyri (Saturniidae), Grammia geneura (Arctiidae), Heteranassa fraternal (Noctuidae), Lesmone griseipennis (Noctuidae), Chloraspilates bicoloraria (Geometridae), Narraga fimetaria (Geometridae), Tornos erectarius (Geometridae), Eurema lisa (Pieridae), Euptoieta claudia (Nymphalidae), Gonometa rufobrunnea (Lasiocampidae), Poecilacampa populi (Lasiocampidae), Argyrotaenia velutinana (Tortricidae) and Lymantria dispar (Lymantriidae). Despite several attempts we were unable to amplify a PCR product from L. dispar genomic DNA using DM1/DM2. The identity of all successful PCR products was confirmed using Sanger sequencing and the sequences have been deposited in GenBank under accessions: KC577819-KC577832. PCR primers used to amplify between BmGH31 and the neighboring gene (BGIBMGA013897) on scaffold 3099 were DW72 (5′ CATTCAACGATCTGAAATGCC 3′) and DW73 (5′ CGCGGAGATCCGGATGGTC 3′).

Results

Bioinformatic Identification of a D. plexippus LGT

To identify relatively recent LGT regions in the D. plexippus genome we used BLASTN searches of the genomic scaffolds against a database of taxonomically diverse bacterial genomes (see methods). In contrast to other studies [18], [23], we decided to use a BLASTN based approach that utilizes the rapid decay of DNA homology to greatly reduces the likelihood of false positives resulting from functionally constrained eukaryotic protein motifs that are shared by bacteria. The single best candidate LGT in the D. plexippus genome based on the BLASTN searches, with a strong BLAST match to the glycosyl hydrolase family 31 (GH31) from Enterococcus faecalis, was on scaffold 15050 located within a predicted gene called DPGLEAN20412 (henceforth referred to as DpGH31). Protein BLAST searches using the DpGH31 sequence against the NCBI NR database also returned a best hit to a glycosyl hydrolase of E. faecalis strain TX0104 (56% identity; E value of 0.0). We noted that the BLASTP output for the gene also contained a strong hit (E value of 0.0) to a glycosyl hydrolase (BGIBMGA013995) from the genome of B. mori. A previous report has described BGIBMGA013995 as a possible LGT [18]. Reciprocal BLASTP comparisons of all D. plexippus and B. mori proteins revealed that DpGH31 and BGIBMGA013995 (henceforth referred to as BmGH31) are 1∶1 BLAST orthologs. The LGT was identified in Plutella xylostella by performing a BLASTP search with the BmGH31 peptide sequence against the P. xylostella peptide database, available at the diamondback moth genome database (http://iae.fafu.edu.cn/DBM) [24]. The top hit (E value 0.0) was to Px016165, henceforth referred to as PxGH31. The best animal BLASTP hit to DpGH31 is alpha glucosidase II alpha subunit from Hydra magnipapillata (E value 7e−40) and the best insect hit (E value 1e−35) is alpha-glucosidase AB from the ant Camponotus floridanus. These BLAST results support the conclusion that DpGH31 represents an LGT between an Enterococcus bacteria and the common ancestor of D. plexippus, B. mori, and P. xylostella (a conclusion corroborated by phylogenetic evidence below).

