Annika Lindqvist1, Dustin Manders, R Ann Word. 1. Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd F2,302, Dallas, TX 75390, USA. annika.lindqvist@utsouthwestern.edu
Abstract
BACKGROUND: Accurate measurements of mRNA expression levels in tissues or cells are crucially dependent on the use of relevant reference genes for normalization of data. In this study we used quantitative real-time PCR and two Excel-based applets (geNorm and BestKeeper) to determine the best reference genes for quantification of target gene mRNA in a complex tissue organ such as the guinea pig cervix. RESULTS: Gene expression studies were conducted in cervical epithelium and stroma during pregnancy and parturition and in cultures of primary cells from this tissue. Among 15 reference gene candidates examined, both geNorm and BestKeeper found CLF1 and CLTC to be the most stable in cervical stroma and cervical epithelium, ACTB and PPIB in primary stroma cells, and CLTC and PPIB in primary epithelial cells. The order of stability among the remaining candidate genes was not in such an agreement. Commonly used reference such as GAPDH and B2M demonstrated lower stability. Determination of pairwise variation values for reference gene combinations using geNorm revealed that the geometric mean of the two most stable genes provides sufficient normalization in most cases. However, for cervical stroma tissue in which many reference gene candidates displayed low stability, inclusion of three reference genes in the geometric mean may improve accuracy of target gene expression level analyses. Using the top ranked reference genes we examined the expression levels of target gene PTGS2 in cervical tissue and cultured cervical cells. We compared the results with PTGS2 expression normalized to the least stable gene and found significant differences in gene expression, up to 10-fold in some samples, emphasizing the importance of appropriately selecting reference genes. CONCLUSIONS: We recommend using the geometric mean of CFL1 and CLTC for normalization of qPCR studies in guinea pig cervical tissue studies, ACTB and PPIB in primary stroma cells and CLTC and PPIB in primary epithelial cells from guinea pig.
BACKGROUND: Accurate measurements of mRNA expression levels in tissues or cells are crucially dependent on the use of relevant reference genes for normalization of data. In this study we used quantitative real-time PCR and two Excel-based applets (geNorm and BestKeeper) to determine the best reference genes for quantification of target gene mRNA in a complex tissue organ such as the guinea pig cervix. RESULTS: Gene expression studies were conducted in cervical epithelium and stroma during pregnancy and parturition and in cultures of primary cells from this tissue. Among 15 reference gene candidates examined, both geNorm and BestKeeper found CLF1 and CLTC to be the most stable in cervical stroma and cervical epithelium, ACTB and PPIB in primary stroma cells, and CLTC and PPIB in primary epithelial cells. The order of stability among the remaining candidate genes was not in such an agreement. Commonly used reference such as GAPDH and B2M demonstrated lower stability. Determination of pairwise variation values for reference gene combinations using geNorm revealed that the geometric mean of the two most stable genes provides sufficient normalization in most cases. However, for cervical stroma tissue in which many reference gene candidates displayed low stability, inclusion of three reference genes in the geometric mean may improve accuracy of target gene expression level analyses. Using the top ranked reference genes we examined the expression levels of target gene PTGS2 in cervical tissue and cultured cervical cells. We compared the results with PTGS2 expression normalized to the least stable gene and found significant differences in gene expression, up to 10-fold in some samples, emphasizing the importance of appropriately selecting reference genes. CONCLUSIONS: We recommend using the geometric mean of CFL1 and CLTC for normalization of qPCR studies in guinea pig cervical tissue studies, ACTB and PPIB in primary stroma cells and CLTC and PPIB in primary epithelial cells from guinea pig.
