Literature DB >> 23341968

The protective effect of glycyrrhetinic acid on carbon tetrachloride-induced chronic liver fibrosis in mice via upregulation of Nrf2.

Shaoru Chen1, Liyi Zou, Li Li, Tie Wu.   

Abstract

This study was designed to investigate the potentially protective effects of glycyrrhetinic acid (GA) and the role of transcription factor nuclear factor-erythroid 2(NF-E2)-related factor 2 (Nrf2) signaling in the regulation of Carbon Tetrachloride (CCl(4))-induced chronic liver fibrosis in mice. The potentially protective effects of GA on CCl(4)-induced chronic liver fibrosis in mice were depicted histologically and biochemically. Firstly, histopathological changes including regenerative nodules, inflammatory cell infiltration and fibrosis were induced by CCl(4).Then, CCl(4) administration caused a marked increase in the levels of serum aminotransferases (GOT, GPT), serum monoamine oxidase (MAO) and lipid peroxidation (MDA) as well as MAO in the mice liver homogenates. Also, decreased nuclear Nrf2 expression, mRNA levels of its target genes such as superoxide dismutase 3 (SOD3), catalase (CAT), glutathione peroxidase 2 (GPX2), and activity of cellular antioxidant enzymes were found after CCl(4) exposure. All of these phenotypes were markedly reversed by the treatment of the mice with GA. In addition, GA exhibited the antioxidant effects in vitro by on FeCl(2)-ascorbate induced lipid peroxidation in mouse liver homogenates, and on DPPH scavenging activity. Taken together, these results suggested that GA can protect the liver from oxidative stress in mice, presumably through activating the nuclear translocation of Nrf2, enhancing the expression of its target genes and increasing the activity of the antioxidant enzymes. Therefore, GA may be an effective hepatoprotective agent and viable candidate for treating liver fibrosis and other oxidative stress-related diseases.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23341968      PMCID: PMC3544925          DOI: 10.1371/journal.pone.0053662

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

In spite of tremendous scientific advancement in the field of hepatology in recent years, liver problems are on the rise and account for a high death rate [1]. Hepatic fibrosis is a common pathological process resulted from various chronic hepatic injuries, which is characterized by an increase of extracelluarmatrix (ECM) deposition in the Disse’s space and the imbalance between synthesis and degradation of ECM [2]. The liver fibrosis is induced by viral hepatitis. In Friedman’s research, alcohol consumption, autoimmune disorders, drug-induced, helminthic infection, iron or copper overload and biliary obstruction may be also a major cause of morbidity and mortality of liver fibrosis worldwide [3]. And Giuseppe Poli suggested that reactive oxidant species likely contribute to both onset and progression of liver fibrosis [4]. As mentioned front, we can know that the pathogenesis of liver fibrosis is complex and diversity. But most of them involve the production of free radicals and oxidative stress [5]–[8]. CCl4 is a potent hepatoxin producing centrilobular hepatic necrosis which is widely used for animal models of liver fibrosis. It has been reported that CYP450 in rat liver activates CCl4 to a trichloromethyl free radical (CCl3• and/or CCl3OO•), and stimulates Kupffer cells to produce ROS, such as •O2 −, H2O2 and •OH, which damage the liver [9]–[11]. These ROS are eliminated by antioxidant enzymes such as superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) and CAT. Upregulation of many antioxidant enzymes in liver is mediated by Nrf2, which plays a pivotal role in the activation of ARE-driven antioxidant gene expression [12], [13]. Normally, Nrf2 is a member of the “‘cap’ ‘n’ collar” family of basic leucine zipper (bZIP) transcription factors, which is sequestered by its suppressor Kelch-like ECH-associated protein 1 (Keap1) in the cytoplasm when in an inactive state, but in an active state, translocated into the nucleus where it binds to the ARE and led to expression of target genes, upon cell stimulation [14]–[16]. In the research of Jiang T indicated that Nrf2 acts as a protective role against arsenic induced liver toxicity in six weeks in vivo. It showed that Nrf2 protects liver against arsenic by controlling a cellular antioxidant response through transcriptional upregulation of an array of down-stream genes, such as GCL, HO-1, GST, MRPs and NQO1 [17]. And Xu WH suggested that activation of Nrf2 may be also a novel strategy to prevent or ameliorate toxin-induced liver injury and liver fibrosis, demonstrated that Nrf2 can protect liver from ROS damage by regulating the Nrf2 target genes in hepatocytes, which encode enzymes involved in the detoxification of CCl4 and its metabolite, such as GST, NQO1 and GCLC [18]. But the research of Wang YP suggested that the protective role of Nrf2 against liver damage may not be related during a long-term of CCl4 administration in 8 weeks [13]. Therefore, Nrf2 is regarded as a protective role and known to act as a mediator in CCl4-induced liver fibrosis by regulated the antioxidant enzymes activity and relative genes expression, but its protective role is perhaps relative to the damage time. GA is one of the derivative products of Glycyrrhizic acid (GL). It is the most effective medicine in clinical, which is extracted from Glycirrhizaglabra. There are a lot of researches showed that GA has potent antiviral, antimutagenic, anti-inflammatory, anti-injury and antioxidant properties as well as liver protection [19]–[25]. It has been clinically used in the treatment of liver diseases. However, the mechanisms underlying the liver fibrosis elicited by GA in association with Nrf2 up-regulation remain poorly understood [26]. Hence, the aimed of this research was to study that liver fibrosis caused by oxidative stress induction by CCl4, and the involvement of Nrf2 activation in the reaction to this stress. Especially, the research on the relationship among Nrf2, its target genes (SOD3mRNA, CATmRNA, GPX mRNA) and the treatment of GA on liver fibrosis induced by CCl4 was completely blank. Given these findings, we present a detail overview of the oxidative stress induction with activation of Nrf2 by CCl4, and attempt to elucidate the possible mechanism of GA on treatment of liver fibrosis induced by CCl4 that the up-regulation of Nrf2 associative with the enhancing expression of its target genes.

Materials and Methods

Chemicals and Reagents

The power of GA (HPLC >98%) was purchased from the local Chinese Natural additive Co., LTD-XIAN CHongXin. Silymarin was purchased from Madaus AG. CCl4 and peanut oil were purchased from MAGBIO Company in China. All other reagents were of analytic grade.

Animals and Treatment

Five-week-old male Kunming mice (25–30 g, affiliated hospital animal center of ZhongShan University) were used in this experiment. The animals were allowed free access to Purina Rodent Chow and tap water ad libitum and randomly divided into six groups containing 8 animals per group. They were maintained in a controlled environment at 25±3°Cand 75±2% relatively humidity with a 12 h dark/light cycle, and acclimatized for one week before the experiment. All procedures were conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals and approved by the Animal Care Committee of the Immunomodulation Research Center, GuangDong Medical College, Guangdong, and China. Mice in group I is control (Cont) and treatment with vehicle (i.g.) daily for 30 days. Mice from group II to group VI received CCl4 at dose of 6.4 g/kg respectively by subcutaneous injection under the skin between head and neck and then given treatment with either vehicle (group II, CCl4), silymarin 100 mg/kg/d (group III, Sil), or GA 25 mg/kg/d (group IV, GA25), GA 50 mg/kg/d (group V, GA50) and GA 100 mg/kg/d (group VI, GA100) for 30 days respectively. Before treatment, CCl4 dissolved in corn oil (12.8 g/kg BW, s.c.) was administrated under the skin between head and neck of mice to each group except Group I, and the following four dose of CCl4 was 6.4 g/kg BW in corn oil. But Group I (Cont.) was given corn oil with the same dosage with other groups every subcutaneous injection. The food was removed from the cage 12 h after the final treatment. Blood samples were collected from the eyeball vein plexus, and the livers were quickly excised from the mice. The blood samples were centrifuged to obtain serum at 3, 000×g for 15 min at 4°C. The excised livers were washed with cold phosphate buffer saline (PH 7.4), and pieces of the liver samples were fixed in 4% paraformaldehyde for histopathological examination. The remnants of the livers were stored at −80°C until the experimental use.

