The generation of NGF-secreting primary rat monocytes: a comparison of different transfer methods.

Nerve growth factor (NGF), a member of the neurotrophin family, is responsible for the maintenance and survival of cholinergic neurons in the basal forebrain. The degeneration of cholinergic neurons and reduced acetycholine levels are hallmarks of Alzheimer's disease (AD) as well as associated with learning and memory deficits. Thus far, NGF has proven the most potent neuroprotective molecule against cholinergic neurodegeneration. However, delivery of this factor into the brain remains difficult. Recent studies have begun to elucidate the potential use of monocytes as vehicles for therapeutic delivery into the brain. In this study, we employed different transfection and transduction methods to generate NGF-secreting primary rat monocytes. Specifically, we compared five methods for generating NGF-secreting monocytes: (1) cationic lipid-mediated transfection (Effectene and FuGene), (2) classical electroporation, (3) nucleofection, (4) protein delivery (Bioporter) and (5) lentiviral vectors. Here, we report that classical transfection methods (lipid-mediated transfection, electroporation, nucleofection) are inefficient tools for proper gene transfer into primary rat monocytes. We demonstrate that lentiviral infection and Bioporter can successfully transduce/load primary rat monocytes and produce effective NGF secretion. Furthermore, our results indicate that NGF is bioactive and that Bioporter-loaded monocytes do not appear to exhibit any functional disruptions (i.e. in their ability to differentiate and phagocytose beta-amyloid). Taken together, our results show that primary monocytes can be effectively loaded or transduced with NGF and provides information on the most effective method for generating NGF-secreting primary rat monocytes. This study also provides a basis for further development of primary monocytes as therapeutic delivery vehicles to the diseased AD brain.

Introduction

Alzheimer's disease (AD) is a progressive neurodegenerative disease characterized by the deposition of tau-associated neurofibrillary tangles and β-amyloid (Aβ)-associated senile plaques, the loss of cholinergic neurons, the emergence of inflammation and distinct cerebrovascular dysfunctions. Severe cognitive decline and memory deficiencies have been attributed to the degeneration of cholinergic neurons and the lack of acetylcholine. Thus, neuroprotective therapies (i.e. growth factor administration) that counteract this neuronal loss may prove beneficial in alleviating AD-associated memory loss and diminished cognition.

NGF is a neurotrophic factor that among other functions promotes the survival and function of cholinergic neurons in the basal forebrain. Evidence has shown that NGF stimulates neuronal cell function, improves cognitive function, and prevents cholinergic neuron cell death. Furthermore, recent studies have shown that a lack of NGF can lead to AD-like neurodegenerative phenotype in transgenic mice (Capsoni et al., 2010). However, the ability to safely and effectively deliver NGF to the brain has proven difficult. Previous investigations have explored several strategies to deliver NGF into the brain including: intracerebroventricular administration (Seiger et al., 1993), ex vivo gene therapy using grafts of NGF-secreting fibroblasts (Tuszynski et al., 2005) or cells transfected by an adeno-associated virus gene transfer (Mandel and Burger, 2004) or a lentiviral vector (Nagahara et al., 2009). These procedures, however, resulted in adverse side effects from widespread growth factor distribution as well as required neurosurgical and invasive means to administer NGF. Due to an ever growing AD disease population such methods may prove inefficient and costly for therapeutic purposes. Thus, researchers have turned to less invasive methods for NGF delivery including: Transferrin receptor-mediated transport (Granholm et al., 1998), intranasal or intraocular application (Capsoni et al., 2009), poly (butyl cyanoactylate) nanoparticle (Kurakhmaeva et al., 2009), microsphere (Gu et al., 2009) or engineered T-cell (Kramer et al., 1995) transport. We have previously demonstrated that NGF-loaded monocytes transplanted into the brain can protect cholinergic neurons against degeneration (Zassler and Humpel, 2006). More recently, we showed in proof-of-principle that monocytes can be used as a carrier system to deliver NGF to the brain (Böttger et al., 2010). This strategy should not only provide a non-invasive and simple mode of delivery (via peripheral administration), but also potentially restrict NGF targeting to lesion sites (avoiding adverse side effects caused by systemic NGF administration).

Although many methods of gene transfer have been developed for effective genetic modification of mammalian cells, the genetic engineering and maintenance of monocytic cells has proven difficult. In this study, we compared five methods of generating NGF-secreting primary rat monocytes: (1) lipid-mediated transfection (Effectene and GuGene), (2) classical electroporation, (3) nucleofection, (4) protein delivery using Bioporter and (5) lentiviral vectors. In this study, we show that classical transfection methods using electroporation or lipid-mediated transfection (Effectene and Fugene HD) are inadequate for proper transfection of primary rat monocytes with NGF. In addition, we show that nucleofection can transfect primary rat monocytes, however, with high variability and poor reproducibility. We report that the transduction of primary rat monocytes is best achieved by using lentiviral vectors or the protein delivery system Bioporter. We also demonstrate that Bioporter does not alter monocyte function as measured by their ability to phagocytose Aβ and begin differentiation.

Methods

Expression vector construction

All non-viral transfection experiments were carried out using the expression vectors pEF-NGF or pcDNA3.1-NGF. Expression vector pEF-neo (5636 bp) was generated as previously described (Wiesenhofer and Humpel, 2000; Zassler and Humpel, 2006) and contains the functional gene NGF (rat, [GenBank: M36589], 723 bp) subcloned into a unique EcoRI restriction site in the pEF-neo vector. pEF-(−) was used in control experiments and consists of the pEF-neo vector containing a 380 bp Stuffer inserted into a unique BstXI restriction site. In order to generate pcDNA3.1-NGF, the coding sequence of rat NGF was amplified from plasmid pEF-NGF using primers CACCATGTCCATGTTGTTCTAC and TCAGCCTCTTCTTGCAGC. The PCR fragment was gel-purified and cloned into mammalian expression vector pcDNA3.1D/V5-His-TOPO (Invitrogen) at BamHI and XbaI sites. The fidelity and orientation of pcDNA3.1D/V5-His-ratNGF was then confirmed by restriction digest and sequencing. The plasmid pcDNA3.1-ratNGF under the control of the CMV promoter was generated to determine if transfection efficiency could be optimized with a different expression vector and promoter. Two lentiviral vectors (pHR-bA-NGF and pHR-SFFV) were also generated under the β-actin and SFFV promoters (see below for details).

