Literature DB >> 23240045

Carriage of stx2a differentiates clinical and bovine-biased strains of Escherichia coli O157.

Smriti Shringi1, Carrie Schmidt, Kaya Katherine, Kelly A Brayton, Dale D Hancock, Thomas E Besser.   

Abstract

BACKGROUND: Shiga toxin (Stx) are cardinal virulence factors of enterohemorrhagic E. coli O157:H7 (EHEC O157). The gene content and genomic insertion sites of Stx-associated bacteriophages differentiate clinical genotypes of EHEC O157 (CG, typical of clinical isolates) from bovine-biased genotypes (BBG, rarely identified among clinical isolates). This project was designed to identify bacteriophage-mediated differences that may affect the virulence of CG and BBG.
METHODS: Stx-associated bacteriophage differences were identified by whole genome optical scans and characterized among >400 EHEC O157 clinical and cattle isolates by PCR.
RESULTS: Optical restriction maps of BBG strains consistently differed from those of CG strains only in the chromosomal insertion sites of Stx2-associated bacteriophages. Multiplex PCRs (stx1, stx2a, and stx2c as well as Stx-associated bacteriophage-chromosomal insertion site junctions) revealed four CG and three BBG that accounted for >90% of isolates. All BBG contained stx2c and Stx2c-associated bacteriophage-sbcB junctions. All CG contained stx2a and Stx2a-associated bacteriophage junctions in wrbA or argW.
CONCLUSIONS: Presence or absence of stx2a (or another product encoded by the Stx2a-associated bacteriophage) is a parsimonious explanation for differential virulence of BBG and CG, as reflected in the distributions of these genotypes in humans and in the cattle reservoir.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23240045      PMCID: PMC3519850          DOI: 10.1371/journal.pone.0051572

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Enterohemorrhagic E. coli O157:H7 (EHEC O157) is an important cause of food- and water-borne illnesses in developed nations. Diseases associated with EHEC O157 infections include hemorrhagic colitis (HC) and the hemolytic uremic syndrome (HUS) [1]. HUS following EHEC O157 infection is associated with 3% to 5% mortality [2]. Cattle are a major reservoir of EHEC O157 and consumption of contaminated bovine-origin foods is frequently linked to EHEC O157 outbreaks [3], [4]. Shiga toxin (Stx) expression is an important virulence factor of EHEC O157. Stx are encoded in late genes of lambdoid bacteriophages; specific bacteriophages, associated with specific Stx variants, are typically inserted at one or two preferred chromosomal locations. Bacteriophages play a major role in generating genetic diversity in the EHEC O157 genome [5], [6], [7], [8], [9], [10], [11], [12], [13]. Molecular epidemiological studies using Stx-associated bacteriophage insertion (SBI) sites for strain differentiation have shown that EHEC O157 can be classified into several genotypes [5], [10], [14]. Bovine-biased genotypes (BBG) are significantly over-represented among cattle isolates compared to clinical isolates, whereas clinical genotypes (CG) are typical of clinical isolates and are also frequently isolated from cattle [15], [16]. Other genotyping methods also demonstrate a similar bias in distribution of EHEC O157 lineages/clades among cattle and human host [6], [8], [12]. Both BBG and CG usually carry both EHEC O157 cardinal virulence factors: production of one or more Stx and expression of the Locus of Enterocyte Effacement (LEE) pathogenicity island required for intestinal colonization [1], [17]. The pronounced differences in their frequency of isolation from human disease and from cattle suggest that BBG may have reduced virulence. This possibility was supported by the recent demonstration that CG strains cause more severe clinical signs, more severe histopathologic lesions, and higher mortality than BBG strains in two animal models of human disease [15]. We hypothesize that specific bacteriophage-associated genetic factors underlie the differential virulence of CG and BBG EHEC O157. To test this hypothesis, we: 1) identified consistent bacteriophage-mediated genetic differences associated with four BBG and three CG strains using optical mapping; 2) developed a 12-plex PCR to efficiently SBI genotype EHEC O157 isolates and formatted a biologically relevant SBI genotype nomenclature; and 3) applied SBI typing to evaluate the consistency of the genetic differences discovered in the optically mapped strains in approximately 200 additional isolates each from cattle and human clinical sources. The presence of specific stx2 variants and/or their associated bacteriophages were strongly associated with specific SBI genotypes and with their relative frequency of isolation from human illness and cattle reservoir.

Materials and Methods

Bacterial Strains

For optical mapping, seven EHEC O157 strains representing the four most common SBI genotypes (one isolate CG-1 and two isolates each CG-3, BBG-5 and BBG-6) isolated from cattle and banked at the Field Disease Investigation Unit at Washington State University [5] were selected by random number table (Table 1). An additional larger set of EHEC O157 strains were randomly selected from the strain bank, stratified to include no more than one isolate per cattle farm per calendar year, for comparison with the optically mapped strains. The bovine isolates included 227 EHEC O157 isolates from four countries including Canada, Japan, Scotland and several states within the USA (WA, OR, ID, CO, AZ, TX, KS, MN, SD, IA, NE, PA, and NY) obtained in field research studies conducted between 1991 and 2010. Human isolates (n = 192), kindly provided by the Washington State Department of Health, included 40–45 isolates randomly selected from among reported cases for each year from 2006 through 2009, and all 19 isolates available from 2010 at the time this study was initiated. Each isolate was confirmed as EHEC O157 by PCR detection of eae and flic by PCR [18], [19], [20] and latex agglutination detection of O157 antigen (E. coli PRO O157, Hardy Diagnostics, USA).
Table 1

Summary of genetic differences among three clinical genotypes (CG) and four bovine-biased genotypes (BBG) of EHEC O157 identified using optical mapping technology.

