Literature DB >> 23188495

Antiviral effects of a probiotic Enterococcus faecium strain against transmissible gastroenteritis coronavirus.

Weidong Chai1, Michael Burwinkel, Zhenya Wang, Christiane Palissa, Bettina Esch, Sven Twardziok, Juliane Rieger, Paul Wrede, Michael F G Schmidt.   

Abstract

The enteropathogenic coronavirus transmissible gastroenteritis virus (TGEV) causes severe disease in young piglets. We have studied the protective effects of the probiotic Enterococcus faecium NCIMB 10415 (E. faecium), which is approved as a feed additive in the European Union, against TGEV infection. E. faecium was added to swine testicle (ST) cells before, concomitantly with, or after TGEV infection. Viability assays revealed that E. faecium led to a dose-dependent rescue of viability of TGEV-infected cells reaching nearly to complete protection. Virus yields of the E. faecium-treated cultures were reduced by up to three log10 units. Western blot analysis of purified TGEV revealed that the levels of all viral structural proteins were reduced after E. faecium treatment. Using transmission electron microscopy, we observed attachment of TGEV particles to the surface of E. faecium which might be a means to trap virus and to prevent infection. Increased production of nitric oxide in the cells treated with E. faecium and elevated expression of interleukin 6 and 8 pointed to stimulated cellular defense as a mechanism to fight TGEV infection.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23188495      PMCID: PMC7086644          DOI: 10.1007/s00705-012-1543-0

Source DB:  PubMed          Journal:  Arch Virol        ISSN: 0304-8608            Impact factor:   2.574


Introduction

Transmissible gastroenteritis virus (TGEV) infects enteric and respiratory tissues and causes severe gastroenteritis with a mortality rate close to 100 % in newborn piglets [3, 36]. The appearance of the closely related TGEV variant porcine respiratory coronavirus (PRCoV) has been found beneficial in preventing TGEV infections, possibly through induction of neutralizing antibodies that can provide cross-protection against TGEV infection [34, 39]. However, TGE prevalence is still being reported, and some TGEV strains have been isolated from domestic pigs in different parts of the world [28]. Commercially available vaccines, either inactivated or attenuated, have failed to provide full protection to piglets [38]. It is likely that the parentally applied inactivated viruses do not induce the local immune response in the small intestine that is required for protection. Therefore, the discovery and development of new, highly potent anti-TGEV agents and effective approaches for controlling the emergence of TGEV infection remains an important mission. Probiotics are defined as live microbial food supplements with health-promoting attributes. Potent mechanisms of beneficial action include the production of antimicrobial agents, modulation of immune responses and promotion of host innate defense mechanisms [6, 7, 13, 20, 31]. Enterococcus faecium NCIMB 10415 (E. faecium) is authorized in the EU for use as a probiotic feed additive for sows and piglets and several other farm animal species. Beneficial effects of the probiotic E. faecium such as immune modulation and improvement of nutrient transport have previously been reported in several studies [12, 23, 32, 33, 37]. In vitro studies have also demonstrated that E. faecium could reduce the rate of invasion of pathogens—for instance, Salmonella in intestinal cell lines [2, 9]. But detailed knowledge on the impact of E. faecium on viral infections in vivo and in vitro is lacking. The purpose of the present study was to establish an in vitro model to investigate the antiviral potential of E. faecium. We used an established swine testicle (ST) cell line to assess the protective effects of E. faecium on TGEV infection in terms of viral replication and cell survival. To gain insight into its possible mechanisms of action, the effects of E. faecium on viral protein synthesis as well as the induction of inducible nitric oxide synthase (iNOS) and selected cytokines were investigated. Our results described here suggest that this probiotic E. faecium strain exhibits antiviral activity against TGEV and may possibly serve as a useful antiviral agent against coronavirus infections in vivo.

Materials and methods

Cells and virus

The epithelial swine testicle (ST) cell line was maintained in Dulbecco’s modified Eagle’s medium (DMEM, PAN Biotech) supplemented with 10 % fetal bovine serum (Hyclone), and 1 % penicillin/streptomycin (Biochrom), growing at 37 °C in a 5 % CO2 humidified incubator. The TGEV strain Purdue 46-MAD (kindly provided by Dr. C. Schwegmann-Wessels, Institut für Virologie, Tierärztliche Hochschule Hannover) was used in this study. Stock virus was propagated in ST cells to a titer of 1.00E+07 PFU/ml. All infections were done at a multiplicity of infection of 0.01.