Gene Structure and Expression of the GH31 LGT

Consensus gene models for both BmGH31 and DpGH31 predict intronless genes that encode 1076 and 923 amino acid long peptide sequences, respectively. A single AUGUSTUS gene model for DpGH31 predicts a small 24 bp intron at the 3′ end of the gene, this exonic/intronic arrangement seems unlikely given it is not independently supported by protein alignments to other GH31 sequences. Eukaryotic gene features such as near consensus poly-A attachment site could be identified in both putative LGTs, whilst neither sequence contained Shine Delgarno sequences that are typically required for bacterial gene translation [25] (results not shown). The pairwise amino acid identity (58.5%) between BmGH31 and DpGH31 was not significantly different from the genome average (70.7%) for other B. mori and D. plexippus 1 to 1 orthologs (Z score = −0.78; p>0.05). Furthermore, DpGH31 and BmGH31 show a very low non-synonymous to synonymous substitution ratio (dN/dS = 0.062), indicative of actively transcribed protein coding genes under strong purifying selection. Both also show low dN/dS to PxGH31 in the more distantly related Plutella xylostella (dN/dS = 0.107 to Dp and 0.108 to Bm). Finally, to rule out the possibility that BmGH31 represents a bacterial insect chimeric miss assembly, we designed PCR primers that would amplify between the LGT and a neighboring gene within scaffold 3099 (Fig. 1). Based on the annotation of B. mori scaffold 3099, BmGH31 is located 85 bp from a BGIBMGA013897, which encodes a novel protein conserved across several insect and animal orders (thus representing a “typical” insect gene). PCR using B. mori genomic DNA with the bridging primers successfully amplifying the expected product size and sequencing confirmed that BmGH31 is located within the B. mori genome (Fig. 1). Although, we did not directly confirm the scaffold arrangement for D. plexippus and P. xylostella by PCR, the preservation of microsynteny between independent assemblies of the DpGH31 genomic region, the PxGH31 genomic region, and the BmGH31 genomic region strongly supports the conclusion that DpGH31 and PxGH31 are also part of the Monarch and Diamondback moth genomes, respectively (Fig. 2).
Figure 1

Molecular evidence supports that BmGH31 is part of the B. mori genome.

PCR was used to amplify across the boundary between the BmGH31 LGT and a flanking insect gene called BGIBMGA013897 that is conserved in divergent insect species. The sequence boundary between BmGH31 (red) and BGIBMGA013897 (blue) was obtained by sequencing the PCR product. The scaffold positions along scaffold3899 are shown above the gene models with the region amplified by the PCR is highlighted by the box. Note that the coding region of BGIBMGA013897 is located on the opposite strand.

Figure 2

Microsynteny exists in the region surrounding DpGH31, BmGH31 and PxGH31.

Microsynteny of genes surrounding the GH31 LGT regions in B. mori, D. plexippus and P. xylostella. The genes’ direction of transcription is indicated by arrows with LGTs shown in red. Genes that are one to one blast orthologs between B. mori, D. plexippus, and P. xylostella are indicated by matching colors and connecting gray lines. The PCR primers used to amplify between BmGH31 and the neighboring gene (BGIBMGA013897) on scaffold 3099 are indicated by small blue arrows on BmGH31 and BGIBMGA013897.

Molecular evidence supports that BmGH31 is part of the B. mori genome.

PCR was used to amplify across the boundary between the BmGH31 LGT and a flanking insect gene called BGIBMGA013897 that is conserved in divergent insect species. The sequence boundary between BmGH31 (red) and BGIBMGA013897 (blue) was obtained by sequencing the PCR product. The scaffold positions along scaffold3899 are shown above the gene models with the region amplified by the PCR is highlighted by the box. Note that the coding region of BGIBMGA013897 is located on the opposite strand.

Microsynteny exists in the region surrounding DpGH31, BmGH31 and PxGH31.

Microsynteny of genes surrounding the GH31 LGT regions in B. mori, D. plexippus and P. xylostella. The genes’ direction of transcription is indicated by arrows with LGTs shown in red. Genes that are one to one blast orthologs between B. mori, D. plexippus, and P. xylostella are indicated by matching colors and connecting gray lines. The PCR primers used to amplify between BmGH31 and the neighboring gene (BGIBMGA013897) on scaffold 3099 are indicated by small blue arrows on BmGH31 and BGIBMGA013897. Microarray data indicates that BmGH31 is expressed in the testis, with moderate to low expression in the ovary, malpighian tubules, fat body, and integument [18]. We were unable to identify an EST for DpGH31 in either the NCBI EST or transcriptome shotgun assembly databases, though it should be noted these are largely brain-specific libraries and MonarchBase indicates that 1635 RNAseq reads map to this gene. Given the above observations plus absence of other evidence that would suggest these genes are pseudogenes (i.e. stop codons, elevated dNdS), it is highly likely that both genes are functionally important.