Histopathological Examination

The fixed liver specimens were dehydrated in a graded alcohol series. Following xylene treatment, the specimens were embedded in paraffin blocks, cut into 5 µm thick sections, and placed on glass slides, then stained with hematoxyline-eosin (H-E), V-G (a collagen fiber dyeing) and Masson (a trichrome stain), according to standard procedure. To evaluate CCl4-induced histopathological changes, the stained tissue sample was examined under a light microscope of 40–200×. A minimum of 10 fields was scored per liver slice to obtain the mean value. The scoring system was devised in conjunction with the experienced liver histopathologies of Kerry Thompson to assess both qualitative and quantitative changes, and based on our previous experience with this model in our lab. Separate parameters were employed to score changes after administration with CCl4 and chronic liver fibrosis treatment with GA (Table 1 and 2). Specimens were scored blinded by the histologist and were also ranked blind for severity of fibrosis, using H-E, V-G and Masson sections [27]–[29].
Table 1

Scoring system for the treatment with GA on the CCl4-induced hepatotoxicity.

Histological ParameterScoreDescription of Lesion
Inflammatory infiltrate (HE)0absent
1Scanty cells with steatosis present at junction of necrotic zone
2Cells with hydropic and balloon degeneration regularly present
3Predominantly neutrophil clusters
4Predominantly mononuclear cell clusters
Table 2

Scoring system for the treatment with GA on the CCl4-induced liver fibrosis.

Histological ParameterScoreDescription of Lesion
Fibrosis (V-G/Masson)0absent
1Trace, slender septa present
2Mild, slender septa linking hepatic veins
3Moderate, Broad/well-developed septa
4Severe. cirrhosis

Serum Analysis

The serum activity of MAO, GOT and GPT was measured to evaluate liver fibrosis. An autoanalyzer (Synergy2, Biotek, USA) was used in the experiments.

Homogenate Preparation

Liver tissues were homogenized with exact buffer (m/v = 1∶9) according to the protocols of commercially available kits, and centrifuged at 3, 000×g for 15 min in a high-speed centrifuge (Eppendorf Cebtrifuge5415R, Eppendorf, Germany) at 4°C. The supernatants were collected to determine the activity of SOD, CAT, GSH-Px and MAO as well as the content of MDA.

Lipid Peroxidation

The content of MDA, a compound produced during lipid peroxidation, was determined by the commercially available colorimetric assay kit (NanJingJianCheng Bioengineering Institute, Nanjing, China). Measurement of MDA was used as an indicator of lipid peroxidation [30]. This assay is based on the reaction of MDA with thiobarbituric acid (TBA). Two molecule of chromogenic reagent (2-Thiobarbituric acid) with one molecule of MDA to yield a stable chromophore at 95°C, forms a MDA-TBA2 adduct that absorbs strongly at 532 nm. 100 µl aliquot of sample solution and MDA standard solution were added to microcentrifuge tube respectively, and added the reagents on the kits into each tube and vortexed, each microcentrifuge tube was incubated at 95°C for 40 min and centrifuged at 4,000×g for 10 min. Then 300 µl of the supernatant was transferred to a microplate and the absorbance measured at 532 nm using a multi-detection microplate reader (Synergy2, Biotek, USA). The level of MDA is expressed as nM MDA/mg homogenate protein.

Antioxidant Enzymes Activity

SOD, GSH-Px and CAT activities were measured according to the protocols of commercially available kits (JianCheng Bioengineering Institute, Nanjing, China). SOD activity was evaluated by utilizing a tetrazolium salt for detection of superoxide radicals, generated by xanthine oxidase and hypoxanthine. One unit of SOD is defined as the amount of enzyme needed to exhibit 50% dismutation of the superoxide radical at 37°C. The reaction product was measured at 450 nm using a Synergy2 Automatic microplate reader. SOD activity in the liver tissues was expressed as units per milligram protein (U/mgprot). GSH-Px activity was based on the reaction of GSH transforms into GSSG. Reduced glutathione in liver homogenate was determined by reaction with 1, 2-dithio-bis nitro benzoic acid (DTNB). Briefly, 1 mol DTNB with 2 mol GSH reacted together to 1 mol 5, 5′-dithiobis (2-nitrobenzoic acid) with an intense yellow color, measured spectrophotometrically at 412 nm using a Synergy2 Automatic microplate reader. Results were expressed as µmol GSH/mg protein. CAT activity was based on the reduction of the H2O2. 0.1 ml 1% homogenate was incubated in 1.0 ml substrate (65 µmol per ml hydrogen peroxide in 60 mmol/L sodium-potassium-phosphate buffer, PH 7.4) at 37°C for 60 s. One unit catalase decomposes 1 µmol of hydrogen peroxide/min under this condiction. Then the enzymatic reaction was stopped with 1.0 ml of 32.4 mmol/L ammonium molybdate ((NH4)6Mo7O24•4H2O). And the yellow complex of molybdate and hydrogen peroxide was measured spectrophotometrically at 405 nm. During the test, the control tube and sample tube should do at the same time.

MAO Activity

MAO is a family of enzymes that catalyze the oxidation of monoamines [31], [32]. They are found bound to the outer membrane of mitochondria in most cells of the body. The enzyme was originally discovered by Mary Bernheim in the liver and was named tyramine oxidase [33], [34]. They belong to the protein family of flavin-containing amine oxidoreductases. And the MAO in the serum is hydrosoluble. It is similar to connective tissue’s, but different to mitochondria’s. The MAO activity in serum is positively correlated to that in homogenate. Both of them are also positively correlated to liver fibrosis. The MAO activity is measured spectrophotometrically at 242 nm using a Synergy2 Automatic microplate reader, according to the protocols of commercially available kits (JianCheng Bioengineering Institute, Nanjing, China).

Preparation of Nuclear Fractions from Liver

Microsomes were prepared as the guidance of Nucleoprotein protein Extraction kits (Sangon Biotech Co., LTD, Shanghai, China). The liver was washed in phosphate buffered saline twice, and then homogenized in three volumes (w/v) of the Hypotonic Buffer containing 5 µl phosphatase inhibitor, 10 µl PMSF and 1 µl DTT, ultrasound broken four times, 30 s per time. Then ice-bathed for 10 min, the liver homogenate was centrifuged at 3,000×g for 5 min in a high-speed centrifuge (Eppendorf Cebtrifuge5415R, Germany) at 4°C. After centrifuged in two volumes (w/v) of the same Hypotonic Buffer, the sediment was centrifuged at 5,000×g for 5 min. Then, the sediment washed and resuspended in the same volume (w/v) of the Lysis Buffer containing 5 µl phosphatase inhibitor, 10 µl PMSF and 1 µl DTT. After ice-bathed for 20 min, the suspension was centrifuged at 15,000× g for 10 min. The supernatant was defined as a nucleoprotein and stored at −80°C until used. Protein concentration was measured by BSABoster protein assay kit.

Preparation of Cytoplasm Fractions from Liver

Microsomes were prepared according to the protocol of Cytoplasmic and membranal protein Extraction kits (Sangon Biotech Co., LTD, Shanghai, China). The liver was washed in phosphate buffered saline twice and centrifuged at 700×g for 3 min in a high-speed centrifuge at 4°C. Then, the sediment was homogenized in ten volumes (w/v) of the Hypotonic Buffer containing 5 µl phosphatase inhibitor, 10 µl PMSF, 1 µl DTT and 1 µl protease inhibitor, ultrasound broken six times, 20 s per time. Then ice-bathed for 10 min, the liver homogenate was centrifuged at 3,000 rpm for 10 min in a high-speed centrifuge at 4°C. Then the supernatant was transferred to another tube and centrifuged at 13,000 rpm for 75 min. The supernatant was defined as a cytoplasmic protein and stored at −80°C until used. Protein concentration was measured by BSABoster protein assay kit.

