Literature DB >> 23493053

Simultaneous Detection of Integrase and Antibiotic Resistance Genes within SXT Constin in Vibrio cholerae O1 El Tor Strains Isolated from Iran Using Multiplex-PCR.

Seyed Mahmoud Amin Marashi1, Bahram Nasr Esfahani, Akbar Tavakoli, Sharareh Moghim, Mohammad Reza Pourshafie, Mansoor Salehi.   

Abstract

OBJECTIVES: Amongst the various antibiotic resistant elements in Vibrio. cholerae, SXT constin (SXT-C) is important. We were going to design a quick method for determination of antibiotic resistance gene pattern in SXT-C.
MATERIALS AND METHODS: Ninety four V. cholerae O1 El Tor isolates were used in this study. Antibiotic susceptibility testing, multiplex PCR amplification of SXT-C containing dfrA1, sulII, strB and the int in a multiplex PCR were done.
RESULTS: Results of our study showed that 92 (97.8%) out of 94 isolates were positive for all above genes. Multiplex PCR results correlated with the antibiotic susceptibility data obtained by using disc diffusion assay.
CONCLUSION: Using this multiplex PCR, it would be easily possible to demonstrate the presence of antibiotic resistance in SXT-C which, in turn, allows for a suitable treatment in cholera patients causing reduction in the mortality and morbidity rate of the infected individuals.

Entities:  

Keywords:  Antibiotic resistance pattern; Integrase; Multiplex-PCR; SXT constin; Vibrio cholerae

Year:  2012        PMID: 23493053      PMCID: PMC3586891     

Source DB:  PubMed          Journal:  Iran J Basic Med Sci        ISSN: 2008-3866            Impact factor:   2.699


Introduction

Cholera is a major cause of health threat and also a major cause of death worldwide and especially in developing countries. In Iran, cholera is an endemic disease and during last decade, especially within 2004-2009 have had several outbreaks (1). In most cases cholera can be successfully treated with oral rehydration therapy but application of antibiotics could shorten the course of the disease. However, Vibrio cholerae, antibiotic resistance has been reported. Singh et al showed antibiotic resistance in all of strains of V. cholerae all over India (2). Similarly, a study in 2004 in Iran by Adabi et al showed resistance to trimethoprim, sulfamethoxazole and streptomycin (3). In V. cholerae, antibiotic resistance confers by R plasmid, integrons and SXT-C (3). The SXT-C, an acronym for a conjugative, self-transmissible and integrating element is a V. cholerae-derived integrating conjugative element (ICE). The SXT-C (≈99 kb) encodes an integrase is a conserved sequence in the SXT-C and in its 5' end that is required for all properties of SXT-C including excision, transfer and integration. It encodes resistance to multiple antibiotics including sulfamethoxazole, trimethoprim and streptomycin. SXT-C has recently evolved as an important self-transmissible element which can integrate into the bacterial chromosome (4, 5). SXT-C has been found in several microorganisms among which V. cholerae O1 has received special attention due to continuous evolving of antibiotic resistance. This element has been reported in the members of Enterobacteriaceae as well (2, 3). Previous studies showed the fact that, sulfamethoxazole, trimethoprim and streptomycin resistance genes were linked to each other (6). In the developing countries, cholera can be spread very fast and therefore antibiotic therapy must be applied. If cholera patients are treated quickly and properly, the mortality rate would be less than 1%. However, with untreated cholera, the mortality rate rises to 50–60% (4, 6, 7). So, the success of treatment is significantly affected by the prompt and method of treatment. Application of a rapid diagnostic assay for the identification of multi-drug resistant V. cholerae is also very critical. Thus, we designed a multiplex PCR for the rapid detection of antibiotic resistance genes and the SXT-C in V. cholerae.