Phylogenetic Relationships of GH31

To better understand the evolutionary history of the D. plexippus and B. mori GH31 LGT sequences, we carried out a phylogenetic analyses with homologous sequences from eukaryote and prokaryote species. In concordance with the BLAST results the Bayesian phylogenetic tree (Fig. 3) groups DpGH31 and BmGH31 together within a strongly supported clade (Posterior probability 99%) of bacterial GH31 sequences. The three other well supported clades (Posterior probability 100%) are composed of animal GH31-like proteins, animal alpha-glucosidases and eukaryotic neutral alpha glucosidase sequences (Fig. 3). Importantly, typical insect alpha-glucosidases found in the genomes of both B. mori and D. plexippus are placed into the expected insect clades. Therefore, the phylogeny strongly suggests DpGH31 and BmGH31 result from an LGT between a bacteria and the common ancestor of B. mori and D. plexippus at least 65 MYA [26].
Figure 3

Bayesian phylogeny of DpGH31 and BmGH31 sequences.

Unrooted Bayesian phylogenetic tree of GH31-like protein sequences from prokaryote and eukaryote species. The clade grouping the D. Plexippus and B. mori LGTs (DpGH31 and BmGH31 shown in red) with the E. faecalis GH31 sequence is supported by a 100% posterior probability. The division of the sequences into Prokaryote and Eukaryote clades, indicted by the curved lines, is supported by a >98% posterior probabilities, with the Lepidopteran LGTs clearly within the bacterial clade. Only posterior probability values at key nodes are not shown for clarity. The tentative protein annotations were made based on the information available at NCBI using the following key: hypothetical (HYP), glycosyl hydrolase family 31 (GH31), alpha-glucosidase (AG), neutral alpha-glucosidase (NAG), glucosidase (GLUC). Gene identifier numbers for all sequences in the phylogeny are provided in Table S1.

Bayesian phylogeny of DpGH31 and BmGH31 sequences.

Unrooted Bayesian phylogenetic tree of GH31-like protein sequences from prokaryote and eukaryote species. The clade grouping the D. Plexippus and B. mori LGTs (DpGH31 and BmGH31 shown in red) with the E. faecalis GH31 sequence is supported by a 100% posterior probability. The division of the sequences into Prokaryote and Eukaryote clades, indicted by the curved lines, is supported by a >98% posterior probabilities, with the Lepidopteran LGTs clearly within the bacterial clade. Only posterior probability values at key nodes are not shown for clarity. The tentative protein annotations were made based on the information available at NCBI using the following key: hypothetical (HYP), glycosyl hydrolase family 31 (GH31), alpha-glucosidase (AG), neutral alpha-glucosidase (NAG), glucosidase (GLUC). Gene identifier numbers for all sequences in the phylogeny are provided in Table S1.

E. faecalis is the Most Likely Source of the GH31 LGT

To better understand the source of the LGT, we used BLASTP searches to identify homologs of DpGH31 and BmGH31 from the Class Bacilli of complete bacteria genomes. The resulting phylogeny constructed from these GH31 sequences (Fig. 4) strongly supports (Posterior probability 100%) E. faecalis (or a closely related, unsequenced Enterococcus) as the source of DpGH31 and BmGH31, from a single event in the common ancestor of B. mori and D. plexippus.
Figure 4

E. faecalis is the likely source of LGT.

Bacilli homologs of DpGH31 and BmGH31 were identified using BLASTP searches of a whole genome microbial databases available at Pathosystems Integration Resource Center (PATRIC). The resulting protein sequences were used to generate the Bayesian phylogeny that shows DpGH31 and BmGH31 grouping (100% posterior probability) with E. faecalis strains.

E. faecalis is the likely source of LGT.

Bacilli homologs of DpGH31 and BmGH31 were identified using BLASTP searches of a whole genome microbial databases available at Pathosystems Integration Resource Center (PATRIC). The resulting protein sequences were used to generate the Bayesian phylogeny that shows DpGH31 and BmGH31 grouping (100% posterior probability) with E. faecalis strains.