Isolation of primary rat monocytes

Primary rat monocytes were freshly isolated as previously described by us with some modifications (Humpel, 2008; Böttger et al., 2010; Hohsfield and Humpel, 2010). In brief, Sprague–Dawley rats (250 g, Himberg, Austria) were anesthetized by an intraperitoneal injection of 40 mg/kg body weight thiopental (Sandoz, Kundl, Austria) and perfused with 500 ml of 4 °C pre-chilled 10 mM phosphate-buffer saline (PBS)/2.7 mM EDTA/25 mg/ml heparin, pH 7.3 through the left ventricle. The collected effluent was centrifuged at 550 ×g for 10 min at 4 °C. The perfusate pellet was resuspended in 50 ml of 10 mM PBS/1% bovine serum albumin (BSA; SERVA Electroporesis, Heidelberg, Germany)/2.7 mM EDTA, pH 7.3 and carefully overlaid on a Percoll working solution (Scriba et al., 1996). After centrifugation at 500 ×g for 30 min at 4 °C, peripheral blood mononuclear cells (PBMC) were harvested from the interface. PBMC were then washed once with 50 ml of PBS and ~ 20 × 106 PBMC were resuspended in 100 μl of PBS/BSA/EDTA. Monocytes were purified from PBMC by negative magnetic selection: PBMC were incubated in a cocktail consisting of four different purified anti-rat monoclonal antibodies (20 μg of each: CD8a (clone OX-8), CD5 (clone OX-19), CD45RA (clone OX-33), PAN T (clone OX-52); all from Cedarlane Laboratories, Szabo, Austria) for 10 min at 4 °C shaking. PBMC were washed once with PBS and resuspended in 100 μl of PBS/BSA/EDTA and 40 μl of MACS Goat Anti-Mouse-IgG Microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany). PBMC were incubated for 15 min at 4 °C on a shaker and following incubation washed once with PBS. The cells were resuspended in 1000 μl of PBS/BSA/EDTA and then applied to a MS-MACS column fixed to a strong magnet. The purified monocytes were centrifuged and pooled for further experiments. Approximately 10 × 106 cells were isolated from one adult rat. The described isolation procedure yields approximately 90–95% CD68-positive monocytes (Moser and Humpel, 2007; Böttger et al., 2010). Monocytes were counted using the Cell Coulter Counter (COULTER®Z™ Series, Fischerlehner & Kucera, Innsbruck, Austria) in a range from 5.5 to 10 μm. All animal experiments were approved by the Austrian Ministry of Science and conformed to the Austrian guidelines on animal welfare and experimentation. All possible steps were taken toward reducing the number of animals used and their suffering.

Electroporation

Freshly isolated monocytes were transiently transfected with pEF-(−), pmaxGFP, or pEF-NGF plasmids by electroporation using Electroporator BTX 830 (BTX Harvard Apparatus) according to the manufacturer's recommendations. pmaxGFP plasmid was provided from Amaxa and used to visualize transfection efficiency. For optimal cell survival and transfection efficiency, cells were incubated 5 min on ice with 10 μg of plasmid DNA and subsequently electroporated with 1 pulse at 500 V for 1 ms. Transfection conditions were optimized for plasmid DNA concentration, cuvette gap width, pulse length and pulse number. The effects of different electroporation buffers (HEPES and PBS), incubation without ice, and an added 10 min recovery period were also evaluated (data not shown). Control samples were either electroporated using an empty vector (pEF-(−)) or electroporated without pulse. Following electroporation, cells were centrifuged at 250 ×g for 5 min, resuspended in glia (Optimem I, 5% horse serum, 0.5% FCS) or slice (50% MEM/HEPES (Gibco), 25% heat-inactivated horse serum (Gibco/Lifetech, Austria), 25% Hanks' solution (Gibco), 2 mM NaHCO3 (Merck, Austria), 6.5 mg/mL glucose (Merck), and 2 mM glutamine (Merck), pH 7.2) culture medium without antibiotics/antimycotics, plated on pre-warmed 24-well or 6-well collagen-coated culture plates, and incubated for 1–7 days at 37 °C/5% CO2. After incubation, cell supernatants were collected for NGF ELISA and/or pooled for addition to organotypic brain slices or cells were stained for further microscopic analysis. Primary astrocytes were isolated as previously done (Wiesenhofer and Humpel, 2000; Zassler et al., 2005a) and used as a positive control.

Effectene transfection

Freshly isolated rat monocytes were transiently transfected with pEF-NGF plasmid using the non-liposomal lipid reagent Effectene Transfection Reagent (QIAGEN) according to the manufacturer's instructions. Briefly, 2 × 104–2 × 105 cells were added to each well in glia culture medium (Optimem I, 5% horse serum, 0.5% FCS) on 24-well collagen-coated culture plates. Effectene Transfection Reagents were prepared in glia culture medium (without antibiotics/antimycotics) and added drop-wise to the cells. The transfection method was optimized by testing the effects of: the number of cells added, prolonged incubation time, and removal of complexes after 16 h (data not shown). Cells were incubated with transfection complexes for 24 h. After incubation, cell supernatants and extracts were collected for further use. Primary astrocytes were isolated as previously done (Wiesenhofer and Humpel, 2000; Zassler et al., 2005a) and used as a positive control.

FuGENE HD transfection

Primary cultures of freshly isolated rat monocytes were transiently transfected with pEF-NGF plasmid using FuGene HD Transfection Reagent (Promega) according to manufacturer's instructions. Briefly, cells were seeded 1 × 105 cells per well in medium (without antibiotic/antimycotics). Cells were incubated at 37 °C until reaching 80% confluency on the day of transfection. On the day of transfection, the DNA-FuGENE mix was prepared in Optimem (Gibco) and added drop-wise to the cells. Different concentrations of DNA, amount of FuGENE HD reagent, incubation times with transfection mix, ‘boosting’ with transfection mix, and recovery times were also evaluated (data not shown). Cells were incubated with transfection complexes for 24, 48, or 72 h in Amaxa culture medium (10% FCS, 2 mM glutamine, 1 ng/ml M-CSF, 1 ng/ml GM-CSF). After incubation, cell supernatants were collected for further use.

