Literature DB >> 23320456

GATA4 and DcR1 methylation in glioblastomas.

Paulina Vaitkienė1, Daina Skiriutė, Kęstutis Skauminas, Arimantas Tamašauskas.   

Abstract

BACKGROUND: Epigenetic silencing of tumor suppressor genes plays important role in gliomagenesis. Recently, GATA4 and DcR1 were suggested to be a tumor suppressor genes involved in tumorigenesis in various types of human cancers. However, up to now the methylation frequency of GATA4 and DcR1 genes has not been determined in glioblastoma. In this study, we investigated methylation of GATA4 and DcR1 promoters and their association with patient prognosis in glioblastoma.
METHODS: Methylation status of GATA4 and DcR1 promoters was investigated by methylation specific PCR in 99 glioblastoma patients. Statistical analyses were conducted to investigate the association between clinical variables and overall survival time.
RESULTS: GATA4 and DcR1 were aberrantly methylated in 23.2% and 27.6% of glioblastoma tumors, but not in normal brain. GATA4 promoter hypermethylation showed significant association with patients age (p = 0.027). Relationship between genes promoter methylation and glioblastoma patient survival was not determined.
CONCLUSIONS: The present work demonstrated that GATA4 and DcR1 promoter hypermethylation is tumor specific event in glioblastoma but they promoter methylation cannot be considered as a prognostic marker of glioblastoma survival. VIRTUAL SLIDES: The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/1381170351801852.

Entities:  

Mesh:

Substances:

Year:  2013        PMID: 23320456      PMCID: PMC3599597          DOI: 10.1186/1746-1596-8-7

Source DB:  PubMed          Journal:  Diagn Pathol        ISSN: 1746-1596            Impact factor:   2.644


Background

Glioblastoma multiforme (GBM) is the most common and most aggressive malignant primary brain tumor in humans. Despite multimodality treatment, prognosis is poor, with a median survival time of approximately 14 months. Therefore looking for new markers which would help better diagnose and predict the course of glioblastoma is important. Understanding apoptosis in disease conditions is very important as it not only gives insights into the pathogenesis of a disease but may also leave clues on how the disease can be treated [1]. Apoptosis activation can be triggered either by engagement of cell surface “death receptors” or by cellular stress [2]. The proteins of Bcl-2 family are key regulators of the stress-induced apoptotic pathway [2]. Although, much is known about the pathways and mechanisms of apoptosis, but the significance of some genes is not fully clear. Our interests have focused on two genes GATA4 and DcR1, which are related to apoptosis. Both of these genes are located on chromosome 8p region. Despite 8p being a relatively small chromosome arm, it is one of the most frequently altered genomic regions in human cancer, and is also rich in candidate oncogenes and tumor suppressor genes associated with the development of certain types of cancers [3]. Deletions in this region are observed in glioblastoma [4]. As an alternative to deletion GATA4 and DcR1 promoter methylation may be associated with clinical data of glioblastoma patients. GATA4 is a member of the GATA family of zinc finger transcription factor, which regulates gene transcription by binding to GATA elements. GATA4 serves as a survival factor in cancer cells by regulating the expression of anti-apoptotic Bcl-2 and Bcl-x L [5]. Although GATA4 was expressed in normal brain, loss of GATA4 expression was observed in 57.6% (94/163) GBM operative samples and it was a negative survival prognostic marker [6]. According to these data was formed hypothesis that promoter methylation of GATA4 gene could be survival prognostic marker. The protein encoded by DcR1 gene is a member of the TNF-receptor superfamily. This receptor is not capable of inducing apoptosis, and is thought to function as an antagonistic receptor that protects cells from TRAIL-induced apoptosis. The expression of this gene was detected in many normal tissues but not in most cancer cell lines, which may explain the specific sensitivity of cancer cells to the apoptosis-inducing activity of TRAIL [7]. Methylation of DcR1 gene promoter was determined in 21% of low grade gliomas [8] suggesting its role in gliomagenesis. In this study, we evaluated the methylation status of GATA4 and DcR1 promoters in glioblastoma tumor tissue to support the hypothesis that they are inactivated in glioblastomas by promoter hypermethylation and plays a role as tumor suppressor genes in gliomagenesis.

