BACKGROUND: Malaria is a significant public health concern in Haiti where approximately 30,000 cases are reported annually with CDC estimates as high as 200,000. Malaria infections in Haiti are caused almost exclusively by Plasmodium falciparum, while a small number of Plasmodium malariae and an even smaller number of putative Plasmodium vivax infections have been reported. The lack of confirmed P. vivax infections in Haiti could be due to the genetic background of native Haitians. Having descended from West African populations, many Haitians could be Duffy negative due to a single nucleotide polymorphism from thymine to cytosine in the GATA box of the promoter region of the Duffy antigen receptor for chemokines (DARC) gene. This mutation, encoded by the FYES allele, eliminates the expression of the Duffy antigen on erythrocytes, which reduces invasion by P. vivax. This study investigated the frequency of the FYES allele and P. vivax infections in malaria patients with the goal of uncovering factors for the lack of P. vivax infections reported in Haiti. METHODS: DNA was extracted from dried blood spots collected from malaria patients at four clinic locations in Haiti. The samples were analysed by polymerase chain reaction (PCR) for the presence of the P. vivax small subunit ribosomal RNA gene. PCR, sequencing, and restriction enzyme digestion were used to detect the presence of the FYES allele. Matched samples were examined for both presence of P. vivax and the FYES allele. RESULTS: No cases of P. vivax were detected in any of the samples (0/136). Of all samples tested for the FYES allele, 99.4% had the FYES allele (163/164). Of the matched samples, 99% had the FYES allele (98/99). CONCLUSIONS: In this preliminary study, no cases of P. vivax were confirmed by PCR and 99% of the malaria patients tested carried the FYES allele. The high frequency of the FYES allele that silences erythroid expression of the Duffy antigen offers a biologically plausible explanation for the lack of P. vivax infections observed. These results provide insights on the host susceptibility for P. vivax infections that has never before been investigated in Haiti.
BACKGROUND:Malaria is a significant public health concern in Haiti where approximately 30,000 cases are reported annually with CDC estimates as high as 200,000. Malaria infections in Haiti are caused almost exclusively by Plasmodium falciparum, while a small number of Plasmodium malariae and an even smaller number of putative Plasmodium vivaxinfections have been reported. The lack of confirmed P. vivaxinfections in Haiti could be due to the genetic background of native Haitians. Having descended from West African populations, many Haitians could be Duffy negative due to a single nucleotide polymorphism from thymine to cytosine in the GATA box of the promoter region of the Duffy antigen receptor for chemokines (DARC) gene. This mutation, encoded by the FYES allele, eliminates the expression of the Duffy antigen on erythrocytes, which reduces invasion by P. vivax. This study investigated the frequency of the FYES allele and P. vivaxinfections in malariapatients with the goal of uncovering factors for the lack of P. vivaxinfections reported in Haiti. METHODS: DNA was extracted from dried blood spots collected from malariapatients at four clinic locations in Haiti. The samples were analysed by polymerase chain reaction (PCR) for the presence of the P. vivax small subunit ribosomal RNA gene. PCR, sequencing, and restriction enzyme digestion were used to detect the presence of the FYES allele. Matched samples were examined for both presence of P. vivax and the FYES allele. RESULTS: No cases of P. vivax were detected in any of the samples (0/136). Of all samples tested for the FYES allele, 99.4% had the FYES allele (163/164). Of the matched samples, 99% had the FYES allele (98/99). CONCLUSIONS: In this preliminary study, no cases of P. vivax were confirmed by PCR and 99% of the malariapatients tested carried the FYES allele. The high frequency of the FYES allele that silences erythroid expression of the Duffy antigen offers a biologically plausible explanation for the lack of P. vivaxinfections observed. These results provide insights on the host susceptibility for P. vivaxinfections that has never before been investigated in Haiti.
