| Literature DB >> 23443120 |
Holly B Ernest1, Tracy L Drazenovich, Lisa S Dalbeck, Michelle G Hawkins.
Abstract
The domestic ferret (Mustela putorius furo) is an important model organism for the study of avian influenza and other diseases of humans and animals, as well as a popular pet animal. In order to evaluate genetic diversity and study disease relationships in ferrets, 22 nuclear microsatellite loci (17 dinucleotide and 5 tetranucleotide) were developed from ferret genomic libraries and organized into seven multiplex sets. Polymorphism was preliminarily assessed in one population in Australia and one in the USA, sampled with 25 individuals each. The loci displayed allelic diversity ranging from 1 to 5 alleles, and expected and observed heterozygosities ranging from 0.04 to 0.65 and 0.04 to 0.76, respectively. Additionally, the loci amplified products in 15 samples from the wild ancestor, European polecat (Mustela putorius) and domestic ferret-polecat hybrids. In polecat/hybrid samples, allelic diversity ranged from 3 to 8 alleles, and expected and observed heterozygosities ranged from 0.13 to 0.81 and 0.13 to 0.80 respectively. These markers will be useful for molecular assessments of genetic diversity and applications to evolution, ecology, and health in domestic ferrets and wild polecats.Entities:
Mesh:
Year: 2012 PMID: 23443120 PMCID: PMC3546709 DOI: 10.3390/ijms131216592
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 5.923
Characterization of the 22 microsatellite loci developed for domestic ferrets, Mustela putorius furo. All reverse primers had a PIG-tail added (gttctt) [6]. The multiplex groups (noted in table by superscripts) 1, 3, 4, 6, and 7 required Q solution contained in the QIAGEN Multiplex PCR Kit. The multiplex groups 2 and 5 did not require Q solution.
| Locus | Dye label | PCR product size (bp) | Repeat motif | Primer sequence (5′-3′) | GenBank Accession no. |
|---|---|---|---|---|---|
| Mpu | vic | 152–174 | (AC)23 | F: CACTTCCTCCCATGGACACT | JX469575 |
| Mpu | ned | 154–158 | (AC)13(AC)7 | F: TGGCCTATATGTGCAGATGAC | JX469576 |
| Mpu | pet | 164–188 | (TG)17 | F: CACTGTTAGGGGAAGGAAGA | JX469577 |
| Mpu | fam | 105–129 | (CA)14 | F: ACTGCCATCAGGTCATCTAGG | JX469578 |
| Mpu | fam | 197–205 | (CA)13 | F: GGCCTCTGAACACATAGTTG | JX469579 |
| Mpu | fam | 137–153 | (TG)13 | F: CCCTATGAGGGCATGTTTGT | JX469580 |
| Mpu | ned | 213–239 | (GT)19 | F: GAAGACAGCACCCCAGAGTC | JX469581 |
| Mpu | pet | 107–139 | (GT)11(TG)7 | F: GGGTAGGACGTGCTTAAAGATG | JX469582 |
| Mpu | vic | 182–224 | (GT)15 | F: CCTCTGGTAACCATCTGTTTG | JX469583 |
| Mpu | vic | 178–190 | (CT)15(CA)8 | F: TCCACTACCTGGCCTCATTC | JX469584 |
| Mpu | ned | 156–164 | (TC)18 | F: TGGGTGTAGAGCATGTTTGG | JX469585 |
| Mpu | vic | 180–192 | (GA)18 | F: CGTTACCAACTGTGGCTGTG | JX469586 |
| Mpu | fam | 175–179 | (AG)11(AC)8 | F: AGTCGACAGATGAGTCCACGAAG | JX469587 |
| Mpu | fam | 161–165 | (AG)14 | F: CCATTACAAGTGCTTGGAGACA | JX469588 |
| Mpu | pet | 164–168 | (CTC)5(GA)14 | F: TCTCCTCCTCCTCCTCCTTC | JX469589 |
| Mpu | vic | 119–125 | (CT)16 | F: TGCTTCTCCCTCTGACTGCT | JX469590 |
| Mpu | vic | 126–144 | (TC)5(TC)17 | F: TTCCCTGCTTGTGCTCTCTT | JX469591 |
| Mpu | ned | 147–163 | (TCCA)9 | F: CTGGCCCTATCACATACATATTCA | JX469592 |
| Mpu | fam | 119–135 | (TGGA)7 | F: GGGTGGATGGGTGAGTAGGTA | JX469593 |
| Mpu | ned | 188–214 | (CT)10 | F: CAGGTGAAGAAGTCCCTCTGT | JX469594 |
| Mpu | fam | 165–185 | (TATC)7 | F: GAACAGCAAGTAGTCCAACTCTCA | JX469595 |
| Mpu | fam | 132–160 | (GATA)9 | F: TTTGGGTTCCACAGTAGGTG | JX469596 |
Diversity calculations in samples of domestic ferret (Mustela putorius furo) from Australia and USA. A third set of samples contained European polecats (Mustela putorius, N = 6) and hybrids of Mustela putorius furo plus one of the following at 50% or more in reported pedigree: Mustela putorius (N = 4), Mustela eversmanni (N = 4), and Mustela siberica (N = 1). NA, number of alleles; HO, observed heterozygosity; and HE, expected heterozygosity.