Nucleofection

Primary cultures of freshly isolated rat monocytes were nucleofected with pEF-(−), pmaxGFP, or pEF-NGF using the Human Monocyte Nucleofection kit (Amaxa) according to the manufacturer's instructions. Monocytes were pelleted directly following isolation at 250 ×g for 5 min. Cell pellets were resuspended in 110 μl of Nucleofector solution (Amaxa), mixed with plasmid DNA, and transferred to an Amaxa cuvette. Nucleofection was performed using the Amaxa program Y-001. Control samples were nucleofected using the empty vector (pEF-(−)). Immediately following nucleofection, 500 μl of pre-warmed glia culture medium (Optimem I, 5% horse serum, 0.5% FCS) (without antibiotics/antimycotics) or Amaxa culture medium (10% FCS, 2 mM glutamine, 1 ng/ml M-CSF, 1 ng/ml GM-CSF) was added to the cuvette and subsequently transferred to a collagen-coated 24-well culture plate. Nucleofected cells were incubated for 1–2 days at 37 °C 5% CO2. After incubation, cell supernatants and extracts were collected for NGF ELISA or cells were stained for further microscopic analysis. Primary astrocytes were isolated as previously done (Wiesenhofer and Humpel, 2000; Zassler et al., 2005a) and used as a positive control.

Lentiviral mediated infection of target cells

The coding sequence of rat NGF was amplified from plasmid pEF-NGF using primers ON3370 caaaaaagcaggctccgccaccatgtccatgttgttctacactctg and ON3371 CAAGAAAGCTGGGTCT CAGCCTCTTCTTGCAGCCTTC, gel-purified and reamplified using primers ON1106 GGGGACAAGTTTGTACAAAAAA GCA GGC Tcc and ON1107 GGGGA CCACTTTGTACAAGAA AGC TGG GTc to generate attB1 and attB2 sequences, respectively. The purified PCR product was gel purified and recombined into pDONR207 using BP clonase (Invitrogen) to generate pENTR-rNGF. After sequence verification, lentiviral expression plasmids were generated by recombining pENTR-rNGF with pHR-SFFV-DEST and pHR-ba-DEST using LR clonase (Invitrogen). The resulting lentiviral constructs pHR-SFFV-rNGF and pHR-ba-rNGF express rNGF under the control of the SFFV and beta actin promoter, respectively. Human embryonic kidney cells (HEK293T) were transiently transfected with pHR-SFFV-rNGF or pHR-ba-rNGF along with psPAX2 packaging and pVSV-G pseudotyping plasmids for 72 h. Twenty-four hours after transfection, the culture media was exchanged for the growth media required for rat monocytes and viral particle containing supernatants harvested 48 and 72 h after transfection. The supernatants were filter sterilized, supplemented with 4 μg/ml polybrene and added to 0.5 × 106 rat monocytes seeded into 24-well plates. HeLa cells were used as a positive control. The vector pHR-SFFV-Venus-NLS-PEST(VNP) expresses a short-lived nuclear yellow fluorescent protein and was used to visualize effective transduction and/or as a negative control.

Bioporter protein delivery

Primary cultures of freshly isolated rat monocytes were loaded with recombinant NGF using the Bioporter Protein Transfer Reagent (QuickEase). Briefly, two vials of Bioporter reagent were prepared: 2.5 μl of Bioporter reagent was mixed with or without (negative control) 100 ng of recombinant NGF in 100 μl of sterile PBS (pH 7.4) and then incubated with the reagent for 5 min at 20 °C. Following incubation, 2.5 × 106 monocytes were resuspended in 400 μl Optimem and added to two vials, each containing diluted Bioporter reagent. The cells were then incubated for 3 h rotating at 10 rpm (Pluriplex rotor). After incubation, cells were centrifuged and dissolved in 500 μl of Optimem. The cells were then pooled (5 × 106 cells), placed into a new eppendorf tube, and washed 3 × with Optimem. After washes, the cell pellet (~ 5 × 106 cells) was resuspended in 1.5 ml of pre-warmed Amaxa medium and cells were cultured on a collagen-coated 6-well plate for 24 h at 37 °C. Following 24 h incubation, the supernatant was collected for further use.

FITC-Aβ phagocytosis and differentiation in Bioporter-loaded monocytes

Following Bioporter treatment, primary rat monocytes (~ 10,000/well) were added to 400 μl culture medium (MEM + 1 mg/ml BSA + 25 mM Hepes, pH = 7.3, ± 10 ng/ml rat macrophage colony-stimulating factor (M-CSF) (Peprotech)) in collagen-coated Lab-Tek chamber glass slides (Nunc) and incubated for two days at 37 °C/5% CO2. Monocytes were then washed and exposed to fluorescein isothiocyanate (FITC)-β-amyloid1-42 peptide (2.5 μg/ml, Bachem) for 2.5 h. Following incubation with Aβ peptide, cells were washed and then visualized under the fluorescence microscope (Leica DMIRB). Images were obtained as described below. Cells were then fixed with 4% PAF and stained for ED1.

Functional assay of NGF and cytokine secretion by Bioporter-loaded monocytes

Following Bioporter treatment, primary rat monocytes (~ 1 × 106) were incubated in 500 μl of culture medium ± 10 μg rat Aβ1-42 (Calbiochem) at 37 °C/5% CO2. Supernatant was collected at 0.2, 3 and 24 h. Subsequently, supernatants were evaluated for NGF and cytokine secretion by ELISA.

Fluorescence microscopy

To evaluate effective transfection efficiency, following incubation, pmaxGFP transfected cells were washed with PBS and then fixed with 4% PFA for 30 min at 4 °C. Following washes, cells were stained with nuclear DAPI (1:10,000, Sigma) for 20 min. Cells were then washed with PBS and visualized under the fluorescence microscope (Leica DMIRB). DAPI and GFP microscope images were obtained using Improvision Openlab 4.0.4 imaging software captured with DAPI and FITC filter sets, respectively.

Flow cytometry

Cell viability was determined by analyzing the number of necrotic and apoptotic cells by flow cytometry (BD Accuri C6, BD Biosciences) using annexin V-FITC and propidium iodide (PI; Annexin V-FITC Apoptosis Detection Kit, BD Biosciences) staining according to manufacturer's instructions. Gating was performed on monocytes based on side-scatter and forward-scatter properties. All necessary controls were included.