Methods

Glioblastoma tumor tissue and normal brain

In total, 99 glioblastoma tumor samples from initial surgery were collected in Neurosurgery clinics of Hospital of Lithuanian University of Health Sciences (Kaunas, Lithuania) through 2003 to 2009 yr. Written patient consent under the approval of ethics committee of Lithuanian University of Health Sciences was obtained for every patient. Data base closure was in November 2010. Glioblastoma Multiforme WHO grade IV (Original SNOMED ID M-94403) diagnoses were established by experienced pathologists according to the World Health Organization (WHO) classification. We included Human brain DNA (Zymo Research, USA) as normal brain control. Glioblastoma samples were stored in liquid nitrogen before DNA extraction. The following clinical data were determined for each patient: age at the time of the operation, gender, tumor multifocality, time of the last follow-up and patient status. Survival time was collected for all cases and overall survival calculated from the date of the operation to death, or last contact to the live patients.

DNA isolation and bisulfate modification

Tumor DNA was extracted from 25-40 mg of frozen tissue using ZR Genomic DNA™ Tissue MiniPrep (Zymo Research, USA) according to manufactures protocol. The methylation status of GATA4 and DcR1 promoters was determined by bisulfite treatment of DNA. 400 ng DNA was used for bisulfite modification. DNA modification was performed using EZ DNA Methylation Kit (Zymo Research, USA), and all procedures were done according to manufactures protocol. Bisulfite treated DNA was eluted in 40 μl distilled water, and stored in −80°C until MS-PCR.

Methylation-specific PCR

The methylation status of the GATA4 and DcR1 promoters region was determined by methylation-specific PCR. Primers distinguishing unmethylated (U) and methylated (M) alleles were taken from articles [9,10] are shown as follows in Table 1.
Table 1

Primers for MSP

GeneForward primer 5-3Reverse primer 5-3Tm,°C
GATA4-M
GTATAGTTTCGTAGTTTGCGTTTAGC
AACTCGCGACTCGAATCCCCG
62
GATA4-U
TTTGTATAGTTTTGTAGTTTGTGTTTAGT
CCCAACTCACAACTCAAATCCCCA
62
DcR1-M
TTACGCGTACGAATTTAGTTAAC
TCAACGACCGACCGAAACG
60
DcR1-UGAATTTTTTTATGTGTATGAATTTAGTTAATCCATCAAACAACCAAAACA60

M – methylated, U – unmethylated, Tm – melting temperature.

Primers for MSP M – methylated, U – unmethylated, Tm – melting temperature. Each PCR reaction contained 20 ng of sodium bisulphite-modified DNA. MSP reaction was performed in 20 μl of total volume, using 10 μl Maxima® Hot Start PCR Master Mix (Thermo fisher Scientific, USA) with Hot start Taq DNA polymerase and 10pmol of each primer (Metabion International AG, Germany). Cycling conditions were initial denaturation at 95°C for 5 min, 38 cycles of 94°C for 30 s, 60/62°C for 1 min and 72°C for 1 min and final step at 72°C for 5 min. For each set of methylation specific PCR reactions human blood lymphocyte DNA treated with bisulfite served as a unmethylated DNA control and as positive methylation control was used ‘Bisulfite Converted Universal Methylated Human DNA Standard’ (Zymo Research, USA). A water blank control was also included. PCR products were separated on 2% agarose gels with ethidium bromide and visualized under UV illumination. PCR analyses were repeated.

Statistical analysis

SPSS Statistics 19 (SPSS Inc., Chicago, IL) software package was used for statistical analysis. The quantitative data presented as median and to show the reliability of the estimate, the confidence interval (CI) with 95% confidence level was presented. Association between gene methylation data and clinical features of glioblastoma patients were evaluated by using Fisher exact test. To estimate survival functions Kaplan-Meier method was used. For comparing survival time distribution between groups the log-rank test was used. A p < 0.05 was considered significant.