Total number of genetic rearrangementsc
StrainSBI Genotypea Genome size (bp)b BamHI fragments (No.)InsertionsDeletionsRFLPOthers
E2325CG-1 (AY2)5,407,64147826241 Inv, 3 Sub
E5252CG-3 (WY12)5,376,9524880771 Sub
E3046CG-3 (WY12)5,486,71654010161 Inv, 1 Sub
E5880BBG-5 (SY2c)5,426,91553227122 Inv, 5 Sub
E3855BBG-5 (SY2c)5,390,209500510163 Sub
E2309BBG-6 (ASY12c)5,504,25251836111 Inv, 1 Tnv, 3 Sub
E6996BBG-6 (ASY12c)5,583,83555145184 Sub

Modified SBI genotype for each isolate is indicated in parenthesis. This shows the concatenation of presence of specific bacteriophage at argW, sbcB, wrbA or yehV locations designated by uppercase first letter of each insertion site (A, S, W or Y,) followed by the presence of stx1, stx2a or stx2c denoted by 1,2 or 2c.

Genome sizes predicted on the basis of optical maps of each strain.

Number of genetic rearrangements in comparison with strain Sakai (CG-3). Insertions = presence of additional restriction fragments; deletions = loss of RE fragments; RFLPs (restriction fragment length polymorphisms) = altered sizes and/or numbers of RE fragments; inversions (Inv) = RE fragments in reversed order; substitutions (Sub) = altered RE fragments; transversion (Tnv) = RE fragments in reversed order and in a different location.

Modified SBI genotype for each isolate is indicated in parenthesis. This shows the concatenation of presence of specific bacteriophage at argW, sbcB, wrbA or yehV locations designated by uppercase first letter of each insertion site (A, S, W or Y,) followed by the presence of stx1, stx2a or stx2c denoted by 1,2 or 2c. Genome sizes predicted on the basis of optical maps of each strain. Number of genetic rearrangements in comparison with strain Sakai (CG-3). Insertions = presence of additional restriction fragments; deletions = loss of RE fragments; RFLPs (restriction fragment length polymorphisms) = altered sizes and/or numbers of RE fragments; inversions (Inv) = RE fragments in reversed order; substitutions (Sub) = altered RE fragments; transversion (Tnv) = RE fragments in reversed order and in a different location.

Optical Mapping

Optical maps of seven EHEC O157 isolates were constructed and provided by OpGen technologies, Inc (Madison, WI, USA) using the procedure described previously [21], [22]. We compared the whole genome optical maps of each strain with the in silico BamHI restriction enzyme (RE) map of strain Sakai (BA000007) using Map Viewer software (OpGen). An inventory of genomic differences involving restriction fragments >2 kb (the resolution of the optical mapping technology) was prepared for each strain in comparison to the reference Sakai sequence[22].

Multiplex PCR Method for SBI Genotyping

To confirm the genetic differences between CG and BBG strains detected by optical mapping, a multiplex PCR was developed and standardized (Table 2). The PCR targets included were the left and right bacteriophage-bacterial backbone junctions of three different bacteriophages potentially inserted at four sites (yehV, wrbA, argW and sbcB) in the EHEC O157 genome, a previously identified variable bacteriophage-yehV right junction [5], [10], and stx1, stx2a, and stx2c. Each of the forward primers was 5′-labeled with a fluorescent dye (PET, 6-FAM VIC or NED) as indicated (Table 2). This multiplex PCR is capable of amplifying 16 different genetic regions; the twelve listed above and in addition the four intact chromosomal insertion sites.
Table 2

Oligonucleotide primers and amplified PCR products in the study.