Bacteria

Enterococcus faecium NCIMB 10415 isolated from a commercial product used in animal nutrition (Cylactin®, Cerbios-Pharma SA, Lugano) was used in this study and cultivated in Todd-Hewitt-Bouillon (THB, Roth). The number of viable bacteria in 1 ml of bacterial culture was determined by plating bacteria on agar. Bacterial cultures were then centrifuged at 2400 rpm for 10 min, and bacteria were washed twice to remove excess THB. Finally, the viable E. faecium particles were resuspended in DMEM to a stock concentration of 6.00E+08 CFU/ml. Heat inactivation of bacteria was performed by heat treatment with E. faecium (1.00E+05, 1.00E+06, 1.00E+07 CFU/ml) in DMEM in a water bath at 100 °C for 10 min. Bacterial culture supernatants were obtained from growing bacterial cultures in THB. Bacteria were removed by centrifugation at 2400 rpm for 10 min, and supernatants were collected.

Assessment of cellular toxicity of E. faecium

Suspensions of 100 μl containing different amounts of E. faecium ranging from 1.00E+04 to 5.00E+08 were added to ST cell monolayers in a 96-well plate (Greiner Bio-One) for 1.5 h before washing away. At the end of the incubation period, a methylthiazolyl-diphenyl-tetrazolium bromide (MTT) viability assay was carried out as described previously [24]. The cell survival rate was determined as bacteria average OD value/control average OD value. The 50 % cytotoxic concentration (CC50) was defined as the concentration that inhibited cell proliferation by 50 %, and a non-cytotoxic concentration of E. faecium was used for antiviral assays.

Impact of E. faecium on TGEV infection

Four different experimental protocols were applied to investigate the antiviral activity of E. faecium. Three setups focused on the effect of E. faecium on the cells by varying the treatment period in relation to infection with TGEV. A fourth setup assessed the direct effect of the probiotic on virus particles. In brief, monolayers of ST cells were treated with E. faecium for 1.5 h, which was washed away before infection with TGEV for 1 h (pretreatment assay), E. faecium and TGEV were added to the cell layer together during the 1-h infection period (competition assay), or E. faecium was added for 1.5 h right after the infection period (post-infection treatment assay). After probiotic treatment as well as after infection with TGEV, cells were washed twice and kept in medium containing 1 % penicillin/streptomycin to kill any viable bacteria that were left. To assess direct effects of E. faecium on TGEV without cells being involved, the virus was mixed with different concentrations of E. faecium and incubated for 1.5 h at 37 °C. After centrifugation for 10 min at 5000 rpm to sediment bacterial cells, the virus containing supernatants were used to infect ST cells (cell-free preincubation assay). The antiviral effects of heat-inactivated E. faecium as well as serially diluted E. faecium supernatants were also tested in the competition assay. Virus-infected ST cells and cells without addition of E. faecium served as controls from which samples were collected at 48 and 72 h after infection (hpi) for the 50 % tissue culture infective dose (TCID50) and the MTT viability assay, respectively. Relative survival of cells was calculated as follows [28]: Percent viable cells = [(OD value of E. faecium group − OD value of infection control)/(OD value of blank control − OD value of infection control)] × 100.

Transmission electron microscopy (TEM)

In order to examine possible direct binding of virus by E. faecium, the cell-free preincubation assay was performed by mixing E. faecium with TGEV at a bacteria-to-virus ratio of 500 for 1.5 h. After centrifugation for 10 min at 5000 rpm to sediment bacterial cells, the pellet was resuspended in 1 ml Karnovsky’s Fixative. The samples were centrifuged for 10 min at 2500 rpm and a drop (15 µl) was taken from the bottom of the tube and negatively stained with 2 % phosphotungstic acid for 1 min. Finally, the samples were evaluated with a transmission electron microscope (Zeiss 10CR).