| Locus | Australia ( | USA ( | Polecat/Hybrid ( | ||||||
|---|---|---|---|---|---|---|---|---|---|
|
|
|
| |||||||
| MpuA4w | 2 | 0.16 | 0.15 | 4 | 0.64 | 0.59 | 8 | 0.80 | 0.75 |
| MpuA10w | 2 | 0.12 | 0.12 | 2 | 0.48 | 0.50 | 3 | 0.20 | 0.19 |
| MpuA115w | 2 | 0.60 | 0.50 | 1 | 0 | 0 | 6 | 0.40 | 0.41 |
| MpuA121w | 2 | 0.60 | 0.46 | 2 | 0.36 | 0.39 | 5 | 0.47 | 0.49 |
| MpuA129w | 2 | 0.16 | 0.22 | 1 | 0 | 0 | 3 | 0.27 | 0.25 |
| MpuA212w | 1 | 0 | 0 | 2 | 0.36 | 0.30 | 3 | 0.13 | 0.13 |
| MpuA223w | 3 | 0.76 | 0.58 | 2 | 0.32 | 0.27 | 7 | 0.67 | 0.81 |
| MpuA229w | 2 | 0.44 | 0.35 | 2 | 0.08 | 0.08 | 4 | 0.47 | 0.67 |
| MpuA231w | 2 | 0.60 | 0.50 | 2 | 0.28 | 0.30 | 6 | 0.73 | 0.73 |
| MpuB1w | 1 | 0 | 0 | 3 | 0.52 | 0.58 | 6 | 0.53 | 0.78 |
| MpuB6w | 3 | 0.56 | 0.65 | 3 | 0.32 | 0.34 | 5 | 0.53 | 0.70 |
| MpuB9w | 5 | 0.40 | 0.49 | 2 | 0.12 | 0.12 | 6 | 0.60 | 0.65 |
| MpuB12w2 | 2 | 0.40 | 0.49 | 2 | 0.32 | 0.44 | 3 | 0.67 | 0.54 |
| MpuB112w2 | 2 | 0.44 | 0.35 | 3 | 0.68 | 0.64 | 3 | 0.53 | 0.69 |
| MpuB202w2 | 2 | 0.60 | 0.51 | 2 | 0.48 | 0.49 | 3 | 0.40 | 0.48 |
| MpuB209w | 3 | 0.52 | 0.58 | 3 | 0.36 | 0.36 | 4 | 0.47 | 0.61 |
| MpuB217w | 3 | 0.32 | 0.29 | 2 | 0.12 | 0.12 | 6 | 0.40 | 0.55 |
| MpuC4w2 | 2 | 0.36 | 0.39 | 2 | 0.04 | 0.04 | 4 | 0.53 | 0.53 |
| MpuC102w | 1 | 0 | 0 | 1 | 0 | 0 | 4 | 0.33 | 0.36 |
| MpuD207w | 3 | 0.32 | 0.37 | 2 | 0.48 | 0.49 | 6 | 0.33 | 0.67 |
| MpuD209w | 3 | 0.64 | 0.51 | 2 | 0.36 | 0.35 | 4 | 0.47 | 0.58 |
| MpuD231w2 | 2 | 0.20 | 0.25 | 4 | 0.40 | 0.45 | 6 | 0.80 | 0.76 |
| Mean | 2.3 | 0.37 | 0.35 | 2.2 | 0.31 | 0.31 | 4.8 | 0.49 | 0.56 |