PrimerDyeOligonucleotide sequences (5′-3′)TargetAmplicon (bp)Reference
2851-80PET GTGCTTGGGTCTTTTCTCTG Phage-sbcB left junction914 [26]
sbcB-R2None TCCAGGCGTAAGGATCGTAG This study
sbcB-FVIC GACAGCAGAAACAACGGATTTAAC Phage-sbcB right junction730This study
2851-82None CCAGCGTGGGATAAAAGAGAATC [26]
sbcB-FVIC GACAGCAGAAACAACGGATTTAAC sbcB insertion site406This study
sbcB-R2None TCCAGGCGTAAGGATCGTAG This study
F6FAM CACCGGAAGGACAATTCATC Phage-yehV left junction824 [10]
BNone AACAGATGTGTGGTGAGTGTCTG [10]
APET AAGTGGCGTTGCTTTGTGAT Phage-yehV right junction702 [10]
ENone GATGCACAATAGGCACTACGC [10]
APET AAGTGGCGTTGCTTTGTGAT Phage-yehV variant right junction295 [10]
E3None AGCGATACAGATCTCAACAC This study
APET AAGTGGCGTTGCTTTGTGAT yehV insertion site340 [10]
BNone AACAGATGTGTGGTGAGTGTCTG [10]
C6FAM AGGAAGGTACGCATTTGACC Phage-wrbA right junction592 [10]
GNone ATCGTTCGCAAGAATCACAA [10]
HPET CCGACCTTTGTACGGATGTAA Phage-wrbA left junction506/537 [10]
DNone CGAATCGCTACGGAATAGAGA [10]
C6FAM AGGAAGGTACGCATTTGACC wrbA insertion site314 [10]
DNone CGAATCGCTACGGAATAGAGA [10]
argW-AVIC CCGTAACGACATGAGCAACAAG Phage-argW right junction583This study
argW-BNone GCAGTATCACGCAGAGCTGAAG This study
argW-C6FAM GCATCTCACCGACGATAACA Phage-argW left junction462This study
argW-DNone AATTAGCCCTTAGGAGGGGC This study
argW-AVIC CCGTAACGACATGAGCAACAAG argW insertion site216This study
argW-DNone AATTAGCCCTTAGGAGGGGC This study
Stx1-2VIC CACAGACTGCTGCAGTGAGG Stx1475 [20]
Stx1-1None CAGTTAATGTGGTGGCGAAG [20]
stx2-1072FNED AGGATGACACATTTACAGTGAAGGTT Stx2a -specific126 [50]
stx2-1197RNone CACAGGTACTGGATTTGATTGTGAC [50]
stx2c-F858NED CGACAGGCCCGTTATAAAAA Stx2c -specific243This study
stx2c-R1100None GGCCACTTTTACTGTGAATGTATC [5]
The PCR reaction mixture included 1X PCR buffer, 0.05 U/ul of Platinum Taq DNA Polymerase (Invitrogen, USA), 2.4 mM MgCl2, 0.4 mM dNTP, 0.2 µM of each forward and reverse primers to amplify the junctions of 4 bacteriophages (A, B, C, D, E, F, G, H, argW-A, argW-B, argW-C, argW-D, sbcB-F, sbcB-R2, 2851-80, and 2851-82), 0.3 µM of each stx1-2 and stx1-1 to amplify stx1, 0.2 µM of each stx2-1072F and stx2-1197R to amplify stx2a, 0.1 µM of each stx2c-F858 and stx2c-R1100 to amplify stx2c, 0.12 µM of primer E3, and 1 µl of Chelex DNA extract supernatant as template. For DNA extraction, a colony of bacteria from a Columbia blood agar (Hardy diagnostics) was added and mixed with 200 µl of 5% Chelex 100 Resin (Bio-Rad), boiled for 10 min, and centrifuged at 13,000 rpm for 1 min. The PCR cycling conditions included initial denaturation at 95°C for 5 min followed by 35 cycles of 94°C for 30 sec, 58°C for 45 sec, and 72°C for 1 min 30 sec and a final extension at 72°C for 10 min. Strains E5880 (BBG-5), E10970 (CG-1) and Sakai (CG-3) were used as positive controls. The method used to differentiate stx2a and stx2c in the current study did not differentiate stx2c and stx2d-activatable. Therefore, we further tested all stx2c strains (n = 131) to detect possible presence of stx2d-activatable using one or both of the two subtyping methods [23], [24]. These analyses confirmed that no strains in this study carried stx2d-activatable. Additionally, two of the stx2c carrying strains, one each from human and cattle sources, carried an insertion sequence within stx2c coding region as demonstrated by partial DNA sequencing (data not shown).

Capillary Electrophoresis

For capillary electrophoresis, 2 µl of PCR product was mixed with 12.5 µl of Hi-Di formamide (Applied Biosystems, Foster City, CA) and 0.5 µl of Liz 1200 size standard (Applied Biosystems). The capillary electrophoresis was performed using ABI-3730 DNA analyzer at WSU Genomic Core. GeneMarker software (SoftGenetics, LLC, State College, PA, USA 16803) was used to identify the electropherogram peaks corresponding to each PCR product according to their molecular size and associated dye colors.

Statistical Analysis

Association of the Stx-associated bacteriophage and stx2 gene variant content with the bovine-biased and clinical genotypes of EHEC O157 was analyzed using the Fisher’s exact test.

Results

A total of 112 polymorphisms were identified in the optical scan restriction maps of seven representative SBI genotype strains compared to the in silico BamHI restriction map of the genome sequence of Sakai (Table 1 and Table S1). Of these polymorphisms, 32 unique to one or more CG strains (and therefore uninformative about BBG - CG strain differences) were not further investigated. Of remaining 80 polymorphisms, 30 affected one or more strains belonging to both CG and BBG, while 50 were unique to one or more BBG strains. Only one polymorphism differentiated all BBG strains from all CG strains, an insertion detected in BBG strains but absent in CG strains (Table 3). This ∼60 kbp insertion affected BamHI RE fragments 334–335 of Sakai strain (2,740,136–2,803,536 bp), a region that includes sbcB, an alternative Stx2c-associated bacteriophage insertion site, suggesting the presence of this phage in BBG strains [9], [25], [26]. This was confirmed when PCR (Table 2) on the optically mapped strains amplified Stx2c-associated bacteriophage sequences adjacent to sbcB sequences in all four BBG strains (Table 3 and Figure S1). In contrast, optically mapped CG strains lacked this insertion and amplified PCR products consistent with an intact sbcB locus.
Table 3

Selected BBG polymorphisms in comparison to reference strain Sakai (CG-3).

Sakai straina
Start Location (bp)End Location (bp)FragmentFeaturesb BBG strainsc PolymorphismSize (bp)Stx-associated bacteriophaged
2,740,1362,803,536334–335SpLE2 (sbcB)1,2,3,4Insertion∼60,000Stx2c
3,172,8593,198,717377–380Sp16 (argW)3Insertion48,365Stx2a
3,198,7173,219,331381–382SP16 (argW)4Insertion58,185Stx2a
1,246,7501,310,488142–151Sp51,2,3,4Deletion63,738Stx2a
2,912,1202,943,884347–349Sp151RFLP3,718Stx1
2,912,1202,943,884347–349Sp152Substitution13,840Stx1

Sakai strain (CG-3) chromosomal location, in silico BamHI fragments, and features present in the polymorphic region.

Genes cited are known Stx-associated bacteriophage insertion sites. In Sakai, Sp5 is the Stx2-associated bacteriophage inserted in wrbA and Sp15 is the Stx1-associated bacteriophage inserted in yehV; Sp = Sakai prophage; SpLE = Sakai prophage like elements.

BBG isolate(s) in which the polymorphism was detected; 1: E5880; 2: E3855; 3: E2039; 4: E6996.

Stx-associated bacteriophage potentially involved in polymorphism based on optical maps.