Accurate measurement of relative mRNA expression levels in tissues or cells using quantitative real-time PCR (qPCR) is crucially dependent on normalization of the data. Due to overall differences in transcriptional activity between tissues and different cell types, normalization cannot be based simply on the amounts of starting material. Since all mRNA molecules in one sample are subject to the same efficiency of RNA purification, reverse transcription and polymerase amplification, quantification of a target gene in the sample is better normalized using the ratio of the target mRNA to an endogenous mRNA reference gene within the sample. It is imperative to use reference genes with minimal variability between samples that are not influenced by the study conditions. A multitude of reference genes have been utilized for this purpose, although none are universally applicable for all tissues or cell types [1,2]. Thus, for every new experimental system, it is important to identify reference genes that fulfill these criteria. In addition, the widespread use of only one reference gene for normalization of qPCR data has been shown to be inadequate at times often resulting in values that are multiple-fold wrong [3]. It has thus been suggested that using the geometric mean of two or more meticulously selected reference genes results in more accurate comparisons and quantification between study conditions.In this study, we sought to identify reference genes suitable for determination of gene expression in guinea pig cervical tissues and cells. We also examined the impact of reference gene choice on the measured changes in expression of a gene that has been shown to be expressed and regulated in cervix at term pregnancy in women [4], i.e., PTGS2, the gene for cyclooxygenase 2. This gene product increases the levels of bioactive prostaglandins which are known to be of importance in cervical ripening. The temporal relationship between cervical ripening and increase in cervical prostaglandins is not known. In mice, rats, as well as other species that depend on progesterone withdrawal prior to parturition, a combination of loss of progesterone systemically [5] and locally [6] leads to increased prostaglandin biosynthesis in progesterone-responsive target tissues. In primates and guinea pigs, however, progesterone levels do not decline systemically prior to parturition. Studies of events involved in cervical ripening in humans are complicated by difficulties in obtaining cervical tissue from second and third trimesters of pregnancy. Indeed, most studies to date have been carried out on cervical biopsies taken either in connection with early termination of pregnancy [7,8], at the time of vaginal delivery [7,9-11], or Cesarean section at term [10,12,13], usually after cervical ripening. Thus, to study this process both in vivo and in vitro, we chose to use the pregnant guinea pig as a model system to dissect changes in gene expression in hormonal settings that mimic those of humans. Despite its historical popularity in research [14], few studies have been published in which guinea pig gene expression levels have been determined using qPCR. Further, to our knowledge, none have been conducted in cervical tissues or cells.Several aspects of qPCR studies in the guinea pig cervix are worthy of consideration. First, the cervix is a complex tissue composed of several cell types. Specifically, the stromal compartment is comprised of highly specialized fibroblasts that orchestrate changes in the extracellular matrix and the biomechanical properties of the cervix [15,16], but myofibroblasts and smooth muscle cells are also present. Endocervical epithelial cells line the cervical canal and are known to alter gene expression during cervical ripening and labor [4]. Finally, a number of different immune cells infiltrate and are activated within the cervix and are believed to contribute to matrix remodeling and function of the cervix during pregnancy and parturition [17]. Hence, to quantify changes in gene expression of the cervix as an organ, reference genes must be applicable to many cell types, all of which differ in transcriptional activity.Here, we used Excel-based applets (geNorm and BestKeeper) to determine the most stable reference genes among 15 candidates for use in qPCR studies of gene expression levels in guinea pig cervical tissues and cell cultures. More specifically, cervical stroma and epithelial tissues from guinea pigs under various hormonal conditions (e.g., immature, mature nonpregnant and pregnant) were collected and analyzed. Likewise, gene expression levels were quantified in primary cervical stromal and epithelial cells in culture treated with or without estradiol and/or progesterone.
Results
Primer validation
The quality of each qPCR primer pair was initially examined using 5-fold dilution series of guinea pig liver cDNA, and acceptable primer combinations had amplification efficiencies greater than 95%, and correlation coefficients ≥ 0.996 (Table 1). Melt-curve analyses revealed a single peak and no amplification in no template controls. Further, examination of qPCR reaction products using 2% agarose-1000 gel electrophoresis revealed a single band of expected size (Figure 1), and gene-specific amplification was confirmed by sequencing the qPCR products.
Table 1
Guinea pig reference gene primer validation using liver cDNA
Gene
Slope
Amplification efficiency (%)
Correlation coefficient
ACTB
−3.4077
96.5
0.9996
ATP5B
−3.3395
99.3
0.9997
ATP6
−3.4453
95.1
0.9996
B2M
−3.2484
103.2
0.9975
CFL1
−3.2969
101.1
0.9983
CLTC
−3.3034
100.8
0.9973
CTBP1
−3.2946
101.2
0.9998
GAPDH
−3.3797
97.6
0.9997
HMBS
−3.2421
103.4
0.9962
PPIB
−3.2028
105.2
0.9981
RPLP0
−3.3246
99.9
0.9984
SDHA
−3.3581
98.5
0.9999
TBP
−3.2961
101.1
0.9979
TFRC
−3.3674
98.1
0.9993
TPT1
−3.2627
102.5
0.9980
Figure 1
Primer validation. Each qPCR reaction mix was loaded in duplicate on 2% Agarose-1000 gels. First RPLP0 primer pair tested (gel B) resulted in an amplification product of ~130 bp (should be 61 bp). New primers were designed, and the resulting qPCR reaction was found to be of the correct size, 64 bp (gel C and D).