Virus yield reduction assay

ST cell monolayers were infected with TGEV with or without probiotic bacteria treatment according to the experimental design. At 48 hpi, aliquots of the supernatants were taken, and serial tenfold dilution steps were performed. Infectivity was determined by endpoint dilution titration on ST cells in a 96-well plate. The plate was incubated for 72 hpi, and infectivity was determined by recording the virus-induced cytopathic effect (CPE). Virus titer was calculated by the method of Reed and Muench, which is usually used for the calculation of LD50 [18] and documented as TCID50 values.

Western blot analysis of virus particles

ST cells were infected in culture dishes with 145-cm2 growth areas under competition assay conditions with E. faecium. At 48 hpi, virus from cell culture fluids and cells were collected by ultracentrifugation in a L7-65 Ultracentrifuge (Beckman Coulter) at 27,000 rpm for 2.5 h using a SW28 rotor. The pellet containing virus particles, with equal amounts of total protein, underwent sodium dodecyl sulfate polyacrylamide gel electrophoresis, and the separated proteins were electro-transferred to Hybond LFP (PVDF) membranes (GE Healthcare) using a feline anti-TGE polyclonal antiserum (NatuTec) at a dilution of 1:1000 and an anti-feline IgG polyclonal antiserum (Rockland) at a dilution of 1:10,000. Antigen-antibody complexes were detected using a western blotting substrate (Pierce® ECL Plus). Immunodetectable protein bands on the membrane were visualized using the Fusion SL4 imaging system (Vilber Lourmat), and protein amounts were estimated by densitometric analysis using the Fusion-Capt software (Vilber Lourmat). Three independent experiments and appropriate gel exposures yielded very similar results for each treatment modality.

Detection of nitric oxide (NO) release

At 48 hpi, in different assays, NO release was determined by measuring the amount of released NO2 − using the Griess-Assay (Promega) according to the manufacturer’s protocol. LPS (0.1 mg/ml)-stimulated cells were used as a positive control. Samples from untreated cells with or without prior infection served to define basal values.

Real-time PCR

Total RNA from ST cells was isolated using a Gene MATRIX RNA Purification Kit (EURx) as described by the manufacturer. Reverse transcription (RT) was performed using a RevertAidTM First Strand cDNA Synthesis Kit (Fermentas) according to the manufacturer’s instructions. PCR reactions were performed in a total volume of 25 μl in an iCycler iQ5 detection system (Bio-Rad Laboratories). Data analysis was based on the measurement of the cycle threshold (Ct). The differences in the Ct values of untreated samples versus treated samples were calculated by using the Delta-Delta-Ct method [22, 29]. Each sample was measured in triplicate from three independent experiments. The names of genes, the GenBank accession number, the primer sequences, the annealing temperatures, and the sizes of the amplification products are listed in Table 1.
Table 1

Detailed primers and conditions used for real-time PCR assays

GeneAccession numberPrimer pairs (5′-3′)Annealing temp. (°C)Amplicon size (bp)