Organotypic brain slices

Cholinergic neurons in organotypic brain slices were cultured as previously described (Weis et al., 2001; Humpel and Weis, 2002; Böttger et al., 2010). Briefly, the basal nucleus of Meynert of postnatal day 10 (P10) rats was dissected under aseptic conditions, 400 μm slices were cut with a tissue chopper (McIlwain, USA), and the slices were placed on a 30-mm Millicell-CM 0.4 μm pore membrane culture plate inserts (7–8 slices per membrane). Slices were cultured in 6-well plates at 37 °C/5% CO2 with 1.2 ml/well of pooled and filtered medium containing pEF-NGF or pEF-(−)-transfected cells or slice medium supplemented with or without 10 ng/ml recombinant NGF for 2 weeks. We have previously established that 400 μm brain slices become thinner following 2 weeks of incubation with a thickness of approximately 100 μm. This flattening is also an internal control indicating a good preparation and dissection. Slices that did not flatten were immediately removed from the experiments.

Immunohistochemistry

Immunohistochemistry was performed as previously described (Zassler et al., 2005b; Zassler and Humpel, 2006; Böttger et al., 2010; Hohsfield and Humpel, 2010). Brain slices were fixed for 3 h at 4 °C in 4% PFA/10 mM PBS, washed in PBS and stored at 4 °C until use. Cultured cells were fixed for 30 min in 4% PFA. After fixation, slices/cells were washed with 0.1% Triton/PBS (T-PBS) for 30 min at 20 °C and then pretreated with 5% methanol/1% H2O2/PBS for 20 min to destroy endogenous peroxidase. Slices/cells were then washed 3 × with PBS and blocked in 20% horse serum/0.2% BSA/T-PBS for 30 min. Following blocking, cells and slices were incubated with the primary antibody against choline acetyltransferase (ChAT, 1:750; AB144P, Chemicon or Millipore) or ED1 (1:500; Chemicon or Millipore) in 0.2% BSA/T-PBS overnight and 2 days at 4 °C, respectively. Slices/cells were then washed and incubated with secondary anti-goat (ChAT) or anti-mouse (ED1) biotinylated antibodies (1:200, Vector Laboratories, USA) in 0.2% BSA/T-PBS for 1 h at 20 °C. After washing, slices/cells were incubated in avidin–biotin complex solution (ABC; Elite Standard PK6100, Vector Laboratories) for 1 h at 20 °C. Finally, the cells were washed 3 × with 50 mM Tris-buffered saline (TBS) and then incubated in 0.5 mg/ml 3,3′ diaminobenzidine (DAB)/0.003% H2O2/TBS at 20 °C in dark until signal was detected. Once DAB staining was visible, the reaction was stopped by adding TBS to cells. Slices/cells were washed and then evaluated by microscopy (Leica DMIRB). Alternatively, NGF-positive monocytes were detected by immunofluorescence using the primary antibody against NGF (1:250; Cedarlane) and anti-rabbit Alexa 488 secondary antibody (1:400; Invitrogen). Following washes, cells were stained with nuclear DAPI (1:10,000, Sigma) for 20 min. Fluorescence microscope images were obtained using Improvision Openlab 4.0.4 imaging software captured with Alexa488/FITC filter sets. Omission of the primary antibody served as a negative control. For confocal microscopy, the cells were visualized with a Leica TCS SP5 microscope under a 64x glycerol objective and processed with Huygens Deconvolution and Imaris V6.4 software.

NGF ELISA

The amount of NGF secreted into the supernatant by transfected and control cells was determined using an indirect sandwich enzyme-linked immunosorbent assay (ELISA; Promega) as previously described (Zassler and Humpel, 2006; Böttger et al., 2010). Cell supernatants were collected each day following transfection and assayed for NGF content. Briefly, 96-well ELISA plates were coated with a monoclonal anti-NGF antibody diluted in carbonate coating buffer (pH 9.7) and incubated overnight at 4 °C. Plates were then blocked using 1 × blocking buffer (200 μl/well) for 1 h at 20 °C. Following incubation, NGF standards (0–100 pg/well) or diluted medium (100 μl) were added to plates and incubated for 6 h at 20 °C. After washes, plates were incubated with a monoclonal rat anti-NGF antibody overnight at 4 °C. After a second round of washes, the plate was incubated with horseradish peroxidase-conjugated anti-rat antibody (1:4000) for 2 h at 20 °C. Plates were again washed and incubated with enzyme substrate (TMB One solution, Promega) for 15 min at 20 °C. The enzyme reaction was stopped by adding 1 N HCl and the absorbance was measured at 450 nm by a microplate ELISA reader (Zenyth 3100 ELISA reader or LambdaE, MWG). Sample values were calculated from a standard curve in the linear range. The detection limit was 10 pg/ml.

Searchlight multiplex ELISA

The detection of inflammatory proteins (monocyte chemotactic protein-1, MCP-1; macrophage inflammatory protein-2, MIP-2; tumor necrosis factor-α, TNFα; interleukin-1β, IL-1β,) was performed using the Thermo Scientific SearchLight Protein Array Technology (THP Medical Products, Vienna) according to the manufacture's recommendations (Bio-Rad) and as previously described by us (Hohsfield and Humpel, 2010). The luminescent signal was detected using a compatible CCD imaging and analysis system measuring absorbance at 450 nm. The concentration of each sample was quantified by comparing the spot intensities with the corresponding standard curves calculated from the standard sample results using the SearchLight Array Analyst Software. Integrated density values were proportional to the concentrations of bound proteins. Standard curves, raw data and final pg/ml concentrations for each analyte and each sample were reviewed in the array software and exported to Microsoft Excel Software for further statistical analysis. Sample values were calculated from the standard curve in a linear range.

Quantitative analysis and statistics

All counts were based on individual sections and show the total number of neurons per slice. The number of microscopically detectable immunoreactive ChAT-positive neurons was counted in each whole slice and visualized under the 40 × objective by a blind observer. Multistatistical analysis (KaleidaGraph) was obtained by one-way ANOVA with Fisher LSD post hoc test, comparing controls against respective treatments in which p < 0.05 represents statistical significance.