Guinea pig reference gene primer validation using liver cDNAPrimer validation. Each qPCR reaction mix was loaded in duplicate on 2% Agarose-1000 gels. First RPLP0 primer pair tested (gel B) resulted in an amplification product of ~130 bp (should be 61 bp). New primers were designed, and the resulting qPCR reaction was found to be of the correct size, 64 bp (gel C and D).
Expression stability according to geNorm and BestKeeper
Each DNase I-treated RNA sample was analyzed twice, and each qPCR was performed in triplicate. The intra-assay coefficient of variation (CV) ranged from 0.10-0.33 for cervical tissue samples, and from 0.10-0.39 for primary cervical cells. The inter-assay CV for tissues ranged from 0.54-3.06 and from 0.60-2.56 for primary cells. Expression level of the candidate reference genes in each tissue was examined before the geNorm or BestKeeper analyses were performed. Any reference gene for which the Cq was above 30 among in a category of samples was excluded from the study. Expression of TBP was found to be too low in all tissues and cell types. HMBS expression level was too low in stromal tissues and stromal cells, and TFRC expression was also too low in stromal tissues. The remaining candidates were included in the geNorm and Best Keeper analyses to determine expression stability.Of the remaining candidate genes examined with geNorm, all exhibited expression stability (M) values of less than 1.0 (lower M value indicates a more stable gene) regardless of tissue or cell type (Tables 2 and 3). This is well below the arbitrary cut-off value of 1.5 for acceptable expression stability. Ranking of expression stability as determined by geNorm analysis in cervical guinea pig tissues is shown in Table 2. The two most stable genes were not further ranked by geNorm and are thereby listed together. CFL1 and CLTC were found to be the most stable genes in samples from both stroma and epithelium (i.e., M values of 0.4-0.9 in cervical stroma and 0.3-0.7 in cervical epithelium). BestKeeper scores the reference genes based on a repeated pairwise correlation analysis, and the more stable genes have a Pearson coefficient of correlation (R) that equals to or is close to 1 (Tables 2 and 3). According to this method, the most stable genes in tissues were identical as those identified using geNorm (Table 2). Specifically, CFL1 and CLTC exhibited correlation coefficients ranging from 0.985-0.995. Overall, most genes displayed more stable expression in cultured cells relative to cervical tissues. Stability predictions for other genes were not as concordant between geNorm and BestKeeper.
Table 2
Stability of various potential reference genes in guinea pig cervical tissues
Stroma enriched
Epithelium enriched
geNorm
BestKeeper
geNorm
BestKeeper
Most stable
CFL1/CLTC (0.42)
CLTC (0.991)
CFL1/CLTC (0.29)
CLTC (0.995)
ACTB (0.48)
ATP5B/CFL1 (0.985)
PPIB (0.34)
CFL1 (0.991)
ATP5B (0.51)
B2M (0.983)
SDHA (0.38)
SDHA (0.983)
GAPDH (0.54)
ACTB (0.978)
GAPDH (0.41)
TPT1 (0.979)
PPIB (0.57)
TPT1 (0.977)
ATP5B (0.44)
B2M (0.970)
SDHA (0.62)
SDHA (0.975)
ACTB (0.47)
TFRC (0.966)
ATP6 (0.70)
RPLP0 (0.967)
HMBS (0.51)
PPIB (0.965)
RPLP0 (0.75)
ATP6 (0.955)
TFRC (0.55)
ACTB (0.958)
B2M (0.78)
CTBP1 (0.954)
ATP6 (0.57)
ATP5B (0.954)
TPT1 (0.83)
GAPDH (0.952)
B2M (0.61)
HMBS (0.950)
CTBP1 (0.89)
PPIB (0.937)
RPLP0 (0.65)
ATP6 (0.920)
CTBP1 (0.68)
GAPDH (0.92)
TPT1 (0.72)
CTBP1 (0.895)
Least stable
RPLP0 (0.892)
Excluded
HMBS
TBP
TBP
TFRC
Genes listed with the most stable as determined by geNorm or BestKeeper on top. Genes excluded due to low expression levels in the respective tissue are listed at the bottom. The numbers in brackets represent geNorm M values and BestKeeper R values, respectively.