Western Blot Analysis for Nrf2

Western blotting was performed by using the standard method. Equal amounts of proteins were separated by 10% SDS-poyacrylamide gel electrophoresis and electro-transferred to an Immun-Blotsolarbio PVDF membrane (0.22 µm pore size, Solarbio). Membranes were blocked overnight at 4°C in Phosphate Buffered Saline (PBS) with 5% w/v skimmed milk powder (Sangon, Shanghai, China), then the membranes were incubated at 4°C with primary antibody diluted in the normal saline contained 0.025% v/v Tween-20 (GAPDH 1∶2000, Nrf2 1:200, Santa Cruz Biochemistry, INC. CA, USA) overnight. After washed with 0.025% v/v Tween-20 in PBS, the membrane was incubated with anti-rabbit IgG AP-linked secondary antibody for 2 h at room temperature and then washed with the same buffer. The blots in the samples were quantified by densitometry analysis using Quantity One software. All data for three independent experiments were expressed as relative intensity compared to the control group for statistical analysis.

QRT-PCR Analysis

Total RNA from liver tissues were extracted using Trizol (Invitrogen, USA). The concentration of total RNA in each sample was quantified spectrophotometrically at 260 nm. The integrity of each RNA sample was evaluated by formaldehyde-agarose gel electrophoresis before analysis. Then equal amounts of RNA (1 µg) were reverse-transcribed into cDNA using the Transcriptor First Strand cDNA synthesis Kit (Promega, USA) according to the manufacturer’s instructions, and the resulting cDNA was used for real-time PCR analysis using SYBR® Green PCR Master Mix in a ABI7500 Fast Real-Time PCR System (USA).The RT-PCR was performed under the instruction of RT-PCR kit (DRR820A, TAKARA) and all reactions were performed in triplicate, and PCR runs were repeated twice. Data were analyzed using ABI7500 biosystems. The data presented were relative mRNA levels normalized to GAPDH, and the value from the control group was set as 1. The target mRNA was performed with specific primers provided by TAKARA. Primer sequences described as followed: SOD3, 5′CTTGTTCTACGGCTTGCTACTG3′ and 5′ ATGCGTGTCGCCTATCTTCT3′; CAT, 5′ CCAGTGCGCTGTAGATGTGAAAC3′and 5′ GGTGGACGTCAGTGAAATTCTTG3′; GPX2, 5′CCACTGTTTCCCCTGAGCA3′ and 5′CAGACTTAGAGCCCCAAGCA3′; GAPDH, 5′ GGTGAAGGTCGGTGTGAACG3′ and 5′CTCGCTCCTGGAAGATGGTG3′.

FeCl2-ascorbic Acid Stimulated Lipid Peroxidation Assay

A murine liver homogenate of the young male mice was used. The reaction mixture was composed of 0.25 ml of the liver homogenate, 0.05 ml of 0.1 mM ascorbic acid, 0.1 ml of Tris-HCl buffer (PH 7.2), 0.05 ml of 4 mM FeCl2 and 0.05 ml of a solution with various concentrations of GA (dissolved in dimethyl-sulfoxide). Control was treated only with dimethylsulfoxide, the final concentration of which never exceeded 0.1%. And this concentration did not have any noticeable effect on the assay systems [35]. After incubated in 37°C for 120 min, the lipid peroxidation products were measured by MDA assay kit (JianCheng Bioengineering Institute, Nanjing, China). 1, 1, 3, 3-Tetraethoxypropan was used as a standard for the calibration of MDA.

Assay of DPPH Radical Scavenging Activity

The antioxidant and free radical scavenging activity of GA was determined by the stable free radical diphenylpicrylhydrazyl (DPPH), in terms of the mechanism of its treatment of liver fibrosis. The reaction was composed of 3.9 ml of 25 mg/L DPPH and 0.1 ml of a solution with various concentrations of GA (all dissolved in ethanol). Control was treated only with ethanol. The products were measured at 517 nm after 5 min reaction. Ascorbic acid was used as a reference inhibitor. All the datas for three independent experiments were expressed by a DPPH curve [36], [37].

Statistical Analysis

Data bars represent the means±SD (standard deviations) for at least three independent experiments in all cases. Two group comparisons were evaluated by Student’s t-test as appropriate. Differences were considered statistically significant when the p value was <0.05.

Results

Effect of GA on CCl4-induced Hepatotoxity

Serum GOT, GPT and histopathological were examined to evaluate the effect of GA on CCl4- induced hepatotoxicity in mice. As showed in Table 3, the group administrated with CCl4 only (model group) caused hepatotoxicity in mice indicated by marked increased GOT and GPT serum levels. GA and silymarin reversed the CCl4-induced elevation of serum GOT and GPT levels to some extent. Histopathological studies showed that, compared to the control group, CCl4 induced severe degeneration in the hepatocytes with extensive inflammatory cell infiltration around the central vein, portal area as well as focal necrosis (Fig. 1B). According to microscopic examinations, severe hepatic lesions induced by CCl4 were remitted by the administration of GA to some extent, which were in good agreement with the results of the serum aminotransferase activities, GA can reverse the increasing level of GOT/GPT in serum induced by CCl4. In GA 25 mg/kg treated group (Fig. 1D), showing moderate hydropic degeneration of hepatocytes. And hepatocyte necrosis was merely diminished, and disappeared nearly in the GA 50 mg/kg treated group (Fig. 1E), showing a significantly reduction of the level of hydropic degeneration and necrosis. But in GA 100 mg/kg group (Fig. 1F), hepatocyte necrosis was severe and showing ballooning degeneration. In Fig. 2, it was showed that GA (25 and 50 mg/kg) significantly decreased inflammation score. These results showed that GA treated CCl4-induced hepatotoxicity to some extent.
Table 3

Effects of the treatment with GA on the CCl4-induced liver fibrosis and lipid peroxidation.

GroupsSerum GOT(U/L)Serum GPT(U/L)Lipid peroxidation(MDA: nM/mgpro)
Cont 8.58±2.70b 7.63±0.79b 2.42±0.53b
CCl4 94.50±11.49a 49.03±6.47a 3.30±0.45a
Sil15.22±3.11a, b 29.90±4.03a, b 2.96±0.59
GA2515.81±3.42a, b 37.40±10.09a, b 3.00±0.16a
GA5018.36±6.10a, b 29.21±4.40a, b 2.84±0.56b
GA10023.11±4.08a, b 40.05±11.06a, b 3.11±0.56a

The mice were treated with GA, silymarin or vehicle every day for 4 weeks on the other day of the first double-dosage administration with CCl4. The CCl4 dissolved in corn oil (6.4 g/kg of body weight, s.c.) was administrated under the skin between head and neck to each group every 6 days during this month, except Cont. The animals were sacrificed 24 h after the last CCl4 administration. Hepatotoxicity was determined by quantifying the serum activities of GPT and GOT as well as hepatic lipid peroxidation. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean±SD (n = 8) in each group.

Significantly different from the control at p<0.05.

Significantly different from the CCl 4 at p<0.05.

Figure 1

Effects of GA on histopathological changes by CCl4 in mice were evaluated in sections stained with hematoxyline-eosin.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration and the liver was removed, fixed and embedded in paraffin. Sections were stained with hematoxyline-eosin (H-E, 200×). (A) Liver tissue of a control mouse. (B) Liver tissue of a mouse treated with CCl4, presenting severe hepatocyte necrosis with neutrophil clusters and mononuclear cells infiltration (arrow 2) around the portal vein. (C) Liver tissue of a mouse treated with silymarin (100 mg/kg, i.g.), showing mild hepatocyte necrosis with inflammatory cell infiltration and steatosis (arrow 1) around the portal vein. (D) Liver tissue of a mouse treated with GA (25 mg/kg, i.g.), showing moderate hepatocyte necrosis with inflammatory cell infiltration and moderate steatosis (arrow 1). (E) Liver tissue of a mouse treated with GA (50 mg/kg, i.g.), showing mild steatosis (arrow 1) around centrilobular and midzone region. (F) Liver tissue of a mouse treated with GA (100 mg/kg, i.g.), showing mild hepatocyte necrosis with inflammatory cell infiltration (arrow 2) and severe steatosis (arrow 1).

Figure 2

The inflammation score was evaluated in the livers of surviving animals by certified pathologist in a blinded fashion.

Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Datas are presented as the mean ± SD (n = 8) in each group. *** Significantly different from the control at p<0.001; ## Significantly different from the CCl4 at p<0.01; ### Significantly different from the CCl4at p<0.001.