Materials and Methods

Ninety four V. cholerae O1 El Tor were isolated from cholera patients in different regions of Iran between 2004 and 2010. Phenotypic strain characterizations were performed using the biochemical tests. All isolates were examined following isolation on TCBS media, for motility, carbohydrate fermentation, indol, arginine dehydrolase, ornithine decarboxylase, MR-VP and growth at different NaCl concentration. All isolates were also examined for their oxidase reaction. The identities of the V. cholerae O1 strains were confirmed by serogrouping using growth from brain heart infusion agar (BHIA) with polyclonal O1 and monospecific Inaba and Ogawa antisera. V. cholerae strains that did not agglutinate with O1 antiserum were checked with O139 monoclonal antibody supplied (Pasteur Institute, Paris, France). V. cholerae O1 biotype El Tor strain KO194 was used as a positive control for sulII+, dfrA1+, strB+ and int+, and strain VO101 used as a negative control. Antibiotic susceptibility patterns to gentamicin (10 µg), doxycycline (30 µg), tetracycline (30 µg), ciprofloxacin (5 µg), oxytetracycline (30 µg), streptomycin (5 µg), ampicillin (10 µg), erythromycin (15 µg), chloramphenicol (30 µg) and co-trimoxazole (25 µg) (purchased from Becton Dickinson) were determined by the standard disk diffusion method according to CLSI guidelines (8). V. cholerae strains thrived overnight at 37°C in Luria–Bertani broth (Merck). Genomic DNA was isolated by DNA extraction kit (Roche, Mannheim, Germany). Sequences of primers used for detection of int and antibiotic resistance genes PCR amplification of target DNA was carried in a total volume of 25 µl. The reaction mixture contained 2.5 µl 10× amplification buffer [500 mM KCl, 100 mM Tris/HCl (pH 8.5), 1.0% Triton X-100], 0.5 µl 25 mM MgCl2, 0.3 µl each of 2.5 mM dNTPs (Fermentas, GmbH, Germany), 0.5 µl forward and reverse primers for all genes (20 ng/µl), 0.2 µl Taq DNA polymerase (5 U/µl), and 100 pg extracted DNA. PCR conditions were; initial denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 1 min, 60 °C for 1 min and 72 °C for 1 min, with a final extension at 72 °C for 3 min. Multiplex PCR was carried out by the simultaneous addition of primer pairs for sulII, dfrA1 and strB in the same reaction mixture. Primer sequences used in this study are shown in Table 1. We designed these primers except primers for int gene that were desing by others (3). Amplified products were separated by agarose (1%) gel electrophoresis in 0.5× TBE, stained by ethidium bromide. The DNAs were extracted from the bands on the gel using gel extraction kit (Qiagen, GmbH, Germany) and then were sequenced by Macrogen Inc, Seoul, Korea.
Table 1

Sequences of primers used for detection of int and antibiotic resistance genes

GenePrimer
Integrase int forward 5’- GCTGGATAGGTTAAGGGCGG -3’
int reverse 5’- CTCTATGGGCACTGTCCACATTG -3’
Dihydrofolate reductase dfr A1 forward 5’-TGATGTTTACTTTCCTGAAATCCC-3’
dfr A1 reverse 5’- ATCCGTTGCTGCCACTTG -3’
Streptomycin Phosphotransferase strB forward 5’-CGTTGCTCCTCTTCTCCATC-3’
strB reverse 5’- TGCCTTCTGCCCTTCTCC -3’
Dihydrofolate synthase sulII forward 5’-TCAAGGCAGATGGCATTCC-3’
sulII reverse 5’- ACGACGAGTTTGGCAGATG -3’
Results of analysis employing multiplex PCR to study Vibrio cholerae O1 strain isolated from different provinces in Iran *Sul= sulfamethoxazole; S= streptomycin; Tm= trimethoprim

Results

Ninety four V. cholerae O1 El Tor strains were examined for the presence of antibiotic resistance genes in the SXT element. Ninety two strains showed resistance to streptomycin, trimethoprim and sulfamethoxazole by disk diffusion method. Multiplex PCR amplification using eight primers gave amplicons of different size for all strains. These results are shown in Table 2. Amplification of genomic DNA extracted from two strains of V. cholerae O1 isolated from Sistan-Baluchistan of Iran in 2004, gave negative multiplex PCR results for the sulII, dfrA1, strB and int genes. These strains, when tested for antibiotic susceptibility, were sensitive to all antibiotics tested for susceptibility analysis. Ninety two strains of V. cholerae O1 were positive and fragments of 157 bp sulII, 121 bp dfrA1, 430 bp strB and 592 bp Int gene were amplified by multiplex-PCR.
Table 2