Sakai strain (CG-3) chromosomal location, in silico BamHI fragments, and features present in the polymorphic region. Genes cited are known Stx-associated bacteriophage insertion sites. In Sakai, Sp5 is the Stx2-associated bacteriophage inserted in wrbA and Sp15 is the Stx1-associated bacteriophage inserted in yehV; Sp = Sakai prophage; SpLE = Sakai prophage like elements. BBG isolate(s) in which the polymorphism was detected; 1: E5880; 2: E3855; 3: E2039; 4: E6996. Stx-associated bacteriophage potentially involved in polymorphism based on optical maps. We also evaluated all other reported alternative insertion sites for Stx-associated bacteriophages (i.e., within or adjacent to wrbA, yehV, argW, ssrA, yecE, Z2755, intS, yfbO, sgcA, and nrdA-yfaL) in the optical maps of the tested strains [9], [25], [26], [27], [28], [29], [30], [31], [32]. Three of these loci (wrbA, yehV and argW) also revealed indels suggestive of bacteriophage insertion or deletion (Table 3). The insertion of Stx2-associated bacteriophage sequences within argW was confirmed in both of the BBG-6 strains and in the CG-1 strain by PCR (Table 3 and Figure S2). The remaining candidate insertions in wrbA and yehV were previously recognized and have been utilized in SBI genotyping [5], [10] (Table 3). Corresponding to the Stx-associated bacteriophage differences detected in optically mapped strains, stx2a was detected by PCR in all CG-1 and CG-3 strains, whereas stx2c (but not stx2a) was detected in all BBG-5 and BBG-6 strains. The absence of stx2a in BBG-6 strains that contain Stx2-associated bacteriophage sequences within argW was associated with altered BamHI restriction fragments consistent with a partial Stx2a-associated bacteriophage at this locus (Figure S2): E2325 (CG1, with an intact stx2a encoding bacteriophage) has four restriction fragments totaling 59,809 bp, whereas BBG-6 strain E6996 has seven restriction fragments totaling 58,185 bp and BBG-6 strain E2309 has five restriction fragments totaling 50,780 bp.

Modified SBI Genotype Designations

Since the multiplex PCR described here includes additional targets compared to previous SBI genotyping reports [5], [10], [14] modification of the previously used SBI genotype nomenclature was necessary. In place of the arbitrary numerical genotypes previously used (e.g., CG-1 and BBG-5), genotypes are identified here by concatenation of the upper case letters of bacteriophage insertion loci (A = argW, S = sbcB, W = wrbA, and Y = yehV), followed by numerical indication of the Stx variants detected (i.e., 1, 2, and/or 2c, Table 4). Bacteriophage insertion loci were considered occupied if either left or right (or both) bacteriophage – bacterial backbone junctions were amplified whereas these had been considered distinct genotypes in the previous system. As a result, the modified nomenclature resulted in both splitting and lumping of genotypes in comparison with the former system (Table 4). Isolates formerly designated CG-1 (n = 91) now include AY2 (61.5%), ASY22c (18.7%), ASY2 (14.3%) and SY2c (5.5%) genotypes. Isolates formerly designated CG-3 (n = 173) remain, with a single exception, a single genotype, WY12. Isolates formerly designated BBG-5 (n = 46) now include SY2c (89%), ASY2c (4.4%) and ASY22c (6.5%). Isolates formerly designated BBG-6 (n = 60) now include genotypes ASY12c (76.6%), SY12c (21.7%), and SY122c (1.7%). Finally, all isolates formerly designated BBG-7 are now WY12. Under this modified SBI genotype nomenclature, the optically mapped strains represent the modal genotypes of the former SBI designations (Table 1): CG-1 strain E2325 is AY2, CG-3 strains E5252 and E3046 are both WY2, BBG-5 strains E5880 and E3855 are both SY2c, and BBG-6 strains E2309 and E6996 are both ASY12c.
Table 4

SBI Genotyping on human and bovine isolates of EHEC O157.

SBI Genotype Codinga Bovine (%)Human (%)Total (%)SBI Genogroupb P-valueb Former SBI genotype designation (%)c
WY1292 (40.5)97 (50.5)189 (45.1)CG0.0483 (91), 7 (6.4), 18 (2.1), 22 (0.5)
AY211 (4.8)47 (24.5)58 (13.8)CG<0.00011 (96.6), 19 (3.5)
SY2c45 (19.8)2 (1.0)47 (11.2)BBG<0.00015 (87.2), 1 (10.6), 19 (2.1)
ASY12c38 (16.7)8 (4.2)46 (11.0)BBG<0.00016 (100)
ASY22c5 (2.2)15 (7.8)20 (4.8)CG0.011 (85), 5 (15)
SY12c14 (6.2)0 (0.0)14 (3.3)BBG0.00046 (92.9), 16 (7.1)
ASY21 (0.4)12 (6.3)13 (3.1)CG0.00051 (100)
W23 (1.3)8 (4.2)11 (2.6)Unclassified0.124 (100)
WY24 (1.8)0 (0.0)4 (1.0)UnclassifiedN/A2 (100)
Y4 (1.8)0 (0.0)4 (1.0)UnclassifiedN/A17 (75), 10 (25)
ASY2c2 (0.9)0 (0.0)2 (0.5)UnclassifiedN/A5 (100)
AWY121 (0.4)1 (0.5)2(0.5)UnclassifiedN/A3, 18
AY1 (0.4)0 (0.0)1 (0.2)UnclassifiedN/A10 (100)
Y10 (0.0)1 (0.5)1 (0.2)UnclassifiedN/A8 (100)
ASY11 (0.4)0 (0.0)1 (0.2)UnclassifiedN/A13 (100)
AY11 (0.4)0 (0.0)1 (0.2)UnclassifiedN/A13 (100)
WY11 (0.4)0 (0.0)1 (0.2)UnclassifiedN/A22 (100)
SWY2c1 (0.4)0 (0.0)1 (0.2)UnclassifiedN/A12 (100)
0 (0.0)1 (0.5)1 (0.2)UnclassifiedN/A9 (100)
SY122c1 (0.4)0 (0.0)1 (0.2)UnclassifiedN/A6 (100)
AWY21 (0.4)0 (0.0)1 (0.2)UnclassifiedN/A2 (100)
Total227192419

Concatenation of presence of specific bacteriophage at argW, sbcB, wrbA or yehV locations designated by uppercase first letter of each insertion site (A, S, W or Y,) followed by the presence of stx1, stx2a or stx2c denoted by 1,2 or 2c.