β-actin-for

β-actin-rev

XM_003124280.2

GGACTTCGAGCAGGAGATGG

GCACCGTGTTGGCGTAGAGG

55233

IL-1β-for

IL-1β-rev

NM_214055

GGCCGCCAAGATATAACTGA

GGACCTCTGGGTATGGCTTTC

5770

IL-2-for

IL-2-rev

EU139160

GCTGGATTTACAGTTGCT

CTTGTTTCAGATCCCTTT

55213

IL-6-for

IL-6-rev

AB194100

AACGCCTGGAAGAAGA

AACCCAGATTGGAAGC

53229

IL-8-for

IL-8-rev

X61151

GTTCTGGCAAGAGTAAG

CACGGAGAATGGGTTT

53275

IL-10-for

IL-10-rev

EF433759

GCATCCACTTCCCAACCA

TCGGCATTACGTCTTCCAG

55178

IFN-α-for

IFN-α-rev

NM_214393

GCTCCTGGCACAAATG

GCTGCTGATCCAGTCC

60197

TNF-α-for

TNF-α-rev

NM_214022

ACGCTCTTCTGCCTACTGC

TGGGCGACGGGCTTATC

58388

TLR-3-for

TLR-3-rev

DQ266435

AACCAGCAACACGACT

TTGGAAAGCCCATAAA

57110

TGEV-for

TGEV-rev

DQ811789

GTATTGGGATTATGCT

GGTGGTGGTAGTAGGT

55258
Detailed primers and conditions used for real-time PCR assays β-actin-for β-actin-rev GGACTTCGAGCAGGAGATGG GCACCGTGTTGGCGTAGAGG IL-1β-for IL-1β-rev GGCCGCCAAGATATAACTGA GGACCTCTGGGTATGGCTTTC IL-2-for IL-2-rev GCTGGATTTACAGTTGCT CTTGTTTCAGATCCCTTT IL-6-for IL-6-rev AACGCCTGGAAGAAGA AACCCAGATTGGAAGC IL-8-for IL-8-rev GTTCTGGCAAGAGTAAG CACGGAGAATGGGTTT IL-10-for IL-10-rev GCATCCACTTCCCAACCA TCGGCATTACGTCTTCCAG IFN-α-for IFN-α-rev GCTCCTGGCACAAATG GCTGCTGATCCAGTCC TNF-α-for TNF-α-rev ACGCTCTTCTGCCTACTGC TGGGCGACGGGCTTATC TLR-3-for TLR-3-rev AACCAGCAACACGACT TTGGAAAGCCCATAAA TGEV-for TGEV-rev GTATTGGGATTATGCT GGTGGTGGTAGTAGGT

Statistical analysis

All calculations were performed with IBM SPSS 20. Statistical analysis of virus titers and NO detection was performed by two and one factorial ANOVA, respectively, followed by Scheffé’s post hoc test. Cytokine expression data analysis was performed by paired t-test. P-values less than 0.05 were considered statistically significant. All data are given as the mean ± SD.

Results

Assessment of cytotoxicity of E. faecium for ST cells

Before the probiotic E. faecium can be used for interference studies, the concentration range in which its addition to cells is non-toxic was defined. The results from cell viability assays (Fig. 1) show that E. faecium was non-toxic at concentrations up to 1.00E+07 CFU/ml. The viability rate of ST cells was 100 %, and no morphological differences were observed between bacteria-treated and mock-treated cells at this concentration. Therefore, the highest concentration of E. faecium chosen for the interference study with TGEV was 1.00E+07 CFU/ml. The CC50 of E. faecium in ST cells was calculated to be 5.92E+07 CFU/ml.
Fig. 1

Effect of E. faecium on the viability of ST cells. E. faecium was added to confluent cells in a 96-well plate, which were then incubated at 37 °C for 1.5 h. Cell viability was tested by MTT assay after 72 h. The cell survival rate was determined by comparing the optical density values from E. faecium–treated cells to those from non-treated control cells set to 100 %. The cell survival rates at different concentrations of probiotic bacteria are given, and 50 % above the cell survival rate (above broken line) is regarded as a non-toxic concentration of E. faecium. Results represent means ± standard deviations from three independent experiments

Effect of E. faecium on the viability of ST cells. E. faecium was added to confluent cells in a 96-well plate, which were then incubated at 37 °C for 1.5 h. Cell viability was tested by MTT assay after 72 h. The cell survival rate was determined by comparing the optical density values from E. faecium–treated cells to those from non-treated control cells set to 100 %. The cell survival rates at different concentrations of probiotic bacteria are given, and 50 % above the cell survival rate (above broken line) is regarded as a non-toxic concentration of E. faecium. Results represent means ± standard deviations from three independent experiments

Assessment of protective effect of E. faecium during infection of ST cells with TGEV

Infection of cell cultures with TGEV is known to cause a severe CPE. If treatment of the host cells with E. faecium has a protective effect, it should cause a decrease in the virus-induced CPE, which should result in the rescue of the viability of the infected cells. The viability of the TGEV-infected cells was analyzed by both MTT assay and flow cytometry. The results from the MTT analysis (Fig. 2a) show that E. faecium provided protection from TGEV infection in a dose-dependent manner. Up to 100 % protection was achieved at the highest concentration of E. faecium (1.00E+07 CFU/ml) when the probiotic was added to the cells together with the virus during the infection period (competition assay).
Fig. 2