GH31 Orthologs in Other Lepidopteran Species

Based on bioinformatic searches, Li et al. (2011) [18] previously reported that BmGH31 was limited to the Bombycoidea. The identification of DpGH31 in D. plexippus (Nymphalidae) motivated us to test several lepidopteran super families for the presence of homologous LGTs. To do this we used conserved regions in the DpGH31 and BmGH31 protein sequences to design degenerate primers that could be used for PCR screens. For this PCR assay we screened species from the Noctuidae, Geometridae, Pieridae, Nymphalidae, Lasiocampidae, Lymantriidae, and Tortricidae. The degenerate primers successfully amplified products with the predicted size from all these taxonomically and geographically diverse groups of lepidopteran species (Fig. 5A), except for the gypsy moth (Lymantriidae; results not shown). The product for P. populi and A. velutina amplified poorly even after attempts to optimize the PCR, suggesting that the degenerate primers are not universally efficient across the Lepidoptera. We also were able to bioinformatically identify a GH31-like gene called HMEL002892 with strong BLAST similarity to DpGH31 in the recently published genome of Heliconius melpomene. Conservation of microsynteny between HMEL002892, DpGH31, and BmGH31 provides further support that this H. melpomene gene is also related to the LGT event (Fig. 2; results not shown). Although the super family relationships of Lepidoptera are currently unresolved (see Kim et al. (2011) [27]), a phylogeny construction using the lepidopteran inferred amino acid sequences from the sequenced PCR-amplified products from species in Figure 5B generally agrees with the established phylogeny at the family level [28], supporting the orthologous relationship of these sequences. Well-supported clades are found for members of the Noctuoidea and Geometroidea, while other phylogenetic relationships were not resolved. For example, S. pyri does not group with the other bombycoid complex species, this most likely results from the relatively few phylogenetic informative sites found in the small region used to derive the phylogeny (116 amino acids). The results demonstrate that DpGH31 homologs are widespread within Lepidoptera. The LGT event occurred around or before the diversification of the Ditrysia (Fig. 6), which has been dated to the Cretaceous period. These findings therefore suggest that the LGT event occurred between 145-65 MYA [26], [29]. At this stage the failure to amplify a product in the gypsy moth (family Lymantriidae) requires further investigation before it can be concluded that this species lost the LGT.
Figure 5

The GH31 LGT is ancient in origin.

A.) Putative homologs of DpGH31 identified using degenerate PCR on genomic DNA from a panel of diverse lepidoptera species. Phylogenetic relationships of the families are taken from Cho et al 2011 [36]. Bombxy mori genomic DNA was used as the positive control (+). Faint bands could be observed for P. populi and A. velutinana on the original gel. B.) A Bayesian phylogenetic tree derived from GH31-LGT conceptually translated DNA sequences. DNA sequences used were obtained either by degenerate PCR or searches of available lepidopteran genome sequences. Well supported clades are resolved for members of the Noctuoidea and Geometroidea. The phylogenetic relationships of species from the Bombycoid complex and the butterflies could not be resolved in this analysis (posterior probability values less than 90%).

Figure 6

A branching diagram showing the hypothesized relationships of lepidopteran families.

PCR with sequencing, and bioinformatic searches were used to identify GH31 LGTs in the lepidopteran species from families highlighted by the blue boxes. The only family in which the LGT was not confirmed by degenerate PCR is Lymantriidae (red box). The most basal species in which the LGT was discovered is P. xylostella (Yponomeutidae). This places the timescale of LGT acquisition (red arrow) to the Cretaceous (145-66 mya), as this is when early radiations of ditrysian superfamilies likely occurred [26]. The branch arrangements are based on data from [28], [36], [37].

The GH31 LGT is ancient in origin.

A.) Putative homologs of DpGH31 identified using degenerate PCR on genomic DNA from a panel of diverse lepidoptera species. Phylogenetic relationships of the families are taken from Cho et al 2011 [36]. Bombxy mori genomic DNA was used as the positive control (+). Faint bands could be observed for P. populi and A. velutinana on the original gel. B.) A Bayesian phylogenetic tree derived from GH31-LGT conceptually translated DNA sequences. DNA sequences used were obtained either by degenerate PCR or searches of available lepidopteran genome sequences. Well supported clades are resolved for members of the Noctuoidea and Geometroidea. The phylogenetic relationships of species from the Bombycoid complex and the butterflies could not be resolved in this analysis (posterior probability values less than 90%).

A branching diagram showing the hypothesized relationships of lepidopteran families.

PCR with sequencing, and bioinformatic searches were used to identify GH31 LGTs in the lepidopteran species from families highlighted by the blue boxes. The only family in which the LGT was not confirmed by degenerate PCR is Lymantriidae (red box). The most basal species in which the LGT was discovered is P. xylostella (Yponomeutidae). This places the timescale of LGT acquisition (red arrow) to the Cretaceous (145-66 mya), as this is when early radiations of ditrysian superfamilies likely occurred [26]. The branch arrangements are based on data from [28], [36], [37].