Results

Characteristics of glioblastoma patients

The median age at diagnosis was 61.0 yr. (CI: 57.3-64.7). The male to female ratio was: 1:1.3. The median age of males (n = 42) was 58.0 yr. (CI: 52.1-63.9) and females (n = 57) 61.0 yr. (CI: 56.9-65.1). Median survival time of glioblastoma patients (n = 99) was 8.9 months (CI: 6.9-10.8). Most of glioblastoma patients (64%) survived less than 12 months after operation.

GATA4 and DcR1 promoters are methylated in glioblastoma

The methylation status of the GATA4 and DcR1 promoter in glioblastoma samples was detected by methylation-specific PCR assay. We evaluated methylation status of the GATA4 promoter in 95 glioblastoma tumors. Promoter hypermethylation was detected in 23.2% (22/95) of the glioblastoma but not in normal brain. Representative samples are shown in Figure 1. The same studies were performed with DcR1 gene promoter in 98 glioblastoma samples. DcR1 gene promoter hypermethylation was detected in 27.6% (27/98) of the glioblastoma tumors but not in normal brain.
Figure 1

Analysis of and in glioblastoma; Analysis of (A) and (B) CpG island promoter methylation status in glioblastoma by the methylation-specific PCR assay. Molecular weight markers are shown in the left, mDNA- methylated DNA control, uDNA-unmethylated DNA control, W- water control, GB1-GB14 glioblastoma tumor samples, NB normal brain sample. The presence of visible PCR products in those lanes marked “U” indicates the presence of unmethylated allele genes and “M” indicates the presence of methylated genes. Kaplan-Meier cumulative survival (months) in glioblastoma patients according to methylation status of (C) GATA4 (log-rank test, p = 0.15) and (D) DcR1 (log-rank test, p = 0.546).

Analysis of and in glioblastoma; Analysis of (A) and (B) CpG island promoter methylation status in glioblastoma by the methylation-specific PCR assay. Molecular weight markers are shown in the left, mDNA- methylated DNA control, uDNA-unmethylated DNA control, W- water control, GB1-GB14 glioblastoma tumor samples, NB normal brain sample. The presence of visible PCR products in those lanes marked “U” indicates the presence of unmethylated allele genes and “M” indicates the presence of methylated genes. Kaplan-Meier cumulative survival (months) in glioblastoma patients according to methylation status of (C) GATA4 (log-rank test, p = 0.15) and (D) DcR1 (log-rank test, p = 0.546). The detection of bands with both primer sets were found in some but not all of the glioblastoma samples likely because of the existence of non-malignant cells in a fraction of the samples or that only one allele of the gene is methylated. Among 22 GATA4-methylated cases, five patients (23%) were younger than 60 years and 17 individuals (77%) were older than 60 years. There is significant difference in gene methylation ratio between age groups (Fisher’s Exact test 2-sided, p = 0.027; Table 2) and this means that GATA4 methylation is related to age. Meanwhile, the interface between the DcR1 promoter methylation status and age is unspecified. No dependences were found between GATA4 and DcR1 promoter methylation and two-year survival time. These genes promoter methylation was not significantly associated with gender or tumor multifocality too (Table 2). In no one of multifocal glioblastomas DcR1 promoter methylation was observed. Maybe the study of a large number of samples could show that DcR1 is an important marker. We analyzed GATA4 and DcR1 promoter methylation for prognostic value of overall survival (OS) using Kaplan-Meier Curves (p values were generated using the log-rank test) (Figure 1C, D). Analysis showed no association between GATA4 and DcR1 gene promoter methylation and survival in glioblastomas.
Table 2

and promoter methylation in human glioblastoma tissue with different clinicopathological features

VariablesGATA4
Statistic significanceDcR1
Statistic significance
MethylatedUnmethylatedMethylatedUnmethylated
Overall
22
73
 
27
71
 
Age (years)
 
 
0.027
 
 
1.000
<60 years
5
37
 
12
32
 
≥60 years
17
36
 
15
39
 
Gender
 
 
0.473
 
 
0.263
Male
11
30
 
9
33
 
Female
11
43
 
18
38
 
Multifocal
 
 
1.000
 
 
0.185
Yes
2
5
 
0
7
 
No
20
68
 
27
64
 
Survival (months)
 