The SBI Genotypes that are significantly over-represented among cattle isolates as compared to human isolates are referred as bovine-biased genotypes (BBG); the SBI Genotypes that show significantly over-representation/similar-representation among human isolates as compared to cattle isolates are referred as clinical genotypes (CG); the SBI genotypes that could not be evaluated for a bovine association due to small numbers (1–4 isolates) are designated “unclassified” genotypes in this manuscript (Fisher’s exact test P≤0.05).

Percent of isolates belonging to most common previously defined SBI genotype [5], [10], [14].

Concatenation of presence of specific bacteriophage at argW, sbcB, wrbA or yehV locations designated by uppercase first letter of each insertion site (A, S, W or Y,) followed by the presence of stx1, stx2a or stx2c denoted by 1,2 or 2c. The SBI Genotypes that are significantly over-represented among cattle isolates as compared to human isolates are referred as bovine-biased genotypes (BBG); the SBI Genotypes that show significantly over-representation/similar-representation among human isolates as compared to cattle isolates are referred as clinical genotypes (CG); the SBI genotypes that could not be evaluated for a bovine association due to small numbers (1–4 isolates) are designated “unclassified” genotypes in this manuscript (Fisher’s exact test P≤0.05). Percent of isolates belonging to most common previously defined SBI genotype [5], [10], [14].

SBI Genotyping on Additional EHEC O157 Isolates

The distribution of SBI genotypes among cattle and human was determined by testing 419 additional EHEC O157 isolates. The PCR differentiated these isolates into 21 different genotypes (Table 4) of which eight genotypes represented a large majority (95%) of the isolates. Seven of these eight genotypes were significantly differentially represented in cattle and human hosts (P<0.05, Table 4). Three genotypes (SY2c, ASY12c and SY12c, n = 107) were significantly more frequent among bovine isolates (BBG, 42.7% of bovine isolates vs 5.2% of clinical isolates). Four SBI genotypes (WY12, AY2, ASY22c, and ASY2, n = 280) were significantly more frequent among clinical isolates (CG, 89.1% of clinical isolates vs 48% of bovine isolates). The remaining genotypes, not detected at significantly different frequencies from cattle and human sources, included W2 (11 isolates, including 8 clinical and 3 bovine) and thirteen additional SBI genotypes (n = 21 total). These SBI genotypes are designated “unclassified” genotypes in this manuscript. The 192 human isolates cumulatively belonged to ten genotypes: CG (89.1%), BBG (5.2%), and unclassified (5.7%). The 227 bovine isolates cumulatively belonged to 19 genotypes: CG (48%), BBG (42.7%), and unclassified (9.3%) (Table 4).

Distribution of Stx2 Gene and Associated Bacteriophages

Stx2a-associated bacteriophage sequences detected adjacent to either wrbA and/or argW and the detection of stx2a were significantly associated with CG compared to BBG strains (P≤0.001): all CG have Stx2a-associated bacteriophage sequences inserted in wrbA and/or argW and carry stx2a. In contrast, the presence of Stx2c-associated bacteriophage sequences inserted in sbcB and the presence of stx2c were significantly more common in BBG compared to CG isolates (P≤0.001): all BBG had both these traits, while only 11.8% of CG belonged to genotypes (ASY2 and ASY22c) with Stx2c-associated bacteriophage sequences inserted in sbcB, and only 7.1% of CG isolates (ASY22c) carried stx2c (Table 5). Many BBG (42.9%) had Stx2a-associated bacteriophage sequences adjacent to wrbA or argW but lacked detectable stx2a (Table 5).
Table 5

Consistency of type of Stx-associated bacteriophage and stx in SBI genotypes in clinical and bovine strains.

SBI genotypesa
Stx-associated bacteriophageInsertion siteOriginCGBBGUnclassifiedb Total
Stx2a wrbA c Bovine92 (92)0 (0)11 (9)103 (101)
Human97 (97)0 (0)9 (9)106 (106)
argW d Bovine17 (17)38 (0)7 (2)62 (19)
Human74 (74)8 (0)1 (1)83 (75)
Stx2c sbcB d Bovine6 (5)97 (97)5 (4)108 (106)
Human27 (15)10 (10)0 (0)37 (25)
Stx1 yehV c Bovine109 (92)97 (52)18 (5)224 (149)
Human171 (97)10 (8)2 (2)183 (107)
Strains in studyBovine1109720227
Human1711011192

Numbers of isolates with the corresponding Stx-associated bacteriophage sequences in the insertion site. Numbers in parentheses indicate the isolate also positive for the expected stx. Association of the Stx-associated bacteriophage and stx2 gene variant with the BBG and CG strains was analyzed using the Fisher’s exact test (P≤0.05).

Two strains of AWY12 and single strain of AWY2 had Stx2-associated bacteriophages inserted into both argW and wrbA, and our data cannot determine whether stx2a is carried by one or both of these bacteriophages.

Stx-associated bacteriophage differences among SBI genotypes identified in earlier studies [5], [10].

Stx-associated bacteriophage differences among SBI genotypes identified in this study.