Possible Functions of Lepidopteran GH31 LGT

The DpGH31 sequence contains three protein family domains: glycoside hydrolase family 31 (PF01055), Discoidin (PF00754), and a Fibronectin type III (PF00041). These domains are extremely common in nature and are involved in a diverse array of mechanisms, including primary metabolism, glycosylation, and immunity. The GO annotation of BmGH31 is a hydrolysis of O-glycosyl compounds is also a very general functional category.

Discussion

In this study we used bioinformatic, molecular and phylogenetic methods to characterize an ancient LGT between an Enterococcus and an ancestral lepidopteran 145-65 MYA. The most basal lineage that the LGT was found in is P. xylostella (superfamily Yponomeutoidea). We have not yet resolved whether the LGT is present in Tineoidea (which includes bagworms [30]), so the LGT could be even more ancient in the Lepidoptera. The use of molecular methods to confirm that BmGH31 is part of the B. mori genome, together with the conservation of microsynteny in this region with D. plexippus and P. xylostella, makes it highly unlikely that these genes are based on a chimeric assembly between bacterial and insect DNA (Fig. 1). Conservation of the LGT protein coding sequence (relative to synonymous substitutions) within several diverse lepidopteran families and its expression in B. mori provides strong evidence that the LGT is functional (Fig. 5). The actual function of the GH31 LGT in Lepidoptera is currently unknown. Unfortunately, bioinformatic and evolutionary tools provide few clues to actual biological function of BmGH31 and DpGH31, as GH31 members are associated with many molecular pathways. For example, other members of this family are involved in the digestion of starch in the human intestine, however, BmGH31 is only expressed lowly in the gut of B. mori [23], [31]. The high expression in the gonad also provides few clues to a possible function as the literature is sparse on examples of testis specific GH31 members. In the future we hope to directly examine the function of BmGH31 using RNA interference gene knockdowns, a method that has previously been successful in B. mori functional studies [32]–[34]. Currently, there is no spatial or temporal expression data available for D. plexippus, and although we were unable to identify an EST for DpGH31, the existing EST libraries are mostly derived from brain tissue. The mechanisms that evolve LGTs into functional eukaryotic genes are poorly understood and fascinatingly complex. The acquisition of a eukaryotic promoter could occur quickly if the LGT integrates near an existing promoter or enhancer element. However, the evolution of introns would be more complex and presumably represents a multistep process. With this latter point in mind, it is interesting that neither D. plexippus nor B. mori GH31 sequences contain introns, despite their ancient establishment. Li et al. (2011) [18] also noted that 20 other putative LGTs they identified in B. mori are intronless. Similarly, LGTs involving two Wolbachia genes in the genome of Aedes aegypti also are intronless [11]. The formation of eukaryotic splice sites must direct precise splicing such that the reading frame in the mRNA is preserved. The process of intron acquisition is thus likely to be hindered by the high probability of deleterious intermediate steps, such as the introduction of frame shift mutations or protein truncations. That several examples of intron-containing LGTs exist shows that this process does occur. However, with the present case in mind, it may require many millions of years [4], [10], [35]. Our limited understanding of intron function also makes it difficult to devise clear hypothesis to explain the selective pressures driving intron acquisition in LGTs. It is clear that the study of LGTs will provide us with a rich source of information not only on the evolution of new introns, but also on the selective forces driving LGT maintenance within eukaryotes. GI numbers for protein sequences used in the phylogenetic tree shown in Figure 3. (DOC) Click here for additional data file.
  34 in total

Review 1.  Lateral gene transfer and the nature of bacterial innovation.

Authors:  H Ochman; J G Lawrence; E A Groisman
Journal:  Nature       Date:  2000-05-18       Impact factor: 49.962

2.  Induction of the white egg 3 mutant phenotype by injection of the double-stranded RNA of the silkworm white gene.

Authors:  G X Quan; T Kanda; T Tamura
Journal:  Insect Mol Biol       Date:  2002-06       Impact factor: 3.585

3.  ProtTest: selection of best-fit models of protein evolution.

Authors:  Federico Abascal; Rafael Zardoya; David Posada
Journal:  Bioinformatics       Date:  2005-01-12       Impact factor: 6.937

Review 4.  Ancient rapid radiations of insects: challenges for phylogenetic analysis.