Table 3
Stability of reference gene candidates in guinea pig cervical primary cell cultures
Stromal cells
Epithelial cells
geNorm
BestKeeper
geNorm
BestKeeper
Most stable
ACTB/PPIB (0.09)
PPIB (0.999)
CLTC/PPIB (0.10)
CLTC (0.983)
SDHA (0.12)
ACTB (0.996)
ATP5B (0.11)
PPIB (0.981)
B2M (0.15)
SDHA (0.995)
CTBP1 (0.12)
ATP5B (0.975)
CLTC (0.18)
B2M (0.984)
B2M (0.12)
CFL1 (0.957)
RPLP0 (0.20)
CLTC (0.977)
SDHA (0.13)
CTBP1 (0.946)
CTBP1 (0.21)
GAPDH (0.974)
HMBS (0.14)
ATP6 (0.945
GAPDH (0.23)
RPLP0 (0.969)
RPLP0 (0.15)
TFRC (0.936)
CFL1 (0.24)
CFL1 (0.958)
ATP6 (0.16)
B2M (0.932)
TPT1 (0.25)
CTBP1 (0.957)
TPT1 (0.18)
ACTB (0.932)
TFRC (0.28)
TFRC (0.928)
GAPDH (0.20)
GAPDH (0.922)
ATP5B (0.30)
TPT1 (0.919)
CFL1 (0.22)
SDHA (0.867)
ATP6 (0.33)
ATP5B (0.908)
ACTB (0.24)
HMBS (0.842)
ATP6 (0.857)
TFRC (0.26)
RPLP0 (0.838)
Least stable
TPT1 (0.602)
Excluded
HMBS
TBP
TBP
Genes listed with the most stable as determined by geNorm or BestKeeper on top. Genes excluded due to low expression levels in the respective tissue are listed at the bottom. The numbers in brackets represent geNorm M values and BestKeeper R values, respectively.
Stability of various potential reference genes in guinea pig cervical tissuesGenes listed with the most stable as determined by geNorm or BestKeeper on top. Genes excluded due to low expression levels in the respective tissue are listed at the bottom. The numbers in brackets represent geNorm M values and BestKeeper R values, respectively.Stability of reference gene candidates in guinea pig cervical primary cell culturesGenes listed with the most stable as determined by geNorm or BestKeeper on top. Genes excluded due to low expression levels in the respective tissue are listed at the bottom. The numbers in brackets represent geNorm M values and BestKeeper R values, respectively.M values (determined with geNorm) were lower in cultured primary cells relative to tissue samples, ranging from 0.1-0.35 in stroma cells and 0.1-0.25 in epithelial cells, suggesting that all tested gene candidates are expressed at rather stable levels in cultured cells. ACTB and PPIB were ranked as the two most stable genes in primary stroma cells whereas CLTC and PPIB were found to be the most stable in primary epithelial cells (Table 3). BestKeeper analysis also revealed the same two genes as top ranked (Table 3), with R values ranging from 0.981-0.999.
Pairwise variation to determine optimal number of reference genes
After identification of the most stable genes, the optimal number of reference genes for accurate normalization was determined. Pairwise variation values (V) were determined for each cell type and tissue using geNorm where lower V values correspond to high correlation coefficients. We considered the arbitrary cut-off value for acceptable pairwise variation as 0.15. Using only the two top rated reference genes exhibited values of less than 0.04 in both stroma and epithelial cell. The analysis revealed no substantial benefit of adding more reference genes to the normalization process in these cell types. Specifically, V values were modestly decreased if more reference genes are included (Figure 2A, B). In cervical tissues M values were in general higher and covered a broader range of V values compared with cells in culture (Figure 2C, D). For cervical epithelial tissue (Figure 2D), V values indicated that using two reference genes for normalization still is sufficient whereas three reference genes may be required to achieve good normalization in cervical stroma tissue (Figure 2C).
Figure 2
Pairwise variation of reference gene candidates in cervical cells and tissues as determined by geNorm. The first bar (2/3) represents the pairwise variation (V) in a 2 vs. 3 reference genes comparison. The second bar (3/4) represents pairwise variations in a 3 vs. 4 reference gene comparison. Variation values were determined using from 2/3 up to 13/14 reference gene comparisons in cultured stromal cells (A), cultured epithelial cells (B), stromal tissues (C), and epithelial tissues (D). Pairwise variation values of ≤0.15 were considered sufficient for normalization, values above 0.15 are considered too variable. Note increased V values in tissues compared with cells in culture.
Pairwise variation of reference gene candidates in cervical cells and tissues as determined by geNorm. The first bar (2/3) represents the pairwise variation (V) in a 2 vs. 3 reference genes comparison. The second bar (3/4) represents pairwise variations in a 3 vs. 4 reference gene comparison. Variation values were determined using from 2/3 up to 13/14 reference gene comparisons in cultured stromal cells (A), cultured epithelial cells (B), stromal tissues (C), and epithelial tissues (D). Pairwise variation values of ≤0.15 were considered sufficient for normalization, values above 0.15 are considered too variable. Note increased V values in tissues compared with cells in culture.