 
0.227
 
 
1.000
<24
20
57
 
22
57
 
≥24
2
16
 
5
14
 
DcR1
 
 
0.185
 
 
-
Methylated
9
18
 
-
-
 
Unmethylated1353    
and promoter methylation in human glioblastoma tissue with different clinicopathological features

Discussion

Understanding of the molecular alterations that occur during tumorigenesis, and identification of novel markers for cancer diagnosis and novel targets for treatment, may be important for the improvements in tumor diagnosis, treatment and prevention [11]. The most common molecular alterations, that characterize glioblastomas and could be used in current clinical practice and therapeutic decision making, are proliferation markers (Ki-67/MIB-1 and phospho-histone-H3 (PHH3)), mutations involving isocitrate dehydrogenase (IDH1 and IDH2) and TP53, also 1p/19q deletion, mutations of Epidermal growth factor receptor (EGFR), O-6-methylguanine-DNA methyltransferase (MGMT) promoter methylation status and glioma-CpG island methylator phenotype [12-14]. Despite extensive efforts at defining biological markers, therapeutic progress for glioblastoma is slow. A further understanding of glioma biology, in concert with well-designed clinical trials, is necessary to identify more putative molecular biomarkers and unravel the mysteries in the pathogenic mechanisms that trigger this menacing disease [12]. The identification of methylated genes in cancer may provide an insight in the molecular mechanisms of tumor development and might reveal new tools to define markers of prognostic significance [15]. In order to identify molecular markers relevant to glioblastoma development, diagnosis and prognosis promoter methylation analysis of 2 genes, DcR1 and GATA4, was performed. Loss of GATA4 expression due to promoter hypermethylation has been reported in primary colorectal, gastric, esophageal, lung and ovarian cancer [10,16]. To analyze the potential of GATA4 as methylation marker in glioblastoma, we analyzed large series of glioblastoma tumor samples and one normal brain tissue. Were showed that methylation of GATA4 (23.2%) occurs not at so high frequencies in glioblastoma as in colorectal cancer (70%) [10] or sporadic gastric carcinomas (53.8%) [10]. Loss of GATA4 was observed in about 57.7% GBM operative samples [6]. In our study GATA4 methylation was detected only in 23.2% of cases, and this may suggest that the GATA4 expression is regulated by different mechanisms or mutation. This could explain the lack of links between GATA4 promoter methylation and survival (p = 0.15) in our study contrary to results obtained in Agnihotri et al. (2011) expression studies [6]. A tumor necrosis factor receptor or death receptor family members were found frequently methylated in glioblastoma: TNFRSF10D promoter methylated in 100% [8], and TNFRSF10A in 68% [11] of glioblastomas. Methylation of DcR1 gene promoter was determined in 21% of low grade gliomas (LGGs; World Health Organization [WHO] grade II) [8]. There is not much data about DcR1 promoter methylation in glioblastoma. Martinez et al. (2007) in 16 glioblastoma patients did not found methylation of DcR1 promoter [17]. We have assumed that in glioblastomas this percentage should be much higher. Our research has established that methylation of DcR1 was in 27.6% of glioblastoma samples, but not in the normal brain DNA, which implied that epigenetic silencing of the DcR1 might be involved in gliomagenesis. This number is close to 37% in lung cancer cell lines or 30.7% in ovarian tumors and is very different from 78.0% methylation in prostate cancer [18-20]. These findings suggest that the prognostic value of promoter hypermethylation of DcR1 could be tissue-specific. The study of gene methylation impact on survival found that the methylation is not associated with survival (p = 0.54). Although promoter hypermethylation of GATA4 and DcR1 genes were found in glioblastoma, they were not associated with patient sex or tumor multifocality in our series. Meanwhile, it was found that GATA4 methylation is related to age (p = 0.027).