Malaria transmission in Haiti is a serious public health concern where approximately 30,000 cases are reported each year with Centers for Disease Control and Prevention (CDC) estimates as high as 200,000 [1]. Over 99% of malaria infections in Haiti are caused by Plasmodium falciparum, with less than 1% of cases reported as Plasmodium malariae infections [2-4]. There are even fewer reports of Plasmodium vivax in Haiti, all of which were only detected by microscopy and none confirmed by polymerase chain reaction (PCR) based methodologies [2,5,6]. Since P. vivax is responsible for 74% of all cases of malaria in Central and South America and up to 94% of cases in Mexico and Central America, the lack of P. vivaxinfections in Haiti merits further investigation [1,5,7]. Besides geographical isolation, host genetic factors could be another reason for the lack of P. vivaxinfections in Haiti. A majority of Haitians are descendants of West African populations, who have a high frequency of individuals that do not express the Duffy antigen receptor for chemokines (DARC) on their erythrocytes [8,9]. The absence of the Duffy antigen on erythrocytes has been shown to reduce or completely prevent P. vivaxinfections [10-14].The Duffy antigen is a trans-membrane glycoprotein located on red blood cells that contains a N-terminal domain used by P. vivax merozoites to invade and infect erythrocytes [15,16]. There are two co-dominant alleles FY and FY that differ by a single nucleotide at amino acid codon 42, where a change from glycine to aspartic acid results in the expression of the Fya or Fyb antigen, respectively [17]. In many African and African-descendent populations the expression of the Duffy antigen is silenced as a result of a single nucleotide polymorphism (SNP) in the GATA box sequence in the DARC gene promoter region in which a cytosine (C) replaces thymine (T) 46 nucleotides before the erythroid cap site [18-20]. This erythroid silent (ES) genotype, encoded by the FY allele, is responsible for the Duffy negative phenotype expressed by homozygotes that can reach a population frequency of 100% in native West Africans [9,21].Neither the reason why P. vivax has been so rarely observed in Haitians, nor the prevalence of the erythroid silent Duffy antigen genotype has been investigated in detail. Therefore, this study investigated the frequency of the FY allele and P. vivaxinfections in malariapatients. The information obtained from this study will help clarify the status of P. vivaxinfections in Haiti.
Map of Haiti with clinical origin of dried blood spots.
Map of Haiti with clinical origin of dried blood spots.
DNA extraction
A methanol extraction procedure was used to extract the DNA from the DBS [22]. Three millimetre discs were punched from the DBS, placed inside a PCR tube, and 100 μl of absolute methanol was added. The samples were incubated at 25 degrees Celsius (°C) for 15 minutes, the methanol was removed, and the samples were allowed to dry overnight. Once dry, 65 μl of nuclease free water was added and heated to 95°C for 30 minutes. The samples were centrifuged and then stored at 4°C for immediate use or stored at – 20°C for future use.
Detection of P. vivax by polymerase chain reaction
A species-specific PCR protocol was used to detect the presence of P. vivax in the samples. PCR primers were targeted to detect the P. vivax small subunit ribosomal RNA gene and were able to detect low levels of parasites [23]. The forward primer and reverse primer sequences used were 5′ GCAACGCTTCTAGCTTAATC 3′ and 5′ACAAGGACTTCCAAGCCGAAGC 3′, respectively. The PCR temperature protocol was as follows: 94°C for 5 minutes; 94°C for 30 seconds, 58°C for 30 seconds, and 72°C for 60 seconds for 40 cycles; and 72°C for 10 minutes. The expected size of the amplicon was 131 base pairs (bps). All PCR runs included a P. vivax positive control obtained from the malaria reagents and resources center (MR4).