Numbers of isolates with the corresponding Stx-associated bacteriophage sequences in the insertion site. Numbers in parentheses indicate the isolate also positive for the expected stx. Association of the Stx-associated bacteriophage and stx2 gene variant with the BBG and CG strains was analyzed using the Fisher’s exact test (P≤0.05). Two strains of AWY12 and single strain of AWY2 had Stx2-associated bacteriophages inserted into both argW and wrbA, and our data cannot determine whether stx2a is carried by one or both of these bacteriophages. Stx-associated bacteriophage differences among SBI genotypes identified in earlier studies [5], [10]. Stx-associated bacteriophage differences among SBI genotypes identified in this study. Corresponding differences were observed in the frequency of carriage of stx2 variants in human- and bovine-origin isolates. A large majority (85.9%) of the 192 human-origin isolates carried stx2a only and an additional 7.8% carried both stx2a and stx2c, while only 5.2% carried stx2c only and 1.0% carried neither stx2 variant. Of 227 bovine isolates 49.8% carried stx2a only, 44.1% carried stx2c only, 2.6% carried both, and 3.5% carried neither variant.

Discussion

Optical mapping technology accurately identified genetic changes consistent with bacteriophage insertions or deletions in EHEC O157 genotypes. This technology was used previously by Kotewicz et al. to identify differences in EHEC O157 strains representing SNP clusters and spinach outbreak strains [22], [30]. While Kotewicz et al. provided valuable information on genetic diversity among EHEC O157 strains of clinical origin; their clinical isolate strain set lacked defined BBG isolates. Our study was specifically designed to identify bacteriophage-related differences between the predominant CG (CG-1 and CG-3, now AY2 and WY12) and BBG (BBG-5 and BBG-6, now SY2c and ASY12c) groups that previously had been associated with differential virulence potential [15]. SBI has proven to be a useful genotyping technique to identify strains of EHEC O157 differing in distribution [5], [10], [14], gene expression [16] and virulence [15]. Although based on the content and insertional locations of bacteriophages (i.e., mobile genetic elements), SBI genotypes are empirically stable characteristics of EHEC O157 strains, as recently confirmed by Bono et al. [33] in their demonstration of close correlation between SBI genotypes and chromosomal backbone SNP-defined lineages of EHEC O157. Specifically, CG-1 (referred in current paper as AY2/ASY2/ASY22c) and CG-3 (WY12) correspond to SNP lineage II and I, respectively, and BBG-5 (SY2c) and BBG-6 (SY12c/ASY12c) corresponds to lineages III, IV, V and VII [33]. Therefore, the SBI multiplex PCR described here provides a means for presumptive identification of EHEC O157 lineages as defined by SNP typing. SBI genotype designations were modified to incorporate data from additional targets and to provide a biologically-based nomenclature. The additional targets include independent detection of stx2a and stx2c variants and two additional chromosomal - bacteriophage insertion sites, argW and sbcB. Even before addition of these targets well over 20 different SBI genotypes had been reported, and this cumbersome number as well as the arbitrary nature of the ordinal genotype designations threatened the usability of the system. Therefore, here we propose identification of SBI genotypes by the concatenation of letters representing specific chromosomal insertion sites followed by numbers indicating the stx variants detected. Isolates classified by this revised SBI designation system are more strongly associated with specific hosts, suggesting that the system is consistent with the biological behavior of the bacterium. The findings of this study clarify the bacteriophage related genetic differences characterizing BBG and CG, and confirm the strong association of stx2 subtypes in these two genogroups. Using a panel of 419 EHEC O157 geographically and temporally diverse cattle- and human-origin isolates, consistent patterns of Stx-associated bacteriophage insertions and stx2 variant carriage defined by the optically mapped strains was consistently observed: CG strains were characterized by the presence of the Stx2a-associated bacteriophage sequences inserted into argW or wrbA and by carriage of stx2a, while BBG were characterized by Stx2c-associated bacteriophage sequences adjacent to sbcB and carriage of stx2c. Some CG strains additionally have Stx2c-associated bacteriophage sequences adjacent to sbcB, with or without stx2c carriage, and about half of BBG isolates additionally have Stx2a-associated bacteriophage sequences adjacent to argW but lack stx2a. The close association of stx2a with the more clinically relevant CG strains is the most striking finding of our study. We recently demonstrated that CG strains (carrying stx2a with or without stx2c) induced more severe clinical symptoms, earlier and higher mortality, and more severe histopathological lesions compared to BBG strains (carrying stx2c only) in two animal models [15]. That study also demonstrated that CG strains produced higher amounts of ELISA-reactive Stx than BBG strains. A recent microarray study [16] demonstrated differential expression profiles of BBG and CG strains suggesting that the increased prevalence of EHEC O157 illness caused by certain strains is associated with over-expression of several virulence factors including ehx, genes on the LEE pathogenicity island, and pO157 genes, although no difference in stx expression was identified. Other comparative genomic studies on EHEC O157 have demonstrated similar variation in the frequency of stx variants among cattle and human isolates. Using octamer-based genome scanning and LSPA-6 genotyping [12], [13], [34], EHEC O157 isolates were differentiated into three lineages: I, I/II, and II. Recent studies demonstrated concordance between LSPA-6 and SBI genotyping, indicating that the lineage I, I/II, II strains predominantly belonged to SBI genotypes CG-3, CG-1 and BBG-6, respectively [35], [36]. Ziebell et al. [37] and Zhang et al. [34] demonstrated that nearly all lineage II strains carried stx2c, nearly all of the lineage I strains carried stx2a and 50.0% of lineage I/II strains carried stx2c. Similarly a recent study on Japanese isolates also suggests stx2a is the most distinctive feature in clinical isolates compared to cattle isolates. The human isolates, predominantly LSPA-6 lineage I or I/II, typically carried stx2a alone or in combination with stx1 or stx2c while LSPA-6 lineage II cattle isolates carried stx2c alone or in combination with stx1 [38]. These investigators also demonstrated that lineage I (stx1-stx2) isolates showed multiple stress resistances when compared to the lineage II (stx1-stx2c) genotypes [39]. Other studies have evaluated association of stx2a and stx2c content with human virulence [23], [40], [41], [42], [43], [44], [45], [46], [47], [48], [49]. Several of these epidemiological studies [41], [42], [43], [45], [46], [47], [48] demonstrated that EHEC O157 carrying stx2a (with or without stx2c) rather than stx2c were more frequent among clinical isolates, in agreement with the results presented here. Recently, Kawano et al. [48] along with others [43], [45], [46] suggested that EHEC O157 carrying stx2c were associated with asymptomatic individuals and mild disease however it is also isolated from patients with severe disease (bloody diarrhea, HC and HUS) as shown by others [23], [40], [41], [44], [47], [49]. Furthermore, Fuller et al. recently demonstrated that purified Stx2a is more potent than Stx2c against primary human kidney cell lines and in mouse models [42]. It is possible that carriage and expression of stx2a alone is sufficient to confer increased virulence in animal models and increased expression of human disease, but alternatively these phenotypes may result in whole or in part on other genetic factors that are correlated with stx2a. Knock-out and complementation studies to evaluate the role of stx2a in otherwise isogenic strains may be required to clarify this question. In conclusion, optical scanning proved effective at identifying large genetic indels associated with insertion or deletion of Stx-associated bacteriophages among major SBI genotypes of EHEC O157. The multiplex PCR described in this study provides a simple and rapid method to efficiently determine SBI genotypes of EHEC O157 isolates, now known to correlate with lineages within the EHEC O157 clade. We conclude that differential virulence of EHEC O157 genotypes may be due to variation in the presence of stx2 variants and/or bacteriophages associated these variants. Unraveling the roles of these genetic elements in EHEC O157 virulence will improve our understanding of pathogenesis and may facilitate development of strategies for the prevention and control of this important food-borne pathogen. Differences in insertion of Stx2c-associated bacteriophage in . The differences in insertion of Stx2c-associated bacteriophage in sbcB are shown by the hatched fragments. The yellow arrows indicate the phages (Sp) or prophage–like elements (SpLE) in sequenced strain Sakai (names shown below the map). Red marks indicate the insertion sites (sbcB and yegQ) for Stx-associated bacteriophage, and left junction (YL) for Stx1-associated bacteriophage inserted in yehV (names shown above the map). The restriction enzyme map of sequenced strain EC4115 (GenBank accession # CP001164) shows the known insertion of Stx2c-associated bacteriophage in sbcB locus (hatched fragments). The restriction enzyme map for Sakai and EC4115 are in silico maps and the other seven maps are optical maps of test strains. Plus (+) and minus (−) signs represent presence and absence of stx gene in the strains. (TIF) Click here for additional data file. Differences in insertion of Stx2a-associated bacteriophage in . The differences in insertion of Stx2a-associated bacteriophage in argW are shown by the hatched fragments. The yellow arrows indicate the phages (Sp) in sequenced strain Sakai (names shown below the map). Red marks indicate the insertion sites (argW/IntS) for Stx-associated bacteriophage (names shown above the map). The restriction enzyme map of the sequenced strain EC4115 (GenBank accession # CP001164) shows the known insertion Stx2a-associated bacteriophage in argW locus (hatched fragments). The restriction enzyme map for Sakai and EC4115 are in silico maps and the other seven maps are optical maps of test strains. Plus (+) and minus (−) signs represent presence and absence of stx gene in the strains. (TIF) Click here for additional data file. Polymorphic sites in optical maps of seven EHEC O157 strains when compared to the HI restriction enzyme map of the EHEC O157 Sakai strain (CG-3). (DOCX) Click here for additional data file.
  50 in total