Rescue of TGEV-infected ST cells by treatment with E. faecium. Different concentrations of E. faecium were added to ST cells in different setups as described (a). Heat-inactivated E. faecium (b) and diluted supernatants of cultured E. faecium (c) were also included. After 72 h, an MTT assay was carried out. Results are plotted as percent viability, with uninfected cells without E. faecium taken as 100 %. Results are given as mean ± standard deviation from at least three independent experiments

Rescue of TGEV-infected ST cells by treatment with E. faecium. Different concentrations of E. faecium were added to ST cells in different setups as described (a). Heat-inactivated E. faecium (b) and diluted supernatants of cultured E. faecium (c) were also included. After 72 h, an MTT assay was carried out. Results are plotted as percent viability, with uninfected cells without E. faecium taken as 100 %. Results are given as mean ± standard deviation from at least three independent experiments To find out whether E. faecium inactivates TGEV particles by direct physical interaction with virus, a cell-free preincubation assay was performed. The results show that the infectivity of TGEV was also reduced in a concentration-dependent manner. These results from the MTT assay (Fig. 2a) were confirmed by flow cytometry using propidium iodide staining in an independent experiment (data not shown). Furthermore, as illustrated by electron microscopy (Fig. 3), virus particles seemed to be bound by E. faecium and attached to the E. faecium surface.
Fig. 3

Attachment of TGEV particles to E. faecium. The pellet of virus and bacteria mixture from cell-free preincubation assay was negatively stained and examined by TEM

Attachment of TGEV particles to E. faecium. The pellet of virus and bacteria mixture from cell-free preincubation assay was negatively stained and examined by TEM Because the competition assay exhibited the most pronounced antiviral activity in terms of cell survival (Fig. 2a), the antiviral effect of heat-killed E. faecium and E. faecium supernatant in the competition assay was also tested. The results (Figs. 2b, c) show that heat-killed E. faecium and E. faecium supernatant still had antiviral activity, but it was much less pronounced, suggesting that live E. faecium is necessary to exhibit the observed virus-reducing effects.

Effect of E. faecium on virus yields in TGEV-infected ST cells

The anti-TGEV activities of E. faecium were confirmed by measuring released infectious virus in the culture medium using a TCID50 assay. As expected, the results (Fig. 4) are consistent with those from the cell viability assays, since TGEV yields were found to be reduced by treatment with E. faecium. Again, the inhibition of virus production was most effective in the competition assay, when cells had been exposed to the highest concentration of E. faecium (1.00E+07 CFU/ml), amounting to a three-log10 reduction. Reduced virus titers were also found in the cell-free preincubation assay, which indicates that the probiotic E. faecium also has antiviral capacity at the level of direct physical interaction with virus particles.
Fig. 4

Less virus produced in E. faecium–treated ST cells infected with TGEV. Cells were exposed to different concentrations of E. faecium as described. Cell culture supernatants were collected, and the yield of virus was determined by TCID50. The means ± standard deviations from three independent experiments are shown. Significance levels for the difference between E. faecium treatment and virus control from untreated cells are given above the bar: **p < 0.001, *p < 0.05

Less virus produced in E. faecium–treated ST cells infected with TGEV. Cells were exposed to different concentrations of E. faecium as described. Cell culture supernatants were collected, and the yield of virus was determined by TCID50. The means ± standard deviations from three independent experiments are shown. Significance levels for the difference between E. faecium treatment and virus control from untreated cells are given above the bar: **p < 0.001, *p < 0.05

Analysis of protein composition of TGEV from ST cells treated with E. faecium

TGEV produced on a large scale under E. faecium interference conditions (competition assay) was enriched by ultracentrifugation and subjected to SDS-PAGE followed by western blot analysis. Protein assays revealed strongly reduced amounts of total viral protein when virus from probiotic treated cells was analyzed (Fig. 5). When virus was collected from cells treated with 1.00E+07 CFU/ml of the probiotic during the infection period, TGEV protein levels were reduced by more than 80 %. More importantly, after western blotting with antibodies raised against total TGEV protein, densitometric inspection failed to show any major aberrations of the relative polypeptide compositions of the virus particles, indicating that the levels of all viral proteins were evenly reduced.
Fig. 5