Effects of GA on histopathological changes by CCl4 in mice were evaluated in sections stained with hematoxyline-eosin.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration and the liver was removed, fixed and embedded in paraffin. Sections were stained with hematoxyline-eosin (H-E, 200×). (A) Liver tissue of a control mouse. (B) Liver tissue of a mouse treated with CCl4, presenting severe hepatocyte necrosis with neutrophil clusters and mononuclear cells infiltration (arrow 2) around the portal vein. (C) Liver tissue of a mouse treated with silymarin (100 mg/kg, i.g.), showing mild hepatocyte necrosis with inflammatory cell infiltration and steatosis (arrow 1) around the portal vein. (D) Liver tissue of a mouse treated with GA (25 mg/kg, i.g.), showing moderate hepatocyte necrosis with inflammatory cell infiltration and moderate steatosis (arrow 1). (E) Liver tissue of a mouse treated with GA (50 mg/kg, i.g.), showing mild steatosis (arrow 1) around centrilobular and midzone region. (F) Liver tissue of a mouse treated with GA (100 mg/kg, i.g.), showing mild hepatocyte necrosis with inflammatory cell infiltration (arrow 2) and severe steatosis (arrow 1).

The inflammation score was evaluated in the livers of surviving animals by certified pathologist in a blinded fashion.

Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Datas are presented as the mean ± SD (n = 8) in each group. *** Significantly different from the control at p<0.001; ## Significantly different from the CCl4 at p<0.01; ### Significantly different from the CCl4at p<0.001. The mice were treated with GA, silymarin or vehicle every day for 4 weeks on the other day of the first double-dosage administration with CCl4. The CCl4 dissolved in corn oil (6.4 g/kg of body weight, s.c.) was administrated under the skin between head and neck to each group every 6 days during this month, except Cont. The animals were sacrificed 24 h after the last CCl4 administration. Hepatotoxicity was determined by quantifying the serum activities of GPT and GOT as well as hepatic lipid peroxidation. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean±SD (n = 8) in each group. Significantly different from the control at p<0.05. Significantly different from the CCl 4 at p<0.05.

Effect of GA on CCl4-induced Liver Fibrosis

Serum MAO, homogenate MAO and histopathological were examined to evaluate the effect of GA on CCl4-induced liver fibrosis in mice. As shown in Fig. 3, CCl4 caused liver fibrosis by marked increased serum MAO and homogenate MAO. GA and silymarin treatment relieved the CCl4-induced elevation of serum and homogenate MAO levels. Histopathological studies showed that CCl4 compared to the control, induced severe degeneration in the hepatocytes with fibrosis around the central vein as well as focal necrosis (Fig. 4B; Fig. 5B). According to microscopic examinations, severe liver fibrosis induced by CCl4 was reduced by the administration of GA to some extent, which was in good agreement with the results of the serum MAO and homogenate MAO. In GA 25 and 100 mg/kg group (Fig. 4D; Fig. 5D and Fig. 4F; Fig. 5F), liver fibrosis was mildly diminished, and merely disappeared in the GA 50 mg/kg (Fig. 4E; Fig. 5E), showing a significantly suppression of hepatic fibrogenesis but severe to moderate hydropic degeneration of hepatocytes. These results were consistent with the fibrosis scores showed in Figure 6 and Figure 7. GA (25, 50 and 100 mg/kg) decreased fibrosis scores to different extent.
Figure 3

Effects of GA on serum and homogenate MAO changes by CCl4 in mice.

Mice in all groups were treated as the same with the front method. Liver fibrosis was determined by quantifying the serum activities of MAO (Fig. 3A) as well as liver homogenate MAO (Fig. 3B). Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Datas are presented as the mean± SD (n = 8) in each group. *** Significantly different from the control at p<0.001; # Significantly different from the CCl4 at p<0.05; ### Significantly different from the CCl4 at p<0.001.

Figure 4

Effects of GA on histopathological changes by CCl4 in mice were evaluated in sections stained with collagenous fiber.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration and the liver was removed, fixed and embedded in paraffin. Sections were stained with collagenous fiber (V-G, 200×). (A) Liver tissue of a control mouse. (B) Liver tissue of a mouse treated with CCl4, numerous fibrocytes appeared at the periphery of the lesions, and the collagen fibers became longer and thicker, presenting severe liver fibrosis and severe hepatocyte necrosis with inflammatory cell infiltration around the portal vein. (C) Liver tissue of a mouse treated with silymarin (100 mg/kg, i.g.), showing broad-develop septa and moderate liver fibrosis around the portal vein. (D) Liver tissue of a mouse treated with GA (25 mg/kg, i.g.), showing slender septa linking hepatic vein and mild hepatic fibrogenesis. (E) Liver tissue of a mouse treated with GA (50 mg/kg, i.g.), showing mild fibrosis around centrilobular and midzone region. (F) Liver tissue of a mouse treated with GA (100 mg/kg, i.g.), showing moderate fibrosis. Arrow 1 shows collagen fibers which was stained red, while arrow 2 shows inflammatory cell infiltration.

Figure 5

Effects of GA on histopathological changes by CCl4 in mice were evaluated in sections stained with Masson.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration and the liver was removed, fixed and embedded in paraffin. Sections were stained with Masson (200×). (A) Liver tissue of a control mouse. (B) Liver tissue of a mouse treated with CCl4, presenting severe liver fibrosis (arrow 1) and ballooning degeneration (arrow 2) aroud the portal vein. (C) Liver tissue of a mouse treated with silymarin (100 mg/kg, i.g.), presenting well-developed septa, showing moderate liver fibrosis (arrow 1) and hepatocyte necrosis with inflammatory cell (arrow 2) infiltration around the portal vein. (D) Liver tissue of a mouse treated with GA (25 mg/kg, i.g.), presenting slender septa linking hepatic veins, showing mild liver fibrosis (arrow 1) and severe sreatosis (arrow 2). (E) Liver tissue of a mouse treated with GA (50 mg/kg, i.g.), presenting slender septa, showing mild fibrosis (arrow 1) and sreatosis (arrow 2) around centrilobular and midzone region. (F) Liver tissue of a mouse treated with GA (100 mg/kg, i.g.), showing severe fibrosis (arrow 1) and sreatosis (arrow 2). Arrows show collagen fibers, which were stained blue (Masson trichrome staining).

Figure 6

Fibrosis score.

Fibrosis score was evaluated in the liver sections stained with V-G of surviving animals by certified pathologist in a blinded fashion. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Datas are presented as the mean ± SD (n = 8) in each group. *** Significantly different from the control at p<0.001; # Significantly different from the CCl 4 at p<0.05; ## Significantly different from the CCl4 at p<0.01; ### Significantly different from the CCl4 at p<0.001.

Figure 7

Fibrosis score.

Fibrosis score was evaluated in the liver sections stained with Masson of surviving animals by certified pathologist in a blinded fashion. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Datas are presented as the mean ± SD (n = 8) in each group. *** Significantly different from the control at p<0.001; # Significantly different from the CCl4 at p<0.05; ## Significantly different from the CCl4 at p<0.01.

Effects of GA on serum and homogenate MAO changes by CCl4 in mice.

Mice in all groups were treated as the same with the front method. Liver fibrosis was determined by quantifying the serum activities of MAO (Fig. 3A) as well as liver homogenate MAO (Fig. 3B). Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Datas are presented as the mean± SD (n = 8) in each group. *** Significantly different from the control at p<0.001; # Significantly different from the CCl4 at p<0.05; ### Significantly different from the CCl4 at p<0.001.

Effects of GA on histopathological changes by CCl4 in mice were evaluated in sections stained with collagenous fiber.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration and the liver was removed, fixed and embedded in paraffin. Sections were stained with collagenous fiber (V-G, 200×). (A) Liver tissue of a control mouse. (B) Liver tissue of a mouse treated with CCl4, numerous fibrocytes appeared at the periphery of the lesions, and the collagen fibers became longer and thicker, presenting severe liver fibrosis and severe hepatocyte necrosis with inflammatory cell infiltration around the portal vein. (C) Liver tissue of a mouse treated with silymarin (100 mg/kg, i.g.), showing broad-develop septa and moderate liver fibrosis around the portal vein. (D) Liver tissue of a mouse treated with GA (25 mg/kg, i.g.), showing slender septa linking hepatic vein and mild hepatic fibrogenesis. (E) Liver tissue of a mouse treated with GA (50 mg/kg, i.g.), showing mild fibrosis around centrilobular and midzone region. (F) Liver tissue of a mouse treated with GA (100 mg/kg, i.g.), showing moderate fibrosis. Arrow 1 shows collagen fibers which was stained red, while arrow 2 shows inflammatory cell infiltration.