Target gene expression levels vary according to choice of reference gene set
To determine the effect of different reference gene sets on target gene expression levels, we compared the relative expression of PTGS2 in cervix-derived tissues and cell samples using different combinations of reference genes. For each sample, qPCR results were normalized to the geometric mean of the top three most stable genes, the top two most stable genes and to the least stable gene (Figures 3, 4). The PTGS2 expression did not vary significantly in primary cervical epithelial cells regardless of if the top three or only top two reference gene set used. In the comparison between the least stable and the top scoring genes only in one treatment group was there a significant difference in PTGS2 gene expression (Figure 3A). In primary cervical stroma cells there was no significant difference in PTGS2 expression when using the top two or three most stable reference genes. However, comparison of any of the most stable gene combinations with the least stable resulted in significant PTGS2 expression differences (Figure 3B). In cervical tissue samples the effect of using different reference gene sets were more pronounced on PTGS2 gene expression results, with up to 10-fold difference seen in both some stroma and epithelial samples (not shown). Figure 4 exemplifies the variation in measured PTGS2 gene expression in five individuals, representing both pregnant and nonpregnant guinea pigs. The difference in PTGS2 gene expression is significant in almost every sample when compared with the least stable gene, despite the limited sample size. Additionally, the expression level is alternating between higher and lower depending on reference gene set used. Of the examples in Figure 4A if normalized to the least stable gene PTGS2 expression was greatest in sample GP29, whereas if normalized to expression of PTGS2 expression was greatest in GP18. Interestingly, levels of the target gene normalized to three recommended reference genes (ACTB/CFL1/CLTC) did not differ appreciably from those normalized to the top two in most stroma samples (Figure 4B).
Figure 3
Effect of normalization options on gene expression in cultured cervical cells. PTGS2 expression was normalized to either the least stable (white), the top two most stable (gray) or the top three most stable (black) reference genes for each cell type as established with geNorm. Relative levels of PTGS2 mRNA were determined in (A) cervical epithelial cells and (B) cervical stromal cells treated with vehicle (C), estradiol (E, 10 nM), progesterone (P, 100 nM), or E+P. Error bars indicate 95% confidence interval; *, p<0.05; **, p<0.01; n=18.
Figure 4
Effect of normalization options on gene expression in cervical tissues. Example of target gene expression levels in (A) cervical epithelial tissues and (B) cervical stromal tissues of the target gene when normalized to either the least stable (white), the top two most stable (gray) or the top three most stable (black) reference genes for each tissue type as determined with geNorm. Tissue samples from five guinea pigs representing various hormonal statuses; not pregnant (NP), mid pregnancy (MidP), late pregnancy not ripe (LP-NR), late pregnancy ripe (LP-R), and postpartum (PP). Error bars indicate 95% confidence interval; *, p<0.05; **, p<0.01; n=6.
Effect of normalization options on gene expression in cultured cervical cells. PTGS2 expression was normalized to either the least stable (white), the top two most stable (gray) or the top three most stable (black) reference genes for each cell type as established with geNorm. Relative levels of PTGS2 mRNA were determined in (A) cervical epithelial cells and (B) cervical stromal cells treated with vehicle (C), estradiol (E, 10 nM), progesterone (P, 100 nM), or E+P. Error bars indicate 95% confidence interval; *, p<0.05; **, p<0.01; n=18.Effect of normalization options on gene expression in cervical tissues. Example of target gene expression levels in (A) cervical epithelial tissues and (B) cervical stromal tissues of the target gene when normalized to either the least stable (white), the top two most stable (gray) or the top three most stable (black) reference genes for each tissue type as determined with geNorm. Tissue samples from five guinea pigs representing various hormonal statuses; not pregnant (NP), mid pregnancy (MidP), late pregnancy not ripe (LP-NR), late pregnancy ripe (LP-R), and postpartum (PP). Error bars indicate 95% confidence interval; *, p<0.05; **, p<0.01; n=6.