PCR and sequencing of the DARC Gene
A PCR protocol was used to amplify a segment of the DARC gene that was 329 bps and included the –46 T/C SNP [14]. The forward primer and reverse primer sequences used were 5′CAGGAAGACCCAAGGCCAG 3′ and 5′CCATGGCACCGTTTGGTTCAGG 3′ respectively. The PCR temperature protocol was as follows: 94°C for 5 min; 94°C for 20 seconds, 62°C for 15 seconds, and 72°C for 20 seconds for 35 cycles; and 72°C for 10 minutes.Ten of the samples from the malariapatients along with a blood sample from one of the authors of European ancestry were sequenced for the GATA box mutation with the forward and reverse primers described above to identify –46 T and –46C controls for use in the restriction enzyme digestion of patient samples. DNA was sequenced by the Interdisciplinary Center for Biotechnology Research at the University of Florida using Sanger sequencing. Sequence analysis was accomplished by the examination of the chromatograms with 4Peaks (Mekentosj, Amsterdam, NL) software followed by alignments using Clustal X2 [24].
Restriction fragment length polymorphism of DARC
Restriction fragment length polymorphism (RFLP) analysis was used to confirm the presence or absence of the −46 T/C SNP [14]. The PCR products were digested overnight with the restriction endonuclease Sty I (New England Biolabs, Ipswich, MA) according to the manufacturer’s specifications. After heat inactivation of the enzyme for 10 minutes at 65°C, the fragments were stained with ethidium bromide and resolved by gel electrophoresis on a 4% agarose gel for 2.5 hours at 140 volts.
Results
The results from the GATA box mutation analysis and the detection of P. vivax from the DBS are shown below (Table 1). No cases of P. vivax were detected by PCR in 136 patient samples tested from the Blanchard clinic. Of the samples tested for the FY allele from the same clinic, 99.4% (163/164) had the FY allele. Of the matched samples (n =99) tested for both the presence of P. vivax and the FY allele, no P. vivaxinfections were found and 99% (98/99) had the FY allele. The remaining samples from the other sites were not tested (NT) for P. vivax, however 100% (20/20) were positive for the FY allele.
Table 1
Prevalence of GATA box mutations and Infections
Site of sample
(FYES) allele presence
P. vivax presence
Collection
No. tested
No. positive
% Positive
No. tested
No. positive
Blanchard Clinic
164
163
99.4
136
0
Hinche
7
7
100
0
NT*
Cap-Haitien
7
7
100
0
NT*
Jacmel
6
6
100
0
NT*
Total
184
99.5%
99.5%
136
0
*NT represents samples not tested for the presence of P. vivax.
Prevalence of GATA box mutations and Infections*NT represents samples not tested for the presence of P. vivax.
Discussion
This preliminary study is the first in Haiti to focus on the prevalence of the FY allele and P. vivaxinfections in malariapatients. No P. vivaxinfections were found and 99% of the malariapatients had the FY allele. The frequency of the FY allele observed in this study could explain the different rates of P. vivax Haiti as compared to Central and South America, where the majority of infections are P. vivax and the population frequency of the FY allele is rare [17,25]. The results from this study are similar to other studies conducted in West African populations, who have between 95-100% prevalence of the FY allele and almost complete absence of P. vivax infections. In a related study in Gambia (n = 1,176) where the population had complete penetrance of the Duffy negative phenotype, of the samples positive for the presence of malaria parasites, 94.8% contained P. falciparum, 3.7% contained P. malariae, 1.5% contained Plasmodium ovale, and 0% contained P. vivax[21]. In another study from nine countries in West and Central Africa (n = 2,588) where the Duffy negative genotype is estimated to be above 95%, PCR analysis of blood samples indicated that of samples positive for malaria parasites, only a single case of P. vivax was found while 98.5% contained P. falciparum, 8.5% contained P. malariae, and 3.9% contained P. ovale[9].The high frequency of the FY allele found in this study could be attributed to the West African ancestry of Haitians. Historical records dating back to the 1780s indicate that a large proportion of West Africans brought to the New World during the trans-Atlantic slave trade arrived in Haiti [8]. It is estimated that over 75% of the total number of enslaved