Conclusion

In conclusion, the present work demonstrated that GATA4 and DcR1 promoter hypermethylation is tumor specific event in glioblastoma but they promoter methylation cannot be considered as a prognostic marker in glioblastoma.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

PV did all gene methylation analysis, generated the main idea of the article, did all statistical analysis and wrote the manuscript. DS did DNA extraction and DNA bisulfite modification and contributed to statistical analysis. KS and AT gathered patient tumor sample and clinical data, supervised the project. All authors read and approved the article.
  19 in total

1.  Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis.

Authors:  Julien Laffaire; Sibille Everhard; Ahmed Idbaih; Emmanuelle Crinière; Yannick Marie; Aurelien de Reyniès; Renaud Schiappa; Karima Mokhtari; Khê Hoang-Xuan; Marc Sanson; Jean-Yves Delattre; Joëlle Thillet; François Ducray
Journal:  Neuro Oncol       Date:  2010-10-05       Impact factor: 12.300

2.  CpG island promoter hypermethylation of the pro-apoptotic gene caspase-8 is a common hallmark of relapsed glioblastoma multiforme.

Authors:  Ramon Martinez; Fernando Setien; Christiane Voelter; Sara Casado; Maria P Quesada; Gabriele Schackert; Manel Esteller
Journal:  Carcinogenesis       Date:  2007-02-01       Impact factor: 4.944

3.  CpG island methylation of DNA damage response genes in advanced ovarian cancer.

Authors:  Jens M Teodoridis; Jacqueline Hall; Sharon Marsh; Hilary D Kannall; Catriona Smyth; Jorge Curto; Nadeem Siddiqui; Hani Gabra; Howard L McLeod; Gordon Strathdee; Robert Brown
Journal:  Cancer Res       Date:  2005-10-01       Impact factor: 12.701

4.  Patients with high-grade gliomas harboring deletions of chromosomes 9p and 10q benefit from temozolomide treatment.

Authors:  Silke Wemmert; Ralf Ketter; Jörg Rahnenführer; Niko Beerenwinkel; Martin Strowitzki; Wolfgang Feiden; Christian Hartmann; Thomas Lengauer; Florian Stockhammer; Klaus D Zang; Eckart Meese; Wolf-Ingo Steudel; Andreas von Deimling; Steffi Urbschat
Journal:  Neoplasia       Date:  2005-10       Impact factor: 5.715

5.  Methylation of apoptosis related genes in the pathogenesis and prognosis of prostate cancer.

Authors:  Makoto Suzuki; Hisayuki Shigematsu; Narayan Shivapurkar; Jyotsna Reddy; Kuniharu Miyajima; Takao Takahashi; Adi F Gazdar; Eugene P Frenkel
Journal:  Cancer Lett       Date:  2006-02-03       Impact factor: 8.679

6.  Promoter methylation of cancer-related genes in gastric carcinoma.

Authors:  T Poplawski; K Tomaszewska; M Galicki; Z Morawiec; J Blasiak
Journal:  Exp Oncol       Date:  2008-06

Review 7.  Chromosome 8p as a potential hub for developmental neuropsychiatric disorders: implications for schizophrenia, autism and cancer.

Authors:  R Tabarés-Seisdedos; J L R Rubenstein
Journal:  Mol Psychiatry       Date:  2009-02-10       Impact factor: 15.992

8.  Aberrant methylation of trail decoy receptor genes is frequent in multiple tumor types.

Authors:  Narayan Shivapurkar; Shinichi Toyooka; Kiyomi O Toyooka; Jyotsna Reddy; Kuniharu Miyajima; Makoto Suzuki; Hisayuki Shigematsu; Takao Takahashi; Gunjan Parikh; Harvey I Pass; Preet M Chaudhary; Adi F Gazdar
Journal:  Int J Cancer       Date:  2004-05-01       Impact factor: 7.396

9.  Genetic and epigenetic inactivation of TNFRSF10C in human prostate cancer.

Authors:  Yu Cheng; Jin Woo Kim; Wennuan Liu; Thomas A Dunn; Jun Luo; Matthew J Loza; Seong-Tae Kim; Siqun Lilly Zheng; Jianfeng Xu; William B Isaacs; Bao-Li Chang
Journal:  Prostate       Date:  2009-02-15       Impact factor: 4.104