Disrupted TGEV protein expression in E. faecium–treated ST cells infected with TGEV. Lane 1, uninfected, untreated cell control; lane 2, TGEV control; lane 3, virus from cells treated with 1.00E+05 CFU/ml E. faecium; lane 4, virus from cells treated with 1.00E+06 CFU/ml E. faecium; lane 5, virus from cells treated with 1.00E+07 CFU/ml E. faecium. Molecular weight marker proteins were run in parallel. Positions of viral spike protein (S), viral nucleocapsid protein (N), and viral membrane protein (M) are indicated on the right. Three independent experiments yielded almost identical results

Disrupted TGEV protein expression in E. faecium–treated ST cells infected with TGEV. Lane 1, uninfected, untreated cell control; lane 2, TGEV control; lane 3, virus from cells treated with 1.00E+05 CFU/ml E. faecium; lane 4, virus from cells treated with 1.00E+06 CFU/ml E. faecium; lane 5, virus from cells treated with 1.00E+07 CFU/ml E. faecium. Molecular weight marker proteins were run in parallel. Positions of viral spike protein (S), viral nucleocapsid protein (N), and viral membrane protein (M) are indicated on the right. Three independent experiments yielded almost identical results

E. faecium treatment increases the production of NO in ST cells

In a first approach to elucidating the mechanism of the effect of probiotic treatment on TGEV production, the synthesis of antiviral NO was measured. As shown in Table 2, all of the three different concentrations of E. faecium apparently induced NO release whether the cells had been infected with TGEV or not. The highest accumulation of NO in the cell culture medium was obtained in the 1.00E+07 CFU/ml E. faecium/virus group, exceeding the levels of the positive control LPS, which is a strong inducer of NO release.
Table 2

Effect of E. faecium on NO (μM NO2 − ± SD) release in control ST cells and TGEV-infected ST cells

Additions to culture mediumNon-infected cellsTGEV-infected cells
No additions0.20 ± 0.112.38 ± 0.39
E. faecium (1.00E+07)5.92 ± 0.28**6.67 ± 0.94**
E. faecium (1.00E+06)4.92 ± 0.37**5.30 ± 0.60**
E. faecium (1.00E+05)4.06 ± 0.34**4.49 ± 0.22*
LPS4.80 ± 0.11**ND

TGEV and E. faecium were present on ST cells for 1 h during the infection period (Competition assay). LPS at 100 μg/ml final concentration was present for 1 h in non-infected cells. Griess assay for NO detection was done 48 h after treatment. OD values at 540 nm were measured and nitrite concentration was calculated according to nitrite standard reference curve. Results are given as nitrite concentration and represent the means ± standard deviations from three independent experiments. Significance levels for the difference between the value for E. faecium and LPS treatment and those for the “no additions” in the same column are marked

*p < 0.05

**p < 0.01

Effect of E. faecium on NO (μM NO2 − ± SD) release in control ST cells and TGEV-infected ST cells TGEV and E. faecium were present on ST cells for 1 h during the infection period (Competition assay). LPS at 100 μg/ml final concentration was present for 1 h in non-infected cells. Griess assay for NO detection was done 48 h after treatment. OD values at 540 nm were measured and nitrite concentration was calculated according to nitrite standard reference curve. Results are given as nitrite concentration and represent the means ± standard deviations from three independent experiments. Significance levels for the difference between the value for E. faecium and LPS treatment and those for the “no additions” in the same column are marked *p < 0.05 **p < 0.01

Cytokine expression in E. faecium–treated ST cells during the period of infection

Cytokines are important components of cellular defense mechanisms against microbial infection. Treatment of ST cells with the probiotic could modulate the cellular expression patterns of cytokines and thereby reduce the efficiency of TGEV multiplication. As a first step to test this hypothesis, we studied the production of selected cytokines under the influence of E. faecium in TGEV- and mock-infected ST cells at 2 h, 4 h, 6 h, 12 h and 24 hpi (competition assay). A clear increased expression of cytokines was observed, reaching the highest levels of expression at 4 hpi. The results show that administration of 1.00E+07 CFU/ml E. faecium together with the virus significantly increases mRNA expression levels of the pro-inflammatory cytokines interleukin 6 (IL-6) and IL-8 (an approximately 3- and 13-fold increase, respectively) when compared with TGEV-infected ST cells that had not been exposed to the probiotic (Fig. 6). Tumor necrosis factor-alpha (TNF-α), interferon α (IFN-α) and Toll-like receptor-3 (TLR-3) mRNA expression showed a less pronounced increase when compared with TGEV-infected cells that had not been exposed to the probiotic. Administration of 1.00E+07 CFU/ml E. faecium alone increased similar mRNA expression levels of those cytokines. IL-1β, IL-2 and IL-10 levels were apparently below the detection limit of the PCR assay applied in this study.
Fig. 6