Authors:  James B Whitfield; Karl M Kjer
Journal:  Annu Rev Entomol       Date:  2008       Impact factor: 19.686

5.  PAML 4: phylogenetic analysis by maximum likelihood.

Authors:  Ziheng Yang
Journal:  Mol Biol Evol       Date:  2007-05-04       Impact factor: 16.240

6.  Plant parasitic nematodes: digesting a page from the microbe book.

Authors:  N T Keen; P A Roberts
Journal:  Proc Natl Acad Sci U S A       Date:  1998-04-28       Impact factor: 11.205

7.  Widespread lateral gene transfer from intracellular bacteria to multicellular eukaryotes.

Authors:  Julie C Dunning Hotopp; Michael E Clark; Deodoro C S G Oliveira; Jeremy M Foster; Peter Fischer; Mónica C Muñoz Torres; Jonathan D Giebel; Nikhil Kumar; Nadeeza Ishmael; Shiliang Wang; Jessica Ingram; Rahul V Nene; Jessica Shepard; Jeffrey Tomkins; Stephen Richards; David J Spiro; Elodie Ghedin; Barton E Slatko; Hervé Tettelin; John H Werren
Journal:  Science       Date:  2007-08-30       Impact factor: 47.728

8.  Wolbachia genome integrated in an insect chromosome: evolution and fate of laterally transferred endosymbiont genes.

Authors:  Naruo Nikoh; Kohjiro Tanaka; Fukashi Shibata; Natsuko Kondo; Masahiro Hizume; Masakazu Shimada; Takema Fukatsu
Journal:  Genome Res       Date:  2007-12-11       Impact factor: 9.043

9.  Knockdown of ecdysis-triggering hormone gene with a binary UAS/GAL4 RNA interference system leads to lethal ecdysis deficiency in silkworm.

Authors:  Hongjiu Dai; Li Ma; Jue Wang; Rongjing Jiang; Zhugang Wang; Jian Fei
Journal:  Acta Biochim Biophys Sin (Shanghai)       Date:  2008-09       Impact factor: 3.848

10.  The 3'-terminal sequence of Escherichia coli 16S ribosomal RNA: complementarity to nonsense triplets and ribosome binding sites.

Authors:  J Shine; L Dalgarno
Journal:  Proc Natl Acad Sci U S A       Date:  1974-04       Impact factor: 11.205

View more
  29 in total

1.  A novel intracellular mutualistic bacterium in the invasive ant Cardiocondyla obscurior.

Authors:  Antonia Klein; Lukas Schrader; Rosario Gil; Alejandro Manzano-Marín; Laura Flórez; David Wheeler; John H Werren; Amparo Latorre; Jürgen Heinze; Martin Kaltenpoth; Andrés Moya; Jan Oettler
Journal:  ISME J       Date:  2015-07-14       Impact factor: 10.302

Review 2.  Horizontal gene transfer in the acquisition of novel traits by metazoans.

Authors:  Luis Boto
Journal:  Proc Biol Sci       Date:  2014-01-08       Impact factor: 5.349

3.  Genome-enabled insights into the biology of thrips as crop pests.

Authors:  Dorith Rotenberg; Aaron A Baumann; Sulley Ben-Mahmoud; Olivier Christiaens; Wannes Dermauw; Panagiotis Ioannidis; Chris G C Jacobs; Iris M Vargas Jentzsch; Jonathan E Oliver; Monica F Poelchau; Swapna Priya Rajarapu; Derek J Schneweis; Simon Snoeck; Clauvis N T Taning; Dong Wei; Shirani M K Widana Gamage; Daniel S T Hughes; Shwetha C Murali; Samuel T Bailey; Nicolas E Bejerman; Christopher J Holmes; Emily C Jennings; Andrew J Rosendale; Andrew Rosselot; Kaylee Hervey; Brandi A Schneweis; Sammy Cheng; Christopher Childers; Felipe A Simão; Ralf G Dietzgen; Hsu Chao; Huyen Dinh; Harsha Vardhan Doddapaneni; Shannon Dugan; Yi Han; Sandra L Lee; Donna M Muzny; Jiaxin Qu; Kim C Worley; Joshua B Benoit; Markus Friedrich; Jeffery W Jones; Kristen A Panfilio; Yoonseong Park; Hugh M Robertson; Guy Smagghe; Diane E Ullman; Maurijn van der Zee; Thomas Van Leeuwen; Jan A Veenstra; Robert M Waterhouse; Matthew T Weirauch; John H Werren; Anna E Whitfield; Evgeny M Zdobnov; Richard A Gibbs; Stephen Richards
Journal:  BMC Biol       Date:  2020-10-19       Impact factor: 7.431