Results

Evaluation and optimization of primary rat monocyte gene transfection

We were interested in identifying the most efficient transfection method for generating NGF-secreting primary rat monocytes. Each system was optimized and evaluated for reproducibility and functional gene expression (NGF secretion). Unfortunately, no NGF secretion was observed in primary monocytes transfected by electroporation, Effectene or FuGene (even following extensive optimization) (Table 1). Note that Table 1 only displays NGF secretion under optimized conditions. Refer to Methods section for all transfection conditions tested. Although the transfection conditions tested within each method were not always equivalent (i.e. DNA concentration) to other methods tested, this was not the reason for different efficiencies between systems. DNA input was determined in accordance with the recommended method levels and thus different concentrations were needed to optimize each method. When primary rat monocytes were transfected using nucleofection, monocytes secreted 0.8 ± 0.2 ng/ml NGF per 24 h per 1 million cells under optimized conditions (determined after many attempts at varying transfection conditions, see Table 1). Approximately 10–30% of nucleofected monocytes were transfected with the pmaxGFP vector (data not shown). However, monocyte nucleofection reproducibility was low (21%). Cell viability was also relatively low in nucleofected cells, where approximately 89% were annexin-V-positive and approximately 51% PI-positive (Fig. 1D–F). Although many attempts were made to enhance reproducibility and determine the factors responsible (i.e. optimizing monocyte isolation/purification, plasmid purification, plasmid concentration, number of monocytes transfected, presence or absence of recovery periods, addition of growth factors, incubation time), only 13 out of 62 nucleofections were successful (i.e. produced > 0.1 ng/ml NGF) (Table 1). We also tested the use of different vector and promoter systems (i.e. pcDNA3.1-NGF) as well as nucleofection programs with no observable improvements.

Table 1

Evaluation of different NGF transfection or transfer methods in primary rat monocytes.

Cell type	Transfection method	NGF secretion[ng/ml × 24 h × 106 cells]	Set-up	Remarks
pA	Electroporation	1.9 ± 0.3 (4)	500 V, 1 pulse, 1000 μs, gap width 2, 10 μg DNA, glia medium (5 μg works as well, but not better)	100% electroporations successfulConsistent NGF transfection method
pA	Effectene	31.2 ± 7.8 (12)	2 × 104–2 × 105 cell seeding, 1:10 DNA/Effectene ratio, 0.2 μg DNA, glia medium, 48 h incubation best	86% transfections successful (n = 14)
pA	Nucleofection	24.2 ± 6.4 (8)	5 μg DNA (EtOH ppt), T-20 program, glia medium, Amaxa Rat Astrocyte kit (1 μg DNA tested 1 ×, similar results)	100% nucleofections successful
pM	Electroporation	nd (9)	500 V, 1–80 pulses, 50–1000 μs, 1–20 μg DNA	0% electroporations successful
pM	Effectene	nd (4)	1 μg, 1 × 106 cells (tried 0.2 μg and lower cell population, but not better), glia medium, 24 h incubation	0% transfections successfulNGF levels so low further testing abandonedMore optimization needed
pM	FuGene HD	nd (9)	105 cell seeding into 24-well, 0.2–2 μg DNA, 1.7–5 μl FuGene, Amaxa medium, 6–8 h recovery or no recovery, 24–72 h incubation	0% Fugene transfections successful
pM	Nucleofection	0.8 ± 0.2 (13)	2 × 106 cells into 4 collagen coated 4-well or 1 6-well, Y-001 program, Amaxa medium, 1 μg DNA (ppt +/− cut), Amaxa Human Monocyte kit	21% nucleofections successful (n = 62)Extremely inconsistent results(tested multiple conditions: plasmid purification,pM purification (Pluriselect), multi pulse, DNA concentration, pM amount, recovery, growth factors, different collection methods, different incubation conditions)
pM	Nucleofection	nd (6)	same as above except different vector (pcDNA3.1-ratNGF)	0% nucleofections successful
pM	Bioporter	0.6 ± 0.2 (10)	2.5 × 106 cells, 100 ng NGF, 1–3 h rotating incubation, 3 x 1 ml Optimem washes, Amaxa medium	100% Bioporter deliveries successfulHigh background, but seems to be good working method for NGF delivery

Following isolation, primary rat monocytes (pM) were immediately transfected as stated above. Cells were transfected with the pEF-NGF vector unless otherwise indicated. Following transfection, cells were incubated for 24 h. After incubation, the supernatant was collected and frozen for further analysis. NGF secretion was measured by NGF ELISA. The experimental set-up is given and indicates all variables tested in attempts to optimize transfection. When only one variable is given, this indicates that the variable was successful in more effective transfection. Values = mean ± SEM ng/ml of NGF secreted per 1 × 106 monocytes per 24 h. NGF secretion is corrected for background (n indicates number of replicates under optimized conditions). pEF-(−) vector or pEF-NGF vector without pulse/transfection reagent served as negative controls. Primary astrocytes (pA) were used as a positive control. Percentage of transfection success refers to transfections that produced > 0.1 ng/ml NGF under optimized conditions.

Fig. 1

Cell viability of primary rat monocytes following transfection and transduction. FACS analysis was performed on monocytes immediately following isolation (A–C), nucleofection with the NGF expression vector (D–F), or Bioporter delivery with recombinant NGF (G–I). Cell viability was determined by evaluating the number of necrotic and apoptotic cells using annexin V (B,E,H) and propidium iodide (PI; C,F,I) staining, respectively.

Evaluation of primary rat monocyte lentiviral transduction

After our unsuccessful attempts at generating a reproducible and efficient transfection system for primary rat monocytes, we explored the transfection potential of lentiviral vectors. HeLa cells were used as a positive control for lentiviral transductions. They produced 19.5 ± 1.6 and 14.5 ± 1.4 ng/ml NGF with 100% reproducibility using lentiviral vectors using the promoters bA and SFFV, respectively (Table 2). Forty-eight hours after initial infection with vectors pHR-bA-NGF and pHR-SFFV-NGF, NGF secretion was measured at 15.6 ± 2.5 and 9.1 ± 2.6 ng/ml NGF per 1 million cells, respectively (Table 2). Although cell cytotoxicity was high at medium collection, the number of surviving monocytes produced high levels of NGF with an 86-100% success rate (Table 2).

Table 2

Evaluation of lentiviral transduction in primary rat monocytes.