Stimulation of cytokine expression by E. faecium in TGEV-infected ST cells. The expression of selected cytokines was measured by quantitative RT-PCR. The expression of IL-6 and IL-8 was significantly increased compared to the cells infected with TGEV only (black bars). Significance levels for the difference between E. faecium treatment and virus control are given above the bar: *p < 0.05, **p < 0.01. The data presented correspond to the mean ± SD of at least three independent experiments

Stimulation of cytokine expression by E. faecium in TGEV-infected ST cells. The expression of selected cytokines was measured by quantitative RT-PCR. The expression of IL-6 and IL-8 was significantly increased compared to the cells infected with TGEV only (black bars). Significance levels for the difference between E. faecium treatment and virus control are given above the bar: *p < 0.05, **p < 0.01. The data presented correspond to the mean ± SD of at least three independent experiments

Discussion

To assess the potential prophylactic or therapeutic effect of the probiotic bacteria E. faecium on TGEV infection, increasing concentrations of probiotic E. faecium bacteria were added to ST cells before, concomitantly with, or after TGEV infection for a short period of time, and cell viability as well as virus titers in the culture medium were quantitatively assessed later after long-term incubation. A low MOI of 0.01 was chosen in order to allow multiple infection cycles, as this more closely reflects natural infection. By pre-treatment of ST cells with E. faecium (pretreatment), the viability of TGEV-infected cells was protected, and virus yields were reduced (Figs. 2 and 4). It appears that E. faecium can interfere with virus attachment and/or entry into cells. Several studies have demonstrated that probiotics can block viral attachment by competitive inhibition if they are able to bind viral receptors at the surface of cells. Freitas and coworkers [10, 11] reported that the Lactobacillus casei strain DN114001 and a strain of Bacteroides thetaiotaomicron produce a soluble compound that partially protects epithelial cells from rotavirus infection in vitro by modulating the apical glycosylation pattern of the cells. The post-infection treatment assay suggested that the antiviral activity of E. faecium also contributed to the stimulation of pro-inflammatory factors (i.e., increased mRNA expression levels of IL-6 and IL-8). Pagnini and co-workers have shown that the multiple probiotic formulation VSL#3 could stimulate the epithelial production of TNF-α and activate NF-κB in vitro [26]. Probiotic bacteria may also indirectly interfere with virus by altering the state of cells, stimulating innate and/or adaptive immunity [5, 6]. In this study, the expression of antiviral cytokines IL-6 and IL-8 may alter the state of cells, eventually leading to an antiviral response. In our cell-free pre-incubation assay, improved survival and a significant drop in virus titer were also observed (Figs. 2 and 4). In theory, the virus could also fail to infect the host cells if it is trapped by adsorption to the bacterial surface, and from the TEM result (Fig. 3), we did observe that virus particles were trapped by E. faecium. There may be some molecular mimicry between a bacterial surface molecule (such as glycoprotein with sialic acid) and a eukaryotic cellular receptor used by a virus for attachment [6]. In this study, the competition assay in which virus and probiotic bacteria are present in the culture medium side by side, exhibited the most pronounced antiviral activity in terms of cell survival (Figs. 2 and 4). This most pronounced antiviral activity most likely resulted from the sum of overlapping mechanisms at different time points before and after virus infection, as shown before, including interference with the adsorption of virus to the host cells, trapping of virus particles or inhibiting the effective adsorption of the virus to the target cells, and the stimulation of pro-inflammatory factors. The finding that the levels of all of the viral structural proteins were equivalently reduced after E. faecium treatment (Fig. 5) indicates that indeed fewer TGEV particles were released from these infected cells. Likewise, reduced synthesis of TGEV proteins may decrease the amount of virus-induced damage and subsequently also ameliorate the cytopathic effect in virus-infected ST cells, which logically must lead to a rescue of cell viability. As the competition assay was the most effective antiviral approach, we looked for possible direct mechanisms for the effect of probiotic treatment by looking for NO release from infected cells. We found that E. faecium could significantly induce NO release (Table 2). The antiviral effects of NO have been well studied for several viral infections [1, 8, 15–17]. Although NO production is believed to be released mainly in macrophages, we did detect an increase of NO release in ST cells upon treatment with E. faecium and TGEV, and this release of NO was dose dependent. This indicates that an induction of iNOS could indeed play a role in the mechanisms for our observation that E. faecium inhibits TGEV infection in ST cells. For the competition assay, we also compared expression of the antiviral cytokines IL-6 and IL-8. TGEV infection of ST cells without E. faecium did not significantly increased expression when compared to mock control. However, E. faecium treatment significantly increased the production of pro-inflammatory factors IL-6 and IL-8 in TGEV-infected ST cells. This result is consistent with those of other authors [14, 19, 25, 30, 40], who showed IL-6 or IL-8 production following the interaction of probiotics with the intestinal epithelium. Because IL-6 and IL-8 responses in intestinal epithelial cells play important roles in the pathogenesis and immune defense against enteric pathogens [21], the increased level of those cytokines could also possibly indicate an enhanced innate response. According to scientific opinion, probiotic concentrations between 106 and 108 CFU/g of intestinal contents are required to elicit potential benefits to the host [4, 27]. In feeding trials with piglets, concentrations of 106 - 107 CFU E. faecium/g digesta could be detected in the intestine [35]. Thus, although not directly comparable, the effective concentrations of E. faecium used in the present study are in a similar range, which adds to the relevance of these data. In conclusion, the results of the present study show that E. faecium inhibits TGEV replication in ST cells and that possibly overlapping mechanisms lead to the observed reduction of virus growth: direct interference with virus attachment, adsorptive trapping or inactivation of virus particles through surface components of the probiotic bacteria, and the stimulation of pro-inflammatory cytokines IL-6 and IL-8 as well as NO production. The data suggest that E. faecium may serve as a useful antiviral agent against infection with TGEV and possibly other viruses. Challenge experiments with different porcine viruses in piglets are under way to substantiate this hypothesis.
  39 in total