Results of analysis employing multiplex PCR to study Vibrio cholerae O1 strain isolated from different provinces in Iran

Sample / ControlStrainsStateNo. of strains testedStrain(s) showing presence of genes encoding:
Antibiotic resistance genepattern*
sulII strB dfrA1 int
Sample V. cholerae  O1Tehran48++++S, Tm , Sul
Golestan14++++S, Tm , Sul
Qum9++++S, Tm , Sul
Sistan-Baluchistan21++++S, Tm , Sul
2-------
Positive control V. cholerae O 1 KO194---1++++S, Tm , Sul
Negative control V. cholerae O 1 VO101---1-------

*Sul= sulfamethoxazole; S= streptomycin; Tm= trimethoprim

Discussion

Oral rehydration therapy is highly effective and is the principal treatment for cholera cases, but antibiotic shortens the course of the disease and reduces the severity of the symptoms. It is important to note that, this recommendation is especially valid in developed countries (5). Oxytetracycline is the primary antibiotic used in the cholera patients (2, 3). Trimethoprim, sulfamethoxazole and chloramphenicol have also been used for cholera treatment for which resistance has been reported in many developing countries (2, 6, 8). Initially, SXT-C was identified in V. cholerae O139 harboring trimethoprim, sulfamethoxazole, streptomycin and chloramphenicol resistance genes. This was followed by identification of the SXT element in O1 strains from several countries, i.e. India, Bangladesh, Mozambique and Laos between 1999 and 2004 (8-10). For the first time in world, Ramachandran et al showed that due to SXT element, 85% of V. cholerae O1 El Tor strains isolated in India were resistant to trimethoprim, sulfamethoxazole and streptomycin (2). Previously in our laboratory, by using disc diffusion method, Adabi et al identified that antibiotic resistance to sulfamethoxazole, streptomycin, and chloramphenicol were 95%, 95%, and 92%, respectively in Iran (3). In the current study, we used a quick, one step multiplex-PCR and showed the presence of antibiotic resistance in SXT-C in V. cholerae. Our results showed that 97.8% out of all of the V. cholerae El Tor strains were positive for integrase and antibiotic resistance genes, but 2.2% strains were negative. The results obtained in this study showed that the V. cholerae O1 El Tor strains isolated from different geographical locations were similar to the results published by Ramachandram et al (2) Adabi et al (3) in India and Iran, respectively. Furthermore, the study showed that, the SXT-C, harboring several different antibiotic resistance gene cassettes, is widely distributed among different clinical V. cholerae O1 serotypes in Iran which makes it essential for developing of a rapid detection method of antibiotic resistance pattern using molecular techniques.

Conclusion

For first time in Iran, we can use one step multiplex PCR for detection of SXT-C and antibiotic resistance gene pattern in V. cholerae. This study showed that by the use of this method, physicians can choose a suitable treatment protocol for the cholera patients. Obviously, incorrect antibiotic therapy may resulted resistant strains (12). The results also show that, with the effective antibiotic therapy, we are not giving a chance to V. cholerae for more SXT-C transfer to other hosts. Finally, this method can be used for evaluation of the spread of antibiotic resistance in epidemiological studies.
  11 in total

1.  Antibiotic resistance conferred by a conjugative plasmid and a class I integron in Vibrio cholerae O1 El Tor strains isolated in Albania and Italy.

Authors:  V Falbo; A Carattoli; F Tosini; C Pezzella; A M Dionisi; I Luzzi
Journal:  Antimicrob Agents Chemother       Date:  1999-03       Impact factor: 5.191

2.  Site-specific integration of the conjugal Vibrio cholerae SXT element into prfC.

Authors:  B Hochhut; M K Waldor
Journal:  Mol Microbiol       Date:  1999-04       Impact factor: 3.501

3.  A new type of conjugative transposon encodes resistance to sulfamethoxazole, trimethoprim, and streptomycin in Vibrio cholerae O139.