Cell type	Vector	NGF secretion [ng/ml × 106 cells]	Remarks
HeLa	pHR-bA-NGF	19.5 ± 1.6 (13)°	100% infections successful
	pHR-SFFV-NGF	14.5 ± 1.4 (13)°	100% infections successful
pM	pHR-bA-NGF	15.6 ± 2.5 (15)	100% infections successful
	pHR-SFFV-NGF	9.1 ± 2.6 (15)	86% infections successful
HeLa	-	0.038 ± 0.026 (7)	Not applicable
	pHR-SFFV-VNP	0.096 ± 0.021 (13)	Not applicable
pM	–	0.018 ± 0.018 (6)	Not applicable
	pHR-SFFV-VNP	0.124 ± 0.029 (11)	Not applicable

Following isolation, primary rat monocytes were seeded onto a 24-well plate (0.5 × 106/well) in medium containing antibiotics/antimycotics. At time of infection, HeLa cells were 75% confluent. Supernatants containing viral particles were added to the cells and incubated for 24 h. After infection, cells were washed and new medium was added. Supernatants were then collected after 24 h, 48 h after initial infection, and frozen at − 80 °C. NGF secretion was measured by NGF ELISA. Values = mean ± SEM ng/ml of NGF secreted by 1 × 106 monocytes or °confluent HeLa cells. NGF secretion is corrected for background (n indicates number of separate wells infected from four independent experiments). Under Remarks, percentage of infection success refers to infections that produced > 0.1 ng/ml NGF, which were not applicable for negative controls. HeLa cells were used as a positive control. pHR-SFFV-VNP expresses a yellow fluorescent protein and was used as a negative control.

Evaluation and optimization of primary rat monocyte using Bioporter

Although NGF secretion by lentiviral transduction was high, we were still interested in developing a reproducible and non-viral method to generate NGF-secreting primary rat monocytes. In this case, we investigated the loading potential of Bioporter, a protein delivery system. In this study, we demonstrated that Bioporter delivers recombinant NGF to primary rat monocytes with a 100% success rate and results in 0.6 ± 0.2 ng/ml of NGF secretion per 24 h per 1 million cells (Table 1). This method was comparable to nucleofection in terms of secretion levels, however, demonstrated a marked improvement in reproducibility. Bioporter-loaded monocytes also showed a higher cell viability compared to nucleofected monocytes. Approximately 25% of Bioporter-treated monocytes were annexin V-positive and approximately 8% were PI-positive (Fig. 1G-I). By immunohistochemistry methods we observed strong NGF immunoreactivity in 58 ± 3 (n = 10) % of all DAPI-positive cells (Fig. 2B). We also observed two distinct staining phenotypes: a perinuclear staining (33 ± 4 (n = 10) % of all cells; Fig. 2B and C) and an intracellular/cytoplasmic staining (26 ± 3 (n = 10) % of all cells; Fig. 2B and D). In addition to NGF staining, we also evaluated these cells for ED1, a common rat monocyte marker (Fig. 2A), and observed no change in cell phenotype following Bioporter protein loading. Previous investigation has shown that Bioporter-loaded monocytes secrete bioactive and nontoxic NGF (Böttger et al., 2010).

Fig. 2

Immunohistochemical evaluation of NGF in primary rat monocytes loaded using Bioporter. Monocytes were stained for the monocyte specific marker ED1 (A) or anti-NGF following Bioporter NGF delivery (B–D). Fig. 2A shows that the majority of primary monocytes are ED1-positive. Fig. 2B demonstrates that Bioporter-loaded monocytes display a strong NGF-like immunoreactivity that, upon confocal microscopy evaluation, is incorporated either in the intracellular/cytoplasmic space of the monocyte or concentrated near the nucleus (perinuclear) (C–E). Fig. 2E displays a phase contrast image of the cell captured in Fig. 2D. Scale bar = 30 μm (A), ~ 7 μm (B), or ~ 3 μm (C–E).

Evaluation of functional properties in primary rat monocytes loaded with Bioporter

Since Bioporter demonstrated efficient NGF secretion and resulted in high reproducibility for generating NGF-secreting primary monocytes, we were also interested in evaluating the functional properties of these cells. Monocytes transduced by lentiviral infection were not evaluated functionally. Ultimately, we wish to pursue studies in an in vivo setting where side effects from viral vectors still pose potential problems. In previous experiments, we demonstrated that NGF secretion from Bioporter-loaded monocytes significantly enhances the number of cholinergic neurons in organotypic brain slices (Böttger et al., 2010). However, it still remains unclear whether these cells maintain proper functioning (i.e. differentiation and phagocytosis of potentially toxic agents). After 2.5 h exposure with the peptide, Biporter-loaded cells appeared to take up or phagocytose FITC-Aβ1–42, as seen by fluorescent cytoplasmic staining of cells (Fig. 3D–F). We also stained these cells for ED1, a known marker for rat monocytes/macrophages, and evaluated the cells for typical macrophage morphology after cultivation for two days in the presence of M-CSF(Fig. 3A). Monocytes incubated without M-CSF maintained their typical small and round morphology, whereas, monocytes incubated with M-CSF exhibited signs of differentiation as seen by an increase in cytoplasmic volume and the appearance of processes (Fig. 3B and C). Bioporter-loaded monocytes were also tested for effective NGF and cytokine secretion at various time intervals. Table 3 shows that monocytes secreted NGF and cytokines in a time-dependent fashion following Bioporter treatment. Exposure to rat Aβ1-42 did not stimulate enhanced cytokine secretion (Table 3).

Fig. 3

Evaluation of functional properties in primary rat monocytes loaded with Bioporter. Monocytes were isolated as usual and cultured for two days in the absence (A,B) or presence of M-CSF (B,C,E,F). Phagocytosis was evaluated by exposure of FITC-Aβ1–42 for 2.5 h and subsequent visualization under fluorescence microscope. Intermediate differentiation was evaluated after staining cells with ED1 (A–C). Monocytes cultured without M-CSF maintain their typical small and round morphology (A). Cells cultured with M-CSF show processes (B) and increased cytoplasmic volume and granularity (C,E,F). Scale bar ~ 10 μm.

Table 3

Evaluation of NGF and cytokine secretion following Bioporter transduction and β-amyloid (Aβ) addition.

Condition	Time	NGF	MCP-1	MIP-2	TNF-α	IL-1β
pM-NGF	0.2	70 ± 32 (6)	11 ± 4 (6)	4 ± 1 (6)	nd (6)	nd (6)
	3	202 ± 92 (6)	206 ± 83 (6)	187 ± 70 (6)	184 ± 71 (6)	nd (6)
	24	473 ± 140 (6)	1658 ± 543 (6)	383 ± 118 (6)	103 ± 25 (6)	33 ± 12 (6)
pM-NGF + Aβ	0.2	53 ± 29 (6)	15 ± 10 (6)	4 ± 3 (6)	nd (6)	nd (6)
	3	289 ± 92 (6)	163 ± 71 (6)	171 ± 78 (6)	138 ± 61 (6)	nd (6)
	24	415 ± 106 (6)	1354 ± 572 (6)	324 ± 124 (6)	82 ± 25 (6)	20 ± 8 (6)

Following isolation, primary rat monocytes (pM) were transduced with recombinant NGF using Bioporter. Following transduction, 10 μg/ml rat Aβ1–42 was added to the culture medium and cell were incubated at 37 °C. Supernatant was collected after 0.2, 3, and 24 h. NGF secretion was measured by NGF ELISA and cytokine secretion by Searchlight Multiplex ELISA. Values = mean ± SEM pg/ml of NGF or cytokine secreted per 1 × 106 monocytes. Secretion is corrected for background (n indicates number of replicates). Culture medium served as negative controls.