Discussion
Gene expression studies in tissue or cell samples depend on usage of appropriate reference genes. Many published qPCR studies normalize target gene expression with the same reference genes that were used for normalization of data obtained with Northern blotting (e.g. GAPDH, 18S, ACTB and HPRT). These genes have since been found to be regulated in certain situations, for example under the influence of steroid hormones [18-20]. In hormone-responsive tissues, such as the uterine cervix, expression levels of reference genes needs to be unaffected by hormonal change associated with the menstrual/estrous cycle or pregnancy, the effect of the presence of an embryo physical impact on the organ (pressure, stretching,) or growth hormones and prostaglandins released by the growing fetus or placenta. Different methods to find the most stable reference genes have been developed such as geNorm [3], BestKeeper [21], NormFinder [22], Principal Component Analysis [23], and methods based on restricted maximum likelihood with support of descriptive statistics [24]. Kayis et al. [24] compared the ability of these different methods to rank reference gene stability in equine endometrium and found that, with the exception of NormFinder, all methods identified the same genes as the most stable. They also found that all methods gave similar results for the least stable genes in the same tissue. Here we chose to use geNorm and BestKeeper to identify the most stable reference genes of fifteen candidates in tissue and cell samples from the guinea pig cervix.Although guinea pigs have been used historically and extensively for animal models in the laboratory, the guinea pig genome has not been completely sequenced. When deciding which reference gene candidates to include in this study, we chose to use only genes for which the guinea pig genomic/cDNA sequence was known and we only included mRNA reference genes. We based our exclusion of the commonly used 18S gene not only on the fact that it represents a different class of RNA but it is also present at a very high abundance in samples which makes dilution of the samples necessary conferring less precision and accuracy. Some reference genes included in the study (e.g. RPLP0) have been shown to be unregulated by estrogen in humanbreast cancer cells [25,26]. Similarly, ACTB mRNA was reported to be unregulated in human endometrium during the course of the menstrual cycle [27]. Thus, these two genes were of great interest as potential candidates for normalization of qPCR data in the guinea pig cervix. Our results indicate that ACTB is indeed a stable gene in guinea pig cervix, but only in stromal tissues and in cultured primary stroma cells. In epithelial tissues and cultured epithelia cells, ACTB ranked among the least stable. In addition, RPLP0 did not rank among the most stable in any of the samples, a finding that exemplifies the importance of evaluating reference for each new sample set and for each experimental set up.It should be emphasized that cell populations and tissues used in this study are not pure. The collection technique allows us to dissect stroma- and epithelium-enriched tissue. No doubt, each tissue type may be contaminated by epithelial or stromal cells, respectively. Further, the extent of this contamination may vary according to pregnancy or hormonal state. The higher M values in tissue samples relative to those in cultured cervical cells are most likely due to heterogeneous cellular composition of tissues. Nonetheless, results from this study support the notion that even under these very variable conditions it is possible to identify reference genes that are expressed in a stable manner.
Conclusions
In summary, we used two different methods, geNorm and BestKeeper, to identify the most stable reference genes in guinea pig cervix among fifteen candidates. Both methods identified CFL1/CLTC as the most stable in cervical tissues, ACTB/PPIB for cultured stroma cells, and CLTC/PPIB for cultured epithelia cells. The minimum number of reference genes to be included in the geometric mean for normalization of qPCR data was found to be two in cervical epithelial tissue and cells, and in cultured stroma cells. In cervical stroma tissue, where the tested reference genes display a higher degree of instability, the mean of three, ACTB/CFL1/CLTC, improves the normalization according to geNorm. In our limited sample numbers there was no statistical difference demonstrated between two and three reference genes. Nevertheless, the importance of stable reference genes in quantification of mRNA levels in complex tissues cannot be overstated.
Methods
Guinea pig tissue collection
Hartley guinea pigs (Elm Hill Labs, Chelmsford, MA) were kept individually in the Animal Care Facility at UT Southwestern, housed at 21°C with 30-70% humidity under a 12 h light cycle, and fed Teklad Global Guinea Pig Diet 2040 pellets, water, and hay ad libitum. All animal procedures were approved by the UT Southwestern Institutional Animal Care and Use Committee. Twenty four female guinea pigs representing sexually immature (n=1), sexually mature non-pregnant (n=4), pregnant (n=15) and postpartum period (n=4) were sacrificed using i.p. Euthasol Euthanasia Solution (390 mg pentobarbital sodium and 50 mg phenytoin sodium/ml) injections according to IACUC approved protocol. The reproductive tract was immediately removed and the cervix excised and further micro dissected into cervical epithelium and stroma. Epithelium was obtained by scraping the lining of the endocervical canal with a scalpel whereas the remaining underlying connective tissue was considered stroma. Cervical and vaginal epithelium covering the external os were discarded. All tissues were snap frozen in liquid nitrogen and stored at −80°C.