Effects of GA on histopathological changes by CCl4 in mice were evaluated in sections stained with Masson.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration and the liver was removed, fixed and embedded in paraffin. Sections were stained with Masson (200×). (A) Liver tissue of a control mouse. (B) Liver tissue of a mouse treated with CCl4, presenting severe liver fibrosis (arrow 1) and ballooning degeneration (arrow 2) aroud the portal vein. (C) Liver tissue of a mouse treated with silymarin (100 mg/kg, i.g.), presenting well-developed septa, showing moderate liver fibrosis (arrow 1) and hepatocyte necrosis with inflammatory cell (arrow 2) infiltration around the portal vein. (D) Liver tissue of a mouse treated with GA (25 mg/kg, i.g.), presenting slender septa linking hepatic veins, showing mild liver fibrosis (arrow 1) and severe sreatosis (arrow 2). (E) Liver tissue of a mouse treated with GA (50 mg/kg, i.g.), presenting slender septa, showing mild fibrosis (arrow 1) and sreatosis (arrow 2) around centrilobular and midzone region. (F) Liver tissue of a mouse treated with GA (100 mg/kg, i.g.), showing severe fibrosis (arrow 1) and sreatosis (arrow 2). Arrows show collagen fibers, which were stained blue (Masson trichrome staining).

Fibrosis score.

Fibrosis score was evaluated in the liver sections stained with V-G of surviving animals by certified pathologist in a blinded fashion. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Datas are presented as the mean ± SD (n = 8) in each group. *** Significantly different from the control at p<0.001; # Significantly different from the CCl 4 at p<0.05; ## Significantly different from the CCl4 at p<0.01; ### Significantly different from the CCl4 at p<0.001. Fibrosis score was evaluated in the liver sections stained with Masson of surviving animals by certified pathologist in a blinded fashion. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Datas are presented as the mean ± SD (n = 8) in each group. *** Significantly different from the control at p<0.001; # Significantly different from the CCl4 at p<0.05; ## Significantly different from the CCl4 at p<0.01.

Effect of GA on CCl4-induced Hepatic Lipid Peroxidation

To evaluate the effect of GA treatment on CCl4-induced liver lipid peroxidation, the levels of MDA, an index of oxidative damage and one of the decomposition products of peroxidased polyunsaturated fatty acids, were monitored. As showed in Table 3, a significant increase of MDA in the CCl4-treated group confirmed that oxidative damage had been induced. Consistent with the serum levels of GPT and GOT, treatment with GA (25, 50 mg/kg) and silymarin were significantly decreased CCl4-induced lipid peroxidation (Table 3). In the mice of group IV to VI treated with GA at doses of 25, 50 and 100 mg/kg in the course of the CCl4 challenge was observed to dose-dependently reverse the CCl4-induced alteration of MDA by 9.1%, 13.9%, 5.8%.

Effect of GA on CCl4-induced Changes in the Levels of Hepatic Antioxidant Enzyme Activities

It has been suggested that SOD, GSH-Px and CAT served as the detoxifying system for the prevention of damage caused by ROS, and play pivotal roles in the scavenging of free radicals. To provide insight into the relationship between the antifibrosis effect and the antioxidant effect of GA, the activities of these antioxidant enzymes were analyzed. As shown in Table 4, CCl4 induced substantial modifications to the hepatic antioxidative enzymes and the decreased hepatic SOD, GSH-Px and CAT activities as the result of CCl4 subcutaneous injection were significantly elevated in the GA and silymarin groups, and the effect was strengthened with GA in the concentration of 25 and 50 mg/kg. Interestingly, the CAT activities of the 25 mg/kg and 50 mg/kg GA treated groups were higher than those of the CCl4-treated group, being at even higher than those of the control group. The SOD activities of the 25 mg/kg and 50 mg/kg GA group were much higher than those of the CCl4-treated group. What’s more, the GSH-Px activities of GA groups were higher than those of the CCl4-treated group to some extent. All were shown in Table 4. Taken together, these results indicate that treatment with GA attenuated the changes in antioxidant enzyme activities induced by the administration of CCl4.
Table 4

Antioxidative effects of the treatment with GA on the CCl4-induced liver fibrosis.

GroupsSOD(U/mgprot)CAT(U/mgprot)GSH-Px(µmol/mgprot)
Cont76.64±21.16b 51.34±4.01b 131.70±16.51b
CCl4 48.15±20.30a 44.50±8.46a 77.26±9.49a
Sil127.62±17.15b 44.54±7.1285.14±13.98b
GA25111.09±24.27b 69.16±17.71b 95.59±10.40b
GA5070.91±21.31b 71.68±7.34b 85.18±7.08b
GA10040.80±14.5652.55±8.9285.81±10.07b

The mice were treated with GA, silymarin or vehicle every day for 4 weeks on the other day of the first double-dosage administration with CCl4. Then every 6 days during this month, CCl4 dissolved in corn oil (6.4 g/kg of body weight, s.c.) was administrated under the skin between head and neck to each group, except Cont. The activities of antioxidant enzyme in the liver were determined. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean± SD (n = 8) in each group.

Significantly different from the control at p<0.05.

Significantly different from the CCl4 at p<0.05.

The mice were treated with GA, silymarin or vehicle every day for 4 weeks on the other day of the first double-dosage administration with CCl4. Then every 6 days during this month, CCl4 dissolved in corn oil (6.4 g/kg of body weight, s.c.) was administrated under the skin between head and neck to each group, except Cont. The activities of antioxidant enzyme in the liver were determined. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean± SD (n = 8) in each group. Significantly different from the control at p<0.05. Significantly different from the CCl4 at p<0.05.

Effects of GA on Hepatic Nrf2 Content

Nrf2 plays a key role in the activation of antioxidants enzymes by regulating their transcription [33]. Therefore, western blotting analysis was performed to examine the effect of GA on Nrf2 protein expression. As shown in Fig. 8, the Nrf2 of the mice receiving CCl4 alone showed a lower expression compared to the control mice in the cytoplasm. In contrast, the mice give administration with GA and silymarin showed a high level of Nrf2 with respect to that in the mice of control group. And the expression of Nrf2 in nucleoprotein was similar to it. As shown in Fig. 9, the mice receiving CCl4 alone showed a dramatic downregulation in the Nrf2 protein levels compared to the control mice in the nucleoprotein. Instead, the mice give administration with GA and silymarin markedly increased the levels of Nrf2 with respect to that in the mice intoxicated with CCl4 alone. The restoration of Nrf2 by GA supplementation implies that GA could have a hepatoprotective effect which led to recovery from CCl4-induced liver fibrosis.
Figure 8

Effects of GA on CCl4 bioactivation related Nrf2 expression in cytoplasm.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration. (A) The expression of Nrf2 and GAPDH in the liver microsomes was determined by western blotting. GAPDH was used as an internal control. (B) Quantitative analysis of the Nrf2 proteins. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean± SD for three independent experiments, performed in triplicate. *** Significantly different from the control at p<0.001; ### Significantly different from CCl4 at p<0.001.

Figure 9

Effects of GA on CCl4 bioactivation related Nrf2 expression in nuclear.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration. (A) The expression of Nrf2 and GAPDH in the liver microsomes was determined by western blotting. GAPDH was used as an internal control. (B) Quantitative analysis of the Nrf2 proteins. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean± SD for three independent experiments, performed in triplicate. *** Significantly different from the control at p<0.001; ### Significantly different from CCl4 at p<0.001.

Effects of GA on CCl4 bioactivation related Nrf2 expression in cytoplasm.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration. (A) The expression of Nrf2 and GAPDH in the liver microsomes was determined by western blotting. GAPDH was used as an internal control. (B) Quantitative analysis of the Nrf2 proteins. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean± SD for three independent experiments, performed in triplicate. *** Significantly different from the control at p<0.001; ### Significantly different from CCl4 at p<0.001.