1.  The nucleotide sequence of Shiga toxin (Stx) 2e-encoding phage phiP27 is not related to other Stx phage genomes, but the modular genetic structure is conserved.

Authors:  Jürgen Recktenwald; Herbert Schmidt
Journal:  Infect Immun       Date:  2002-04       Impact factor: 3.441

2.  Ancestral divergence, genome diversification, and phylogeographic variation in subpopulations of sorbitol-negative, beta-glucuronidase-negative enterohemorrhagic Escherichia coli O157.

Authors:  J Kim; J Nietfeldt; J Ju; J Wise; N Fegan; P Desmarchelier; A K Benson
Journal:  J Bacteriol       Date:  2001-12       Impact factor: 3.490

3.  Genomic diversity of enterohemorrhagic Escherichia coli O157 revealed by whole genome PCR scanning.

Authors:  Makoto Ohnishi; Jun Terajima; Ken Kurokawa; Keisuke Nakayama; Takahiro Murata; Kazumichi Tamura; Yoshitoshi Ogura; Haruo Watanabe; Tetsuya Hayashi
Journal:  Proc Natl Acad Sci U S A       Date:  2002-12-12       Impact factor: 11.205

4.  Bovine reservoir for verotoxin-producing Escherichia coli O157:H7.

Authors:  A A Borczyk; M A Karmali; H Lior; L M Duncan
Journal:  Lancet       Date:  1987-01-10       Impact factor: 79.321

5.  Clinical Escherichia coli strains carrying stx genes: stx variants and stx-positive virulence profiles.

Authors:  Marjut Eklund; Kirsikka Leino; Anja Siitonen
Journal:  J Clin Microbiol       Date:  2002-12       Impact factor: 5.948

6.  Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature.