RNA isolation
Cervical tissues (5–50 mg) were thawed and homogenized in RNA STAT-60 (TelTest Inc., Friendswood, TX) using a tissue tearor (Biospec Products, Inc., Bartlesville, OK). Thereafter, total RNA was extracted according to the manufacturer’s protocol, using chloroform (C2432, Sigma, St. Louis, MO), isopropanol (I9516, Sigma, St. Louis, MO), and ethyl alcohol (E190, Pharmaco-Aaper, Brookfield, CT). Each RNA sample (~10 μg) was treated for 30 min @ 37°C with 2 U DNase I in 50 μl reactions (DNA-free, part no. AM1906, Ambion) for removal of contaminating genomic DNA, and subsequently stored at −80°C. Total RNA was isolated from cells in culture using an RNAqueous®-4PCR kit (cat. No. AM1914, Ambion, Austin, TX), and subsequently stored at −80°C.
Guinea pig cervical primary cell culture
Cervical tissues were obtained from a mature nonpregnant guinea pig. After mincing in 2–4 mm pieces, fresh tissues were incubated for 1 h at 37°C in solution containing collagenase B (1 mg/ml) (cat no. 11088823103, Roche, Indianapolis, IN) and DNase I (0.1 mg/ml) (cat no. 10104159001, Roche, Indianapolis, IN). The mixture was then strained through a 70 μm mesh (cat no. 352350, BD Biosciences, Bedford, MA) to achieve separation between stromal (flow through) and epithelial (retained) cells. The respective cells were collected, dispersed in DMEM without phenol red (cat no. 11054, Invitrogen, Carlsbad, CA) buffered with 10 mM HEPES (cat no. 15630, Invitrogen, Carlsbad, CA), and supplemented with 2 mM L-Glutamine (cat no. 25030, Invitrogen, Carlsbad, CA), 10% by volume fetal bovine serum (FBS) (cat no. S11150, Atlanta Biologicals, Lawrenceville, GA) and penicillin G (10 U/ml)-streptomycin sulfate (10 μg/ml)-amphotericin B (25 ng/ml) mix (cat no. 9350, Irvine Scientific, Santa Ana, CA). Cells were plated at 5 × 105 cells/cm2 and culture medium was changed every other day until near confluency (2–4 day). Preconfluent cells in passages 1–3 were used for experiments. Cells were serum-deprived for 3 day before treatment with 17β-estradiol (10 nM), progesterone (1 μM), a combination of 17β-estradiol and progesterone, or vehicle (ethanol) for 24 h.
cDNA synthesis
Nucleic acid quantification and purity assessment were conducted spectrophotometrically using a SmartSpec™3000 (Bio-Rad, Hercules, CA), with expected 260/280 ratios above 1.8. A High Capacity cDNA Reverse Transcription Kit (part no. 4368813, Applied Biosystem, Carlsbad, CA) based on random primer priming with MultiScribe™ Reverse Transcriptase was used for cDNA synthesis from 2 μg total RNA in 20 μl reaction volumes, with the following reaction conditions; 25°C for 10 min, 37°C for 2 hrs, 85°C for 5 min, and 4°C for 1 min. The final product was diluted to correspond to 20 ng initial RNA input/μl, and was stored at −20°C.
Selection of reference and target genes, and primer design
Potential reference genes were chosen among those used in various human tissues or cell types [3,23,28,29] for which the corresponding guinea pig nucleotide sequence was available. When possible, primer pairs were designed to span an intron. Two primer sets have been used previously as guinea pig reference genes in qPCR assays, GAPDH[30] and ACTB[31]. For target gene we chose cyclooxygenase-2, PTGS2, an enzyme involved in prostaglandin synthesis that has been shown to be expressed in human cervix [4]. Primer sequences are shown in Table 4. All primers were synthesized commercially (Integrated DNA Technology, Coralville, IA).
Table 4
Guinea pig reference and target gene information
Gene symbol
Name
Primer sequences 5’ to 3’
Exons
Amplicon size (bp)
Function
Ensembl or GenBank accession no.