Effects of GA on CCl4 bioactivation related Nrf2 expression in nuclear.

Mice in all groups were treated as the same with the front method. The animals were sacrificed 24 h after the last CCl4 administration. (A) The expression of Nrf2 and GAPDH in the liver microsomes was determined by western blotting. GAPDH was used as an internal control. (B) Quantitative analysis of the Nrf2 proteins. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean± SD for three independent experiments, performed in triplicate. *** Significantly different from the control at p<0.001; ### Significantly different from CCl4 at p<0.001.

Effects of GA on Nrf2 Targeted mRNA Expression in Liver

To determine the mechanism of how GA protects against CCl4-induced liver fibrosis by Nrf2, CAT, GPX2 and SOD3 mRNA were quantified in livers of the six groups’ mice (Fig. 10). The SOD3 level of the six groups was shown in Fig. 10A. The SOD3 level was four-fold higher in control group, five -fold higher in silymarin group and 25 mg/kg GA group, ten-fold higher in 50 mg/kg GA group but twice higher in 100 mg/kg GA group, compared with the models. As shown in Fig. 10B, without CCl4 the basal level of CAT was 53% higher than the model group. Compared with the model group, the level of CAT was 76% higher in Silymarin, three -fold higher in the 25 mg/kg GA group and 84.3% higher in the 50 mg/kg GA group. But the level of CAT on the 100 mg/kg GA group was twice as much as the model group. Similarly, the level of GPX2 in control group was 62.9% higher than that in the model group. The level of GPX2 in Silymarin group was 72.9% higher than the model group. And that level in 50 mg/kg and 100 mg/kg GA group were twice higher than model group. But the level of GPX2 in 25 mg/kg GA group was 23.6% lower than the model group. All these results shown in Fig. 10 indicate that the administration of CCl4 inhibited the expression of the genes regulated by Nrf2 including CAT, GPX2 and SOD3, but the treatment with GA could enhance the target genes expression to some extent.
Figure 10

Effect of GA on the mRNA expression levels of SOD3, CAT, and GPX2 genes.

Total RNA was extracted from mice liver tissues of GA-treated, CCl4-administrated, silymarin-treated, and control group animals after sacrificed. qRT-PCR was performed for analysis of mRNA expression levels of SOD3, CAT, and GPX2. (A) qRT-PCR results for analysis of SOD3 mRNA. (B) qRT-PCR results for analysis of CAT mRNA. (C) qRT-PCR results for analysis of GPX2 mRNA. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean± SD for three independent experiments, performed in triplicate.*** Significantly different from the control at p<0.001; ### Significantly different from CCl4 at p<0.001.

Effect of GA on the mRNA expression levels of SOD3, CAT, and GPX2 genes.

Total RNA was extracted from mice liver tissues of GA-treated, CCl4-administrated, silymarin-treated, and control group animals after sacrificed. qRT-PCR was performed for analysis of mRNA expression levels of SOD3, CAT, and GPX2. (A) qRT-PCR results for analysis of SOD3 mRNA. (B) qRT-PCR results for analysis of CAT mRNA. (C) qRT-PCR results for analysis of GPX2 mRNA. Cont, normal control; CCl4, CCl4 alone; Sil, CCl4+100 mg/kg silymarin; GA25, CCl4+25 mg/kg GA; GA50, CCl4+50 mg/kg GA; GA100, CCl4+100 mg/kg GA. Data are presented as the mean± SD for three independent experiments, performed in triplicate.*** Significantly different from the control at p<0.001; ### Significantly different from CCl4 at p<0.001.

Effect of FeCl2-ascorbic Acid Stimulated Lipid Peroxidation and DPPH Radical Scavenging Activity

The anti-lipid peroxidation and DPPH scavenging effects of GA were investigated in liver homogenates to determine the antioxidant effects of GA in terms of the mechanism of their anti-fibrosis effects. Consistent with the results CCl4-induced hepatic lipid peroxidation, GA showed a dose-dependent inhibition of the FeCl2-ascorbic acid stimulated lipid peroxidation in the liver homogenate (Fig. 11A) and also exhibited DPPH radical scavenging activity in a dose-dependent manner (Fig. 11B). Taken together, GA has antioxidant activity in vitro.
Figure 11

Inhibitory effects of GA on FeCl2-ascorbic acid stimulated lipid peroxidation and DPPH radical scavenging activity.

(A) The mouse liver homogenates were stimulated with FeCl2-ascorbic acid in the presence or absence of GA. The lipid peroxidation was measured as described in Section 2. Control value of lipid peroxidation in liver homogenates. (B) The DPPH radical scavenging activity was determined by the DPPH assay in the presence or absence of GA and the scavenging activity was measured as described in Section 2. The value is presented as the mean of the percentage inhibition±SD for three independent experiments, performed in triplicate. *Significantly different from the control (GA = 0 µg/ml) at p<0.05.

Inhibitory effects of GA on FeCl2-ascorbic acid stimulated lipid peroxidation and DPPH radical scavenging activity.

(A) The mouse liver homogenates were stimulated with FeCl2-ascorbic acid in the presence or absence of GA. The lipid peroxidation was measured as described in Section 2. Control value of lipid peroxidation in liver homogenates. (B) The DPPH radical scavenging activity was determined by the DPPH assay in the presence or absence of GA and the scavenging activity was measured as described in Section 2. The value is presented as the mean of the percentage inhibition±SD for three independent experiments, performed in triplicate. *Significantly different from the control (GA = 0 µg/ml) at p<0.05.