Authors:  Flemming Scheutz; Louise D Teel; Lothar Beutin; Denis Piérard; Glenn Buvens; Helge Karch; Alexander Mellmann; Alfredo Caprioli; Rosangela Tozzoli; Stefano Morabito; Nancy A Strockbine; Angela R Melton-Celsa; Maria Sanchez; Søren Persson; Alison D O'Brien
Journal:  J Clin Microbiol       Date:  2012-07-03       Impact factor: 5.948

7.  Nucleotide sequence of the integration site of the temperate bacteriophage 6220, which carries the Shiga toxin gene stx(1ox3).

Authors:  Claudia Koch; Stefan Hertwig; Bernd Appel
Journal:  J Bacteriol       Date:  2003-11       Impact factor: 3.490

8.  Escherichia coli O157:H7 Shiga toxin-encoding bacteriophages: integrations, excisions, truncations, and evolutionary implications.

Authors:  Nurmohammad Shaikh; Phillip I Tarr
Journal:  J Bacteriol       Date:  2003-06       Impact factor: 3.490

9.  Shiga toxin-producing Escherichia coli in Montana: bacterial genotypes and clinical profiles.

Authors:  Jill K Jelacic; Todd Damrow; Gilbert S Chen; Srdjan Jelacic; Martina Bielaszewska; Marcia Ciol; Humberto M Carvalho; Angela R Melton-Celsa; Alison D O'Brien; Phillip I Tarr
Journal:  J Infect Dis       Date:  2003-08-15       Impact factor: 5.226

10.  A nested PCR followed by magnetic separation of amplified fragments for detection of Escherichia coli Shiga-like toxin genes.

Authors:  O Olsvik; E Rimstad; E Hornes; N Strockbine; Y Wasteson; A Lund; K Wachsmuth
Journal:  Mol Cell Probes       Date:  1991-12       Impact factor: 2.365

View more
  25 in total

1.  A Putative Microcin Amplifies Shiga Toxin 2a Production of Escherichia coli O157:H7.

Authors:  Hillary M Mosso; Lingzi Xiaoli; Kakolie Banerjee; Maria Hoffmann; Kuan Yao; Edward G Dudley
Journal:  J Bacteriol       Date:  2019-12-06       Impact factor: 3.490

2.  Geographically distinct Escherichia coli O157 isolates differ by lineage, Shiga toxin genotype, and total shiga toxin production.

Authors:  Glen E Mellor; Narelle Fegan; Kari S Gobius; Helen V Smith; Amy V Jennison; Beatriz A D'Astek; Marta Rivas; Smriti Shringi; Katherine N K Baker; Thomas E Besser
Journal:  J Clin Microbiol       Date:  2014-12-10       Impact factor: 5.948

3.  Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages.

Authors:  Ludivine Bonanno; Estelle Loukiadis; Patricia Mariani-Kurkdjian; Eric Oswald; Lucille Garnier; Valérie Michel; Frédéric Auvray
Journal:  Appl Environ Microbiol       Date:  2015-03-27       Impact factor: 4.792

4.  Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli O157:H7.

Authors:  Woo Kyung Jung; James L Bono; Michael L Clawson; Shana R Leopold; Smriti Shringi; Thomas E Besser
Journal:  Appl Environ Microbiol       Date:  2013-09-06       Impact factor: 4.792

5.  Prevalence of carriage of Shiga toxin-producing Escherichia coli serotypes O157:H7, O26:H11, O103:H2, O111:H8, and O145:H28 among slaughtered adult cattle in France.

Authors:  Delphine Bibbal; Estelle Loukiadis; Monique Kérourédan; Franck Ferré; Françoise Dilasser; Carine Peytavin de Garam; Philippe Cartier; Eric Oswald; Emilie Gay; Frédéric Auvray; Hubert Brugère
Journal:  Appl Environ Microbiol       Date:  2015-02       Impact factor: 4.792

6.  Multilocus genotype analysis of Escherichia coli O157 isolates from Australia and the United States provides evidence of geographic divergence.

Authors:  Glen E Mellor; Thomas E Besser; Margaret A Davis; Brittany Beavis; Wookyung Jung; Helen V Smith; Amy V Jennison; Christine J Doyle; P Scott Chandry; Kari S Gobius; Narelle Fegan
Journal:  Appl Environ Microbiol       Date:  2013-06-14       Impact factor: 4.792

7.  Repeated Oral Vaccination of Cattle with Shiga Toxin-Negative Escherichia coli O157:H7 Reduces Carriage of Wild-Type E. coli O157:H7 after Challenge.

Authors:  Smriti Shringi; Haiqing Sheng; Carolyn J Hovde; Thomas E Besser; Andrew A Potter; Scott A Minnich
Journal:  Appl Environ Microbiol       Date:  2021-01-04       Impact factor: 4.792

8.  Standardized Escherichia coli O157:H7 Exposure Studies in Cattle Provide Evidence that Bovine Factors Do Not Drive Increased Summertime Colonization.

Authors:  Haiqing Sheng; Smriti Shringi; Katherine N K Baker; Scott A Minnich; Carolyn J Hovde; Thomas E Besser
Journal:  Appl Environ Microbiol       Date:  2015-11-25       Impact factor: 4.792

9.  Importance of case age in the purported association between phylogenetics and hemolytic uremic syndrome in Escherichia coli O157:H7 infections.

Authors:  G A M Tarr; S Shringi; H N Oltean; J Mayer; P Rabinowitz; J Wakefield; P I Tarr; T E Besser; A I Phipps
Journal:  Epidemiol Infect       Date:  2018-06-19       Impact factor: 4.434

10.  GeneSippr: a rapid whole-genome approach for the identification and characterization of foodborne pathogens such as priority Shiga toxigenic Escherichia coli.

Authors:  Dominic Lambert; Catherine D Carrillo; Adam G Koziol; Paul Manninger; Burton W Blais
Journal:  PLoS One       Date:  2015-04-10       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.