Review 4.  Functional horizontal gene transfer from bacteria to eukaryotes.

Authors:  Filip Husnik; John P McCutcheon
Journal:  Nat Rev Microbiol       Date:  2017-11-27       Impact factor: 60.633

5.  The Toxicogenome of Hyalella azteca: A Model for Sediment Ecotoxicology and Evolutionary Toxicology.

Authors:  Helen C Poynton; Simone Hasenbein; Joshua B Benoit; Maria S Sepulveda; Monica F Poelchau; Daniel S T Hughes; Shwetha C Murali; Shuai Chen; Karl M Glastad; Michael A D Goodisman; John H Werren; Joseph H Vineis; Jennifer L Bowen; Markus Friedrich; Jeffery Jones; Hugh M Robertson; René Feyereisen; Alexandra Mechler-Hickson; Nicholas Mathers; Carol Eunmi Lee; John K Colbourne; Adam Biales; J Spencer Johnston; Gary A Wellborn; Andrew J Rosendale; Andrew G Cridge; Monica C Munoz-Torres; Peter A Bain; Austin R Manny; Kaley M Major; Faith N Lambert; Chris D Vulpe; Padrig Tuck; Bonnie J Blalock; Yu-Yu Lin; Mark E Smith; Hugo Ochoa-Acuña; Mei-Ju May Chen; Christopher P Childers; Jiaxin Qu; Shannon Dugan; Sandra L Lee; Hsu Chao; Huyen Dinh; Yi Han; HarshaVardhan Doddapaneni; Kim C Worley; Donna M Muzny; Richard A Gibbs; Stephen Richards
Journal:  Environ Sci Technol       Date:  2018-04-24       Impact factor: 9.028

6.  Horizontal Gene Transfer and Gene Duplication of β-Fructofuranosidase Confer Lepidopteran Insects Metabolic Benefits.

Authors:  Xiangping Dai; Takashi Kiuchi; Yanyan Zhou; Shunze Jia; Yusong Xu; Susumu Katsuma; Toru Shimada; Huabing Wang
Journal:  Mol Biol Evol       Date:  2021-06-25       Impact factor: 16.240

7.  Molecular evolution of glycoside hydrolase genes in the Western corn rootworm (Diabrotica virgifera virgifera).

Authors:  Seong-il Eyun; Haichuan Wang; Yannick Pauchet; Richard H Ffrench-Constant; Andrew K Benson; Arnubio Valencia-Jiménez; Etsuko N Moriyama; Blair D Siegfried
Journal:  PLoS One       Date:  2014-04-09       Impact factor: 3.240

8.  Common Virulence Factors and Tissue Targets of Entomopathogenic Bacteria for Biological Control of Lepidopteran Pests.

Authors:  Anaïs Castagnola; S Patricia Stock
Journal:  Insects       Date:  2014-01-06       Impact factor: 2.769

9.  Genome of the pincer wasp Gonatopus flavifemur reveals unique venom evolution and a dual adaptation to parasitism and predation.

Authors:  Yi Yang; Xinhai Ye; Cong Dang; Yunshen Cao; Rui Hong; Yu H Sun; Shan Xiao; Yang Mei; Le Xu; Qi Fang; Huamei Xiao; Fei Li; Gongyin Ye
Journal:  BMC Biol       Date:  2021-07-27       Impact factor: 7.431

10.  Host and Symbiont Jointly Control Gut Microbiota during Complete Metamorphosis.

Authors:  Paul R Johnston; Jens Rolff
Journal:  PLoS Pathog       Date:  2015-11-06       Impact factor: 6.823

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.