Discussion

Chronic liver diseases constitute a global connection, and the medical treatments for these diseases are usually difficult to handle and have limited efficacy. Therefore, it is necessary and considerable interest to find new medicines for the treatment of liver diseases [35]. For that reason, our experiment is interesting. In an attempt to model the liver fibrosis process, CCl4 has been used to experimentally induce liver injury in rodents widely. A single dose of CCl4 leads to centrizonal necrosis and steatosis [38], while prolonged administration CCl4 leads to liver fibrosis. It is said that the liver fibrosis model induced by CCl4 is the best-characterized system among the xenobiotic-induced liver damage [39]–[44]. It is now generally accepted that the liver fibrosis is induced by oxidative stress, which was produced by CCl4 in vivo. As reported, the liver fibrosis induced by CCl4 is the result of reductive dehalogenation. CCl4 in vivo is catalyzed by CYP450, then it forms the highly reactive trichloromethyl free radical (CCl3•). This radical readily interacts with O2 to form a more reactive trichloromethylperoxy radical (CCl3OO•), which is capable of binding to protein or lipid, or of abstracting a hydrogen atom forms an unsaturated lipid, which leads to lipid peroxidation and liver damage as well as plays significant roles in the pathogenesis of liver fibrosis [39]–[43], [45]–[52]. GA has been widely used for the treatment of liver diseases, such as chronic hepatitis C. It has been reported that GA can treat chronic hepatitis C by inhibiting the type I collagen gene transcription [53]. It can treat liver fibrosis by decreasing the collagen deposition and downregulation of the type I procollagen as well as the alpha-SMA on RNA expression [54]. But in our study, we found that GA can inhibit the free radical toxicity and lipid peroxidation in vitro, which is close to itself’ s antioxidative ability. Moreover, our study showed that GA has an inhibitory effect on liver fibrosis in vivo, which is probably associated with its activation of antioxidant protein that was regulated by Nrf2. All these results referred to front are consistent with the others researchers’ opinion on GA [55]–[57]. It has showed that, the increased serum levels of GOT and GPT have been attributed to the damaged structural integrity of the liver, because these are cytoplasm in location and released into circulation after cellular damage [41], [42]. And both of the increased levels of serum MAO and the homogenate MAO are the standards of liver fibrosis [58], [59]. Upon our study, liver fibrosis induced by CCl4 intoxication in mice was established from significant alterations in the serum GOT, GPT and MAO levels as found by previous researchers. However, the serum GOT, GPT and MAO activities declined in the GA-supplemented groups, suggesting that GA protected the mice against CCl4-induced liver fibrosis to some extent. During the different dose of GA administration, the 50 mg/kg GA and 25 mg/kg GA decreased these in serum and homogenate levels mostly. In parallel with the alteration of liver function markers, these phenomena were also confirmed by histological observation (Fig. 1; Fig. 2; Fig. 4; Fig. 5; Fig. 6; Fig. 7). In our study, GA can relieve the inflammatory cell infiltration, hydropic degeneration and fibrosis around the central vein as well as focal necrosis to some extent, which is induced by the administration of CCl4. Then the improvement of enzyme level to a normal value indicated that GA could treat liver fibrosis to some extent. Oxidative stress is a key factor on liver fibrosis. Extensive studies with model systems, and with biological material in vitro, have clearly showed that free radicals which are produced along with oxidative stress, can produced chemical damage to lipids, proteins, and carbohydrates [60]. So if such free radicals produced in liver, it can make great degeneration disease-liver fibrosis. It can be restrained by endogenous free radical scavengers such as SOD, CAT and GSH-Px. SOD reduces the concentration of highly reactive superoxide radical by converting it to H2O2 whereas CAT and GSH-Px decomposes H2O2 and protect the tissues from highly reactive hydroxyl radicals [42], [43]. And our study showed that, the treatment of GA can reverse the toxic effects of CCl4 by restoring the activities of antioxidant enzymes towards the level of control animals. It seems likely that CCl4 administration cause oxidative stress in liver via the generation of free radicals whereas GA relieves the liver injuries by upregulating the activity of CAT, SOD and GSH-Px to scavenge of free radicals. As reported, the lipid peroxidation is one of the major outcomes of free radical-mediated injury that directly damages membranes and generates a number of secondary products in vivo, both from fission and endo-cyclization of oxygenated fatty acids possessing toxic activities. It is close to liver fibrosis. It is not only as the standard of the liver fibrosis, but could also directly induce liver fibrosis [61], [62]. And it is said that one of the principle causes of CCl4-induced liver fibrosis is lipid peroxidation of hepatocyte membranes by free radical derivatives of CCl4 [61], [62]. MDA, an end product of membrane lipid peroxidation, is one of the most widely used indicators for free radical mediated damage [63]. The observation of elevated levels of hepatic MDA in Group II (administered CCl4 alone) in our study is higher than that in any other groups. GA can decrease the high level of MDA induced by CCl4, which had made great interest since it provides additional evidence to show us an anti-liver fibrosis role of GA. That is consistent with the hypothesis that GA could reverse CCl4-induced liver fibrosis in mice by inhibiting the lipid peroxidation. But either inhibiting lipid peroxidation or upregulating the antioxidatiant enzymes activity in vivo was regulated by the NF-E2-related factor 2 (Nrf2). Nrf2, a structure of leucime zipper, is highly expressed on detoxification organs, such as liver and kidney [64]. Under normal conditions, Nrf2 is located in the cytoplasm where it forms an inactive complex with its repressor Kelch-like ECH2-associated protein [65]. Upon cell stimulation, Nrf2 dissociates from Keap 1, translocates into the nucleus where it binds to ARE, promotes the expression of Nrf2 target genes, and then increases the effect of antioxidative enzymes, such as CAT, SOD as well as GSH-Px [66]–[71], [73]. Therefore, upregulation of Nrf2 in nuclear can result in a reduction in the level of the reactive metabolites, and correspondingly, less tissue injury. In our study, immune blot analysis showed that the mice receiving CCl4 alone showed a dramatic down-regulation in Nrf2 protein level in both nuclear and cytoplasm which was reversed by GA treatment (Fig. 8 and Fig. 9). And it is showed that the level of Nrf2 expression is a good correlation with the treatment of GA against CCl4 induced liver fibrosis in mice. These results showed that the enhanced expression of Nrf2 in the nuclear transplantation by GA is consistent with the increase activities of antioxidant enzymes by GA in vivo. But the mechanisms of Nrf2 up-regulation by GA require further investigation. In this study, we hypothesized that the activation and upregulation of Nrf2 enhancing the target genes’ expression in mice plays an important role in enhancing antioxidative activity against liver fibrosis induced by CCl4 [73]–[74]. Gene’s expression studies are useful supplements to protein examinations, as the mRNA levels represent a snapshot of the cell activity at a given time. Nrf2 is also known to act as a mediator in CCl4-induced liver fibrosis by regulating relative gene of antioxidant enzymes expression. And in our study, SOD3 mRNA, CAT mRNA and GPX2 mRNA were chosen as the target genes of Nrf2 in protecting liver from fibrosis [16]–[18], [73], [74]. The SODs represent the major cellular defense system against superoxide radicals. In mammalian tissue, three isoforms of SODs have been identified: the cytoplasmic CuZnSOD (SOD1), the mitochondrial MnSOD (SOD2) and the extracellular SOD (EC-SOD or SOD3). There is reported that SOD1 and SOD2 genes didn’t decrease by the oxidative stress but the SOD3 gene, which is consistent with our study [75]. SOD3 is mainly secreted into the extracellular space, but a smaller proportion is also found in plasma and other extracellular fluids. It is the least studied enzyme, but recent data supports an important role for SOD3 in maintaining oxidative homeostasis in extracellular matrix and in nucleus as well [76]–[78]. And the disruption of the SOD3 gene in mice does not produce obvious pathologies under normal conditions, but these mice are more prone to environmental stressors. Moreover, very little is known about the regulation and potential of SOD3 in the prevention of CCl4-induced liver fibrosis. And there is a presence of an antioxidant responsive element (ARE) to Nrf2, which is the master regulator of the antioxidant response binds has been reported in 5′-untranslated region of SOD3 gene. This region is only in SOD3 promoter and not in SOD2 promoter region. [75], [79]. In our study, we have reported that GA can enhance the SOD3 gene expression, which is regulated by Nrf2 in the prevention of CCl4-induced liver fibrosis. This is the first direct evidence for the role of SOD3 in antioxidant-mediated prevention liver fibrosis and regulation of SOD3 through Nrf2 after the treatment of GA. Catalase is a 240,000 molecular weight tetrameric hemoprotein, which is located mainly in the peroxisomes, has reductive activity mainly for small molecules rather than lipid hydroperoxide products of lipid peroxidation [80]. CAT catalyzes the reduction of H2O2 to water (H2O) and oxygen (O2) under the regulation of Nrf2 [81]. During our study, CAT enzymes’ activity is consistent with the expression of CAT mRNA in livers. Hence, GA protects liver from highly reactive hydroxyl radical (•OH) derived from H2O2 by upregulating Nrf2, enhancing its target gene-CAT expression and increasing the activity of CAT enzyme. GPXs, a family of selenium-dependent glutathione peroxides, contain five members. GPX2, which is responsible for glutathione-dependent hydrogen peroxide-reducing activity in the epithelium of the gastrointestinal tract, was first described in 1993 as a novel isoenzyme exclusively expressed in the gastrointestinal tract. GPX2 is the same with other glutathione peroxidases in some function. It reduces fatty acid hydroperoxides and, due to its expression in the intestinal epithelium, has been suggested to function as a barrier against hydroperoxide absorption [82]–[85]. As reported, GPX2 gene as an unorthodox target for Nrf2 is regulated by Nrf2, which canonically responds to antioxidants [85]. Intrigued by this corollary, we analyzed whether the enhancing expression of GPX2 of GA is regulated by the Nrf2/Keap1 system and we can see that the expression of GPX2 can be inhibited by the regulated of Nrf2 in the livers administrated by CCl4. But GA can reverse it to some extent. In addition, GA has an obvious antioxidative activity in vitro. In vitro, lipid peroxidation in liver homogenate can proceed in a nonenzymatic way. The process is induced by ascorbate in the presence of Fe2+/3+. Furthermore, it has been reported that, Fe2+ and ascorbic acid stimulated lipid peroxidation in rat liver microsome and mitochondria [36]. In vitro lipid peroxidation experiments were carried out to clarify the mode of GA action. According to the results obtained, GA inhibited FeCl2-ascorbic acid-stimulated lipid peroxidation in liver homogenate and made it presence of a dose-dependence (Fig. 11A). And these results showed that GA exercised powerful free radical scavenging activity on the DPPH free radical generated using the DPPH• assay (Fig. 11B), and acted by scavenging free radicals and oxygen species formed during the CCl4 metabolism. These results are consistent with the previous reports showing that GA is an oxygen free radical scavenger. Active oxygen species and free radicals are the code epidemic factor of liver fibrosis. GA with antioxidant properties might contribute towards the partial or total alleviation of this damage [72]. All together, the results in this study were summarized in the scheme of Fig. 12. It demonstrated that GA has hepatoprotective action upon CCl4-induced chronic liver fibrosis in mice. These results show that the treatment effect of GA may be due to its ability to promote Nrf2 nuclear transcription and enhance the Nrf2 target genes’ expression, then inducing the MDA content and oxidases (GOT/GPT/MAO) activity decreased, the anti-oxidases (SOD/CAT/GSH-Px) activity increased toward the formation of trichloromethyl radicals that are capable of inducing liver fibrosis.
Figure 12

Potential mechanisms for anti-fibrosis mechanism of GA against CCl4-induced liver fibrosis in mice.