Africans in Haiti came from West and West Central Africa, which have almost exclusively the FY/FY genotype [8,9]. This study found only a single patient without the FY allele that may be due to the small proportion of Haitians having French and/or Spanish ancestry or a foreign aid worker, who have much lower population frequencies of the FY allele [18]. Though the French and the Spanish originally colonized Haiti, in 1804 the French departed and the remaining Spanish sequestered themselves eastward to the Dominican Republic. This massive gene flow from West Africa followed by the establishment of Haiti as an independent country could have contributed to high population frequency of Duffy negative individuals [8].Although the sample size was relatively small, no P. vivax DNA was found in any of the patient samples, which is consistent with previous reports of the lack of P. vivax in Haiti [2-4]. It is likely that the high prevalence of the FY allele that causes the Duffy negative phenotype may be responsible for the lack of P. vivax transmission in Haiti. The samples in this study were obtained from areas that are predominantly of West African ancestry, which are more representative of the ancestry of native Haitians. However, historical reports have indicated P. vivax transmission in communes inhabited by higher proportions of people who are of African/European descent that have lower population frequencies of the Duffy negative phenotype [26]. Since P. vivaxinfections have received little attention, it is unknown if such transmission is still occurring in those areas of Haiti. It is likely that low rates of travelers to Haiti from the surrounding P. vivax endemic countries in South America may have slowed any potential introductions of P. vivaxinfections into Haiti. Even if introductions were to occur, it would not be likely that P. vivax transmission could be sustained because of the high rates of the FY allele in the population. A more extensive study with a larger sample size from multiple sites in Haiti is desirable to confirm these results.In conclusion, no P. vivaxinfections were confirmed by PCR and the FY allele that results in silenced expression of the Duffy antigen on erythrocytes was found in 99% of the patients. The high frequency of FY allele could explain the sparse historical evidence of P. vivaxinfections in native Haitians and is attributable to their West African ancestry. Though P. vivaxmalaria is not prevalent and does not represent a significant public health risk in native Haitians, the risk of infection for travellers and foreign aid workers who are Duffy positive remains uncertain.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
TAW carried out the genetic testing for the FY allele and drafting the manuscript. TC helped conduct the genetic testing for the P. vivax and revision of the manuscript. ZC helped conduct the genetic testing for P. vivax. MEV was involved in drafting of the manuscript. VSF, AE aided in the sample collection. BAO conceived, designed and coordinated the study, and helped draft the manuscript. All authors read and approved the final manuscript.
Authors: P A Zimmerman; I Woolley; G L Masinde; S M Miller; D T McNamara; F Hazlett; C S Mgone; M P Alpers; B Genton; B A Boatin; J W Kazura Journal: Proc Natl Acad Sci U S A Date: 1999-11-23 Impact factor: 11.205
Authors: Tamar E Carter; Alexis Boulter; Alexandre Existe; Jean R Romain; Jean Yves St Victor; Connie J Mulligan; Bernard A Okech Journal: Am J Trop Med Hyg Date: 2015-02-02 Impact factor: 2.345
Authors: Thomas A Weppelmann; Michael E von Fricken; Tara D Wilfong; Elisa Aguenza; Taina T Philippe; Bernard A Okech Journal: Am J Trop Med Hyg Date: 2017-08-18 Impact factor: 2.345
Authors: Jason S Lehmann; Joseph J Campo; Micheline Cicéron; Christian P Raccurt; Jacques Boncy; Valery E M Beau De Rochars; Anthony P Cannella Journal: PLoS One Date: 2017-04-03 Impact factor: 3.240
Authors: Lynette Isabella Ochola-Oyier; Kevin Wamae; Irene Omedo; Christabel Ogola; Abneel Matharu; Jean Pierre Musabyimana; Francis K Njogu; Kevin Marsh Journal: Infect Genet Evol Date: 2019-02-05 Impact factor: 3.342
Authors: Michael E von Fricken; Thomas A Weppelmann; Brandon Lam; Will T Eaton; Laura Schick; Roseline Masse; Madsen V Beau De Rochars; Alexandre Existe; Joseph Larkin; Bernard A Okech Journal: Malar J Date: 2014-09-14 Impact factor: 2.979