Discussion

This present study demonstrates the continued difficulty of transfecting primary rat monocytes, however, provides evidence that lentiviral vectors and protein delivery systems may prove more effective at generating functional protein production in these cells.

Although many methods of gene transfer have been developed for effective genetic modification of mammalian cells, the engineering and maintenance of monocytic cells has proven difficult. In the present study, we were unable to observe effective transfection of primary rat monocytes using lipid-mediated transfection, electroporation or nucleofection, despite their success in transfecting primary rat astrocytes (data not shown). Primary monocytes do not proliferate and thus it is not surprising that transfection methods that rely on cell division (i.e. lipid-mediated transfection) have proven unsuccessful. Thus, recent investigations have turned to electroporation and nucleofection in order to develop more efficient nonviral DNA delivery methods for primary cells. Although advances have been made in primary human monocytes (Bhattacharjee et al., 2008), the nonviral transfection of primary animal monocytes remains difficult. In line with our findings, Herold et al. (2006) have reported that electroporation and lipid-mediated transfection were unsuccessful in transfecting primary rabbit monocytes. Although others have indicated that transfection efficiencies over 70% can be achieved in monocytes using Nucleofector technology, most of these high transfection efficiencies have been performed using immortal monocytic cell lines rather than primary cells (Martinet et al., 2003; Schnoor et al., 2009). Recently, others have demonstrated the successful transfection of mRNA into primary murine and human monocytes using mouse macrophage Nucleofector and Human Monocyte Nucleofector kits, respectively (Zimmermann et al., 2012). Although our methods (specifically the kit used) are similar to the published study, our unsuccessful attempts could illustrate the need for a cell-type specific Nucleofector kit, optimized for primary rat monocytes, in order to achieve effective transfection. It could also be possible that mRNA transfection is more potent for primary monocyte nucleofections. Despite exhaustive optimization attempts, classical transfection methods (i.e. lipid-based reagents, electroporation, and nucleofection) were unable to generate stable NGF expression in primary rat monocytes. Although nucleofection generated some NGF expression in monocytes (0.8 ± 0.2 ng/ml NGF per 24 h per 1 million cells), reproducibility was highly variable (21% successful). Even after exhaustive attempts at optimizing the transfection conditions (i.e. plasmid purity, cell purity, various incubation and culture conditions, etc.), we were unable to achieve better reproducible results. Since our interest is to later administer NGF-secreting monocytes in vivo, we concluded that this method would not serve as an attractive method for future experiments.

In this study, we demonstrated that lentiviral vectors and Bioporter were the most efficient methods for generating NGF-secreting monocytes. Others have also reported success using viral transduction methods in these cells. Herold et al. (2006) demonstrated that adenoviral infection transduced approximately 95% of primary monocytes and Mordelet et al. (2002) demonstrated the success and efficiency of lentiviral transduction for monocyte/macrophage gene delivery in rats. In this study, monocytes transduced with lentiviral vector pHR-ba-NGF or pHR-SFFV-NGF produced 15.6 ± 2.5 or 9.1 ± 2.6 ng/ml per 1 million cells, respectively. Both exhibited high reproducibility at 100% and 86%, respectively. Thus, our data is in line with others supporting the use of viral transduction for successful DNA delivery to primary monocytes.

Since the use of lentiviral vectors still remains controversial due their immunogenicity properties and we ultimately plan on using these cells for in vivo studies, we also investigated Bioporter as a nonviral approach for generating NGF-secreting monocytes. Bioporter is a protein delivery system that relies on lipid complexes to translocate proteins into target cells. Previous investigations have established that this system can effectively deliver functional recombinant proteins to a wide variety of cell types (Böttger et al., 2010). In the present study, we demonstrate that Bioporter is an efficient nonviral method to deliver NGF to primary rat monocytes, in which monocytes secrete 0.6 ± 0.2 ng/ml per 24 h per 1 million cells with a 100% rate of reproducibility, 75% viability, and 58 ± 3% efficiency as seen by immunohistochemical evaluation. Here, we show that NGF is effectively incorporated into monocytes. Following confocal microscopy, we observed that NGF staining was mostly localized in perinuclear and cytoplasmic regions. It appears that some cells are quicker at NGF uptake (perinuclear staining) compared to other cells (cytoplasmic staining). Since we did not perform further staining of lysosomes or endosomes, we cannot identify the exact location of NGF. However, these two different stainings patterns could indicate that these cells exhibit differential abilities at taking up and secreting NGF. However, further analysis is needed to determine to what extent this occurs and how it differs within each group.

Most importantly, however, these cells secrete bioactive NGF. We have previously demonstrated that the production of NGF in primary rat monocytes enhances the number of cholinergic neurons in organotypic brain slices (Fig. 4). This is important to evaluate since proNGF, the uncleaved precursor of NGF, has been implicated in neuronal cell death (Fortress et al., 2011). Our data indicate that conditioned medium from NGF-secreting cells can promote the survival of cholinergic neurons, as measured by choline acetyltransferase (ChAT)-positive neurons.

Fig. 4

The effects of conditioned medium from NGF-loaded monocytes on the survival of cholinergic neurons. Organotypic nuclus basalis of Meynert brain slices were incubated with conditioned medium from primary monocytes loaded with Bioporter alone (A) or NGF (B). An enhanced number of ChAT (choline acetyltransferase)-positive cholinergic neurons survived when incubated with medium from NGF-loaded cells. Fig. 4C shows the number of cholinergic neurons in organotypic brain slices incubated for 2 weeks without NGF (minus), with 10 ng/ml recombinant NGF (NGF 10), with conditioned medium from cells loaded with Bioporter alone (pM-(−)) or conditioned medium from cells loaded with Bioporter containing NGF (pM-NGF). Values represent mean ± SEM ChAT + neurons/slice (C). In order to calculate ng NGF/mg protein, brain slice extracts were collected and measured for NGF by NGF ELISA (ng/ml NGF) and then divided by their total protein (mg protein) determined by Bradford protein assay. Statistical analysis was performed by one-way ANOVA with LSD post hoc test (*** p < 0.001, * p < 0.05). Scale bar = 30 μm (A & B). Values were obtained and modified from Böttger et al., 2010.