10.  GATA4 and GATA5 are potential tumor suppressors and biomarkers in colorectal cancer.

Authors:  Debby M E I Hellebrekers; Marjolein H F M Lentjes; Sandra M van den Bosch; Veerle Melotte; Kim A D Wouters; Kathleen L J Daenen; Kim M Smits; Yoshimitsu Akiyama; Yasuhito Yuasa; Silvia Sanduleanu; Carolina A J Khalid-de Bakker; Daisy Jonkers; Matty P Weijenberg; Joost Louwagie; Wim van Criekinge; Beatriz Carvalho; Gerrit A Meijer; Stephen B Baylin; James G Herman; Adriaan P de Bruïne; Manon van Engeland
Journal:  Clin Cancer Res       Date:  2009-06-09       Impact factor: 12.531

View more
  7 in total

1.  Regulatory Network of PD1 Signaling Is Associated with Prognosis in Glioblastoma Multiforme.

Authors:  Camila M Lopes-Ramos; Tatiana Belova; Tess H Brunner; Marouen Ben Guebila; Daniel Osorio; John Quackenbush; Marieke L Kuijjer
Journal:  Cancer Res       Date:  2021-09-07       Impact factor: 12.701

Review 2.  DNA Methylation and Hydroxymethylation in Cervical Cancer: Diagnosis, Prognosis and Treatment.

Authors:  Hongming Zhu; He Zhu; Miao Tian; Dongying Wang; Jiaxing He; Tianmin Xu
Journal:  Front Genet       Date:  2020-04-09       Impact factor: 4.599

3.  Integrative analysis identifies an immune-relevant epigenetic signature for prognostication of non-G-CIMP glioblastomas.

Authors:  Anan Yin; Zhende Shang; Amandine Etcheverry; Yalong He; Marc Aubry; Nan Lu; Yuhe Liu; Jean Mosser; Wei Lin; Xiang Zhang; Yu Dong
Journal:  Oncoimmunology       Date:  2021-03-29       Impact factor: 8.110

4.  Cellular localization of protein arginine methyltransferase-5 correlates with grade of lung tumors.

Authors:  Konstantin Shilo; Xin Wu; Smita Sharma; Meng Welliver; Wenrui Duan; Miguel Villalona-Calero; Junya Fukuoka; Said Sif; Robert Baiocchi; Charles L Hitchcock; Weiqiang Zhao; Gregory A Otterson
Journal:  Diagn Pathol       Date:  2013-12-10       Impact factor: 2.644

5.  DNA methylation status of NKX2-5, GATA4 and HAND1 in patients with tetralogy of fallot.

Authors:  Wei Sheng; Yanyan Qian; Huijun Wang; Xiaojing Ma; Ping Zhang; Lianwei Diao; Quan An; Long Chen; Duan Ma; Guoying Huang
Journal:  BMC Med Genomics       Date:  2013-11-01       Impact factor: 3.063

6.  Hypermethylation of the GATA binding protein 4 (GATA4) promoter in Chinese pediatric acute myeloid leukemia.

Authors:  Yan-Fang Tao; Fang Fang; Shao-Yan Hu; Jun Lu; Lan Cao; Wen-Li Zhao; Pei-Fang Xiao; Zhi-Heng Li; Na-Na Wang; Li-Xiao Xu; Xiao-Juan Du; Li-Chao Sun; Yan-Hong Li; Yi-Ping Li; Yun-Yun Xu; Jian Ni; Jian Wang; Xing Feng; Jian Pan
Journal:  BMC Cancer       Date:  2015-10-21       Impact factor: 4.430

7.  TNFRSF10C methylation is a new epigenetic biomarker for colorectal cancer.

Authors:  Cong Zhou; Ranran Pan; Haochang Hu; Bin Li; Jie Dai; Xiuru Ying; Hang Yu; Jie Zhong; Yiyi Mao; Yihan Zhang; Dongping Wu; Shiwei Duan
Journal:  PeerJ       Date:  2018-09-13       Impact factor: 2.984

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.