Sense and antisense
ACTB
β-Actin
tgcgttacaccctttcttgaca
5
73
Cytoskeletal protein
From ref. [31]
acaaagccatgccaatctcat
ATP5B
ATP synthase, F1 complex β subunit
gatcaatttaaaagatgctacctcgaa
5 and 6
68
ATP synthesis
DQ403103
caccaggcggttcattcatt
ATP6
Adenosine triphosphatase 6
cccactatgagcagcaactgtaa
1
67
ATP metabolism
NC_000884
gaagtgggctagggatgcttt
B2M
β2-Microglobulin
tggtgcatgctgcctttaca
2
64
Cell surface molecule component
NM_001172856
gtgatgtgtgaaactctgcaagaa
CFL1
Cofilin 1
ttccaaggatgccatcaaaaa
3 and 4
65
Actin modification
ENSCPOT00000008138
cgtagcaatttgcctgtaattcg
CLTC
Clathrin
caattcgttttcaggagcatctc
1 and 2
64
Coated vesicle formation protein
ENSCPOT00000005567
aagccaatgtttgctgggtta
CTBP1
C-terminal binding protein 1
tctcatcaacgacttcactgtcaa
4 and 5
61
Transcriptional repressor phosphoprotein
ENSCPOT00000019529
ggccgtgttcaccaggaa
GAPDH
Glyceraldehyde-3-phosphate dehydrogenase
tcagagggctccctcaaag
2
70
Glycolytic enzyme
From ref. [30]
cgctgttgaagtcacaggac
HMBS
Hydroxymethyl-bilane synthase
cctgggttggcagaacaga
9 and 10
66
Heme biosynthesis
ENSCPOT00000006534
tggcccacagcatacatacag
PPIB
Cyclophilin B
gggcctaaagtcaccgtcaa
1 and 2
63
Protein folding catalyst
ENSCPOT00000000258
ccggcccacatcttcatct
RPLP0
Ribosomal protein, large, P0
atgctgctggccaataaggt
3 and 4
64
Protein synthesis
ENSCPOT00000019555
tgacttcacatggtgcaatgg
SDHA
Succinate dehydrogenase, subunit A
gatgccatccattacatgacaga
4 and 5
67
Citric acid cycle enzyme
DQ402978
gcatgccataattttctagctcaa
TBP
TATA-binding protein
acttgacctaaagacaattgcacttc
5 and 6
65
Transcription factor
ENSCPOT00000001200
cagcaaaccgcttgggatta
TFRC
Transferrin receptor
gaccttccagtcttcggtcatg
8 and 9
68
Iron transport
S81327
aaagaagggaacccaggtgtataa
TPT1
Tumor protein, translationally controlled 1
ccttgctaatttcaaaaactatcagttc
4 and 5
67
EU330893
agcaaccatgccatctggat
PTGS2
Cyclooxygenase-2
ctgcgcaatgcaatcatga
3 and 4
67
Prostaglandin synthesis
Y07896
agttggtggactgtcgatcaga
Guinea pig reference and target gene information
Quantitative real-time PCR (qPCR)
All qPCR was performed using 50% of iTaq SYBR green SUPERMIX with ROX (cat. no. 172–5851, Bio-Rad, Hercules, CA), 900 nM of each primer and 30 ng cDNA (assuming a 1:1 reversed transcription reaction efficiency) in 19 μl reactions in MicroAmp® Optical 384-Well Reaction Plates (part no. 4309849, Applied Biosystems, Carlsbad, CA) on a 7900HT Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA). The cycling program was: stage A 50°C for 2 min; stage B (denaturation) 95°C for 10 min; stage C (cycling) 95°C for 15 sec and then 60°C for 1 min repeated 40 times, and stage D (dissociation) 95°C for 15 sec then 60°C for 15 sec and a final 95°C for 15 sec. All samples were run in triplicate and each primer pair was validated using a 7 point 5-fold dilution series of guinea pig liver cDNA (50–0.0032 ng per reaction) and no template controls.
Analyses of qPCR results using geNorm and BestKeeper
Each RNA sample was analyzed twice from the reversed transcriptase step and on, and the threshold cycle (Cq) value for each sample was determined for all primer pairs. The mean Cq of triplicates for each sample run was then used for input in geNorm v3.5 and BestKeeper v1 applets, and the respective stability values were automatically calculated as described [3,21].
All authors declare that they have no competing interest.
Authors’ contributions
AL conceived the study and participated in its design, participated in tissue retrieval and cell culture, performed all qPCRs, and drafted the manuscript. DM participated in cell culture and performed the computer and statistical analyses. RAW participated in the design of the study, participated in tissue retrieval, and helped draft the manuscript. All authors read and approved the final manuscript.
Authors: Jo Vandesompele; Katleen De Preter; Filip Pattyn; Bruce Poppe; Nadine Van Roy; Anne De Paepe; Frank Speleman Journal: Genome Biol Date: 2002-06-18 Impact factor: 13.583
Authors: Christina S Fjeldbo; Eva-Katrine Aarnes; Eirik Malinen; Gunnar B Kristensen; Heidi Lyng Journal: PLoS One Date: 2016-05-31 Impact factor: 3.240
Authors: Dustin B Manders; Hari Annavarapu Kishore; Adi F Gazdar; Patrick W Keller; Jun Tsunezumi; Hiromi Yanagisawa; Jayanthi Lea; Ruth Ann Word Journal: Oncotarget Date: 2018-02-14