  69 in total

Review 1.  The Nrf2-Keap1 defence pathway: role in protection against drug-induced toxicity.

Authors:  Ian M Copple; Christopher E Goldring; Neil R Kitteringham; B Kevin Park
Journal:  Toxicology       Date:  2007-11-12       Impact factor: 4.221

Review 2.  Free-radical mechanisms in tissue injury.

Authors:  T F Slater
Journal:  Biochem J       Date:  1984-08-15       Impact factor: 3.857

Review 3.  Reactive oxygen and nitrogen species in Alzheimer's disease.

Authors:  Mutay Aslan; Tomris Ozben
Journal:  Curr Alzheimer Res       Date:  2004-05       Impact factor: 3.498

4.  Synthesis and in vitro antioxidant activity of glycyrrhetinic acid derivatives tested with the cytochrome P450/NADPH system.

Authors:  Mourboul Ablise; Brigitte Leininger-Muller; Choi Dal Wong; Gérard Siest; Vincent Loppinet; Sophie Visvikis
Journal:  Chem Pharm Bull (Tokyo)       Date:  2004-12       Impact factor: 1.645

5.  Turnover of extracellular-superoxide dismutase in tissues.

Authors:  K Karlsson; J Sandström; A Edlund; S L Marklund
Journal:  Lab Invest       Date:  1994-05       Impact factor: 5.662

6.  Polymeric black tea polyphenols induce phase II enzymes via Nrf2 in mouse liver and lungs.

Authors:  Rachana Patel; Girish Maru
Journal:  Free Radic Biol Med       Date:  2008-02-21       Impact factor: 7.376

7.  Increased procollagen mRNA levels in carbon tetrachloride-induced liver fibrosis in rats.

Authors:  R A Pierce; M R Glaug; R S Greco; J W Mackenzie; C D Boyd; S B Deak
Journal:  J Biol Chem       Date:  1987-02-05       Impact factor: 5.157

8.  Human copper-containing superoxide dismutase of high molecular weight.

Authors:  S L Marklund
Journal:  Proc Natl Acad Sci U S A       Date:  1982-12       Impact factor: 11.205

9.  Protective effects of Pycnogenol on carbon tetrachloride-induced hepatotoxicity in Sprague-Dawley rats.

Authors:  Young-Su Yang; Tai-Hwan Ahn; Jong-Chan Lee; Chang-Jong Moon; Sung-Ho Kim; Woojin Jun; Seung-Chun Park; Hyoung-Chin Kim; Jong-Choon Kim
Journal:  Food Chem Toxicol       Date:  2007-08-21       Impact factor: 6.023

Review 10.  Oxidative stress and redox signaling mechanisms of alcoholic liver disease: updated experimental and clinical evidence.

Authors:  Hong Zhu; Zhenquan Jia; Hara Misra; Y Robert Li
Journal:  J Dig Dis       Date:  2012-03       Impact factor: 3.366

View more
  43 in total

1.  18β-Glycyrrhetinic acid protects against alpha-naphthylisothiocyanate-induced cholestasis through activation of the Sirt1/FXR signaling pathway.

Authors:  Shou-Yan Wu; Shi-Chao Cui; Le Wang; Yi-Ting Zhang; Xiao-Xia Yan; Heng-Lei Lu; Guo-Zhen Xing; Jin Ren; Li-Kun Gong
Journal:  Acta Pharmacol Sin       Date:  2018-07-30       Impact factor: 6.150

2.  Dibenzoylmethane Protects Against CCl4-Induced Acute Liver Injury by Activating Nrf2 via JNK, AMPK, and Calcium Signaling.

Authors:  Mingnan Cao; Huixia Wang; Limei Guo; Simin Yang; Chun Liu; Tin Oo Khor; Siwang Yu; Ah-Ng Kong
Journal:  AAPS J       Date:  2017-08-21       Impact factor: 4.009

Review 3.  Role of Nrf2 in chronic liver disease.

Authors:  Wei Tang; Yong-Fang Jiang; Murugavel Ponnusamy; Mamadou Diallo
Journal:  World J Gastroenterol       Date:  2014-09-28       Impact factor: 5.742

4.  San-Cao Granule () Ameliorates Hepatic Fibrosis through High Mobility Group Box-1 Protein/Smad Signaling Pathway.

Authors:  Shi-Zhang Wei; Sheng-Qiang Luo; Jian Wang; Jia-Bo Wang; Rui-Sheng Li; Xiao-Mei Zhang; Yan-Lei Guo; Chang Chen; Xiao Ma; Zhe Chen; Hong-Hong Liu; Zhi-Rui Yang; Jian-Yu Li; Rui-Lin Wang; Ya-Ming Zhang; Hui-Yin Yang; Xiao-He Xiao; Yan-Ling Zhao
Journal:  Chin J Integr Med       Date:  2015-12-19       Impact factor: 1.978

5.  Glycyrrhizin Protects against Acetaminophen-Induced Acute Liver Injury via Alleviating Tumor Necrosis Factor α-Mediated Apoptosis.

Authors:  Tingting Yan; Hong Wang; Min Zhao; Tomoki Yagai; Yingying Chai; Kristopher W Krausz; Cen Xie; Xuefang Cheng; Jun Zhang; Yuan Che; Feiyan Li; Yuzheng Wu; Chad N Brocker; Frank J Gonzalez; Guangji Wang; Haiping Hao
Journal:  Drug Metab Dispos       Date:  2016-03-10       Impact factor: 3.922

6.  18β-Glycyrrhetinic acid exerts protective effects against cyclophosphamide-induced hepatotoxicity: potential role of PPARγ and Nrf2 upregulation.

Authors:  Ayman M Mahmoud; Hussein S Al Dera
Journal:  Genes Nutr       Date:  2015-09-19       Impact factor: 5.523

7.  Upregulation of cannabinoid receptor-1 and fibrotic activation of mouse hepatic stellate cells during Schistosoma J. infection: role of NADPH oxidase.

Authors:  Mi Wang; Justine M Abais; Nan Meng; Yang Zhang; Joseph K Ritter; Pin-Lan Li; Wang-Xian Tang
Journal:  Free Radic Biol Med       Date:  2014-03-19       Impact factor: 7.376

8.  The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects.

Authors:  Sherifa S Hamed; Nouf A Al-Yhya; Manal F El-Khadragy; Ebtesam M Al-Olayan; Reem A Alajmi; Zeinab K Hassan; Salwa B Hassan; Ahmed E Abdel Moneim
Journal:  Front Physiol       Date:  2016-08-05       Impact factor: 4.566

9.  Effects of Glycyrrhetinic Acid on GSH Synthesis Induced by Realgar in the Mouse Hippocampus: Involvement of System [Formula: see text], System [Formula: see text], MRP-1, and Nrf2.

Authors:  Yan-Lei Wang; Mo Chen; Tao-Guang Huo; Ying-Hua Zhang; Ying Fang; Cong Feng; Shou-Yun Wang; Hong Jiang
Journal:  Mol Neurobiol       Date:  2016-04-02       Impact factor: 5.590

Review 10.  Nrf2 in liver toxicology.

Authors:  Keiko Taguchi; Thomas W Kensler
Journal:  Arch Pharm Res       Date:  2019-11-28       Impact factor: 4.946

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.