Authors:  M K Waldor; H Tschäpe; J J Mekalanos
Journal:  J Bacteriol       Date:  1996-07       Impact factor: 3.490

4.  Expanding multiple antibiotic resistance among clinical strains of Vibrio cholerae isolated from 1992-7 in Calcutta, India.

Authors:  P Garg; S Chakraborty; I Basu; S Datta; K Rajendran; T Bhattacharya; S Yamasaki; S K Bhattacharya; Y Takeda; G B Nair; T Ramamurthy
Journal:  Epidemiol Infect       Date:  2000-06       Impact factor: 2.451

5.  Class 1 integron-borne, multiple-antibiotic resistance encoded by a 150-kilobase conjugative plasmid in epidemic vibrio cholerae O1 strains isolated in Guinea-Bissau.

Authors:  A Dalsgaard; A Forslund; A Petersen; D J Brown; F Dias; S Monteiro; K Molbak; P Aaby; A Rodrigues; A Sandström
Journal:  J Clin Microbiol       Date:  2000-10       Impact factor: 5.948

6.  Multiplex PCR for detection of antibiotic resistance genes and the SXT element: application in the characterization of Vibrio cholerae.

Authors:  Dhanya Ramachandran; R Bhanumathi; Durg V Singh
Journal:  J Med Microbiol       Date:  2007-03       Impact factor: 2.472

7.  Dissemination of a single Vibrio cholerae clone in cholera outbreaks during 2005 in Iran.

Authors:  M R Pourshafie; B Bakhshi; R Ranjbar; M Sedaghat; N Sadeghifard; J Zaemi Yazdi; M Parzadeh; J Raesi
Journal:  J Med Microbiol       Date:  2007-12       Impact factor: 2.472

8.  An epidemic of Vibrio cholerae el tor Inaba resistant to several antibiotics with a conjugative group C plasmid coding for type II dihydrofolate reductase in Thailand.

Authors:  R Tabtieng; S Wattanasri; P Echeverria; J Seriwatana; L Bodhidatta; A Chatkaeomorakot; B Rowe
Journal:  Am J Trop Med Hyg       Date:  1989-12       Impact factor: 2.345

9.  Antibiotic resistance conferred by a class I integron and SXT constin in Vibrio cholerae O1 strains isolated in Laos.

Authors:  Masaaki Iwanaga; Claudia Toma; Tomoko Miyazato; Sithat Insisiengmay; Noboru Nakasone; Masahiko Ehara
Journal:  Antimicrob Agents Chemother       Date:  2004-07       Impact factor: 5.191

10.  Distribution of class I integron and sulfamethoxazole trimethoprim constin in Vibrio cholerae isolated from patients in Iran.

Authors:  Maryam Adabi; Bita Bakhshi; Hossein Goudarzi; Seyed Mohsen Zahraei; Mohammad R Pourshafie
Journal:  Microb Drug Resist       Date:  2009-09       Impact factor: 3.431

View more
  2 in total

1.  Genetic Characterization of AmpC and Extended-Spectrum Beta-Lactamase Phenotypes in Escherichia coli and Salmonella From Alberta Broiler Chickens.

Authors:  Tam Tran; Sylvia Checkley; Niamh Caffrey; Chunu Mainali; Sheryl Gow; Agnes Agunos; Karen Liljebjelke
Journal:  Front Cell Infect Microbiol       Date:  2021-03-12       Impact factor: 5.293

2.  Determination of ctxAB expression in Vibrio cholerae Classical and El Tor strains using Real-Time PCR.

Authors:  Seyed Mahmoud Amin Marashi; Ramazan Rajabnia; Abbas Ali Imani Fooladi; Zohreh Hojati; Sharareh Moghim; Bahram Nasr Esfahani
Journal:  Int J Mol Cell Med       Date:  2013
  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.