In addition, we investigated the functional capabilities of these cells following Bioporter treatment. These analyses were only carried out in Bioporter-transduced monocytes and not in lentiviral-transduced cells. A recent study has published that haematopoietic stem cells transduced by lentiviral vector do not present any alterations in monocytic differentiation and function (Magga et al., 2012). However, lentiviral modification still poses potential problematic side effects, such as high viral titers and immunogenic effects that we wish to avoid in our future in vivo studies. Here, we show that Bioporter-loaded monocytes can phagocytose Aβ and appear to develop morphological changes (i.e. larger cytoplasm, appearance of processes) indicative of differentiation. Although seven days are needed for monocytes to become fully differentiated into macrophages in culture, we were only interested in their short-term functional capabilities. This is due to the fact that these cells exhibit rather short life-spans once in circulation in vivo.

This present work extends our earlier studies of the potential therapeutic use of peripheral monocytes for the delivery of NGF to the brain (Zassler and Humpel, 2006; Böttger et al., 2010). Despite extensive evidence supporting the therapeutic potency of NGF (Tuszynski et al., 2005; Nagahara et al., 2009), its use in the treatment of CNS disorders has been limited due to its inability to penetrate the blood–brain barrier (BBB) and the adverse and intolerable side effects (e.g. nociceptor activation) that appear upon broad NGF distribution (Covaceuszach et al., 2009). Previous investigations have taught us that in order to develop an effective NGF delivery system, it should adhere to the following criteria: 1) supply a sufficient quantity of NGF to effectively stimulate degenerating neurons, 2) provide continuous delivery of NGF, 3) restrict NGF distribution to lesion sites, and 4) in regards to an ever growing AD population, provide efficient, reproducible, and non-invasive application.

In order to address these concerns, we propose the use of peripheral monocytes as NGF delivery vehicles to the AD brain. We and others have shown that Aβ deposits can stimulate monocyte recruitment and infiltration into the brain (Fiala et al., 1998; Giri et al., 2000; Humpel, 2008). Furthermore, recent studies have shown that bone marrow-derived or blood-derived monocytic cells are recruited to the diseased AD brain and play an important role in the clearance of Aβ deposits and plaques (El Khoury et al., 2007; Gate et al., 2010; Lebson et al., 2010). This selective transmigration to amyloid plaques confers a gross advantage for the use of these cells as therapeutic delivery vehicles to the AD brain (Malm et al., 2010; Schwartz and Shechter, 2010). We hypothesize that following BBB insult (e.g. activation or breakdown) or stimuli from disease-associated lesion sites (i.e. Aβ plaque), monocytes can transmigrate across the BBB and enter the diseased AD brain (Fig. 5). Monocytes are then attracted to the lesion site by a chemotactic gradient (e.g. monocyte chemotactic protein-1 (MCP-1/CCL2)) where they can secrete NGF to support the survival of degenerating cholinergic neurons as well as to reduce amyloid burden by differentiating into macrophages and phagocytosing Aβ (Fig. 5).

Fig. 5

Therapeutic potential of transmigrating monocytes. We propose that peripheral monocytes carrying NGF can gain access to the Alzheimer's disease brain via blood–brain barrier (BBB) activation/disruption. Subsequently, these cells are recruited by chemokines (e.g. monocyte chemotactic protein-1 (MCP-1/CCL-2)) to disease lesion sites (i.e. Aβ plaque deposition) where they can phagocytose Aβ, secrete NGF, and ultimately help counteract neurodegeneration.

Although a number of recent studies have reported on the therapeutic potential of monocytes in AD (Lebson et al., 2010), the role of these cells in contributing to further inflammatory activity and disease aggrevation should still be considered. Their response to neurodegeneration can be beneficial, but ultimately become detrimental once dysregulated and persistent (Shechter and Schwartz, 2013). Other hurdles will include generating large populations of healthy functioning monocytes since these cells are short-lived, exhibit limited numbers in vivo, and are ineffective at Aβ phagocytosis in Alzheimer's patients (Fiala et al., 2005).

In the rat brain, physiological levels of NGF have been reported at 1.01 ng/g tissue and 0.2 ng/g tissue in the hippocampus and cortex, respectively (Whittemore et al., 1986). In mice, reducing NGF brain levels from 13–17 ng/mg in wildtype animals to 6 ng/mg in transgenic anti-NGF animals results in AD-like neurodegeneration (Capsoni et al., 2010).

The mechanisms of NGF secretion has been studied extensively in hippocampal neurons and a previous investigation has also shown that monocytes can produce, store, and release NGF (Rost et al., 2005). However, the cellular pathway involved in its release has not been fully characterized. The main mechanism of Bioporter-loaded protein secretion is through macropinoctosis, which can often lead to remaining protein left trapped in endosomal vesicles (Yamaguchi et al., 2011). Here, we show that primary monocytes loaded with NGF using Bioporter can secrete NGF in a time-dependent manner over 24 h. This is also true for endogenous cytokines indicating that protein secretion is active rather than a result of proteolytic degradation, however, further investigation is required. On the other hand, whether or not monocyte cell death does indeed occur, the more important point is that NGF is released from our cells. Other studies have reported that Aβ1–42 significantly elevates the release of inflammatory cytokines in monocytes (Fiala et al., 1998). Differences in our findings may be due to culturing variations, a longer incubation period and higher doses of Aβ. Our future studies will involve administrating Bioporter-NGF-loaded primary monocytes and observing whether these cells can deliver therapeutically relevant levels of NGF as well as help reduce β-amyloid deposition and cholinergic neurodegeneration.

Conclusion

The present study illustrates that primary rat monocytes can be efficiently loaded with NGF using lentivirus vectors or Bioporter. It further shows that NGF secreted from these cells is bioactive and that Bioporter does not disrupt monocyte functional properties. These findings provide insights into the use of peripheral monocytes as brain delivery vehicles for NGF and this approach may have implications in the future for the treatment of AD and other neurodegenerative diseases.