1.  Probiotics promote gut health through stimulation of epithelial innate immunity.

Authors:  Cristiano Pagnini; Rubina Saeed; Giorgos Bamias; Kristen O Arseneau; Theresa T Pizarro; Fabio Cominelli
Journal:  Proc Natl Acad Sci U S A       Date:  2009-12-14       Impact factor: 11.205

2.  Innate mechanisms for Bifidobacterium lactis to activate transient pro-inflammatory host responses in intestinal epithelial cells after the colonization of germ-free rats.

Authors:  Pedro A Ruiz; Micha Hoffmann; Silke Szcesny; Michael Blaut; Dirk Haller
Journal:  Immunology       Date:  2005-08       Impact factor: 7.397

3.  A heat labile soluble factor from Bacteroides thetaiotaomicron VPI-5482 specifically increases the galactosylation pattern of HT29-MTX cells.

Authors:  M Freitas; C Cayuela; J M Antoine; F Piller; C Sapin; G Trugnan
Journal:  Cell Microbiol       Date:  2001-05       Impact factor: 3.715

4.  Effect of probiotic strains on interleukin 8 production by HT29/19A cells.

Authors:  K M Lammers; U Helwig; E Swennen; F Rizzello; A Venturi; E Caramelli; M A Kamm; P Brigidi; P Gionchetti; M Campieri
Journal:  Am J Gastroenterol       Date:  2002-05       Impact factor: 10.864

5.  Non-pathogenic bacteria elicit a differential cytokine response by intestinal epithelial cell/leucocyte co-cultures.

Authors:  D Haller; C Bode; W P Hammes; A M Pfeifer; E J Schiffrin; S Blum
Journal:  Gut       Date:  2000-07       Impact factor: 23.059

6.  Interaction of probiotics and pathogens--benefits to human health?

Authors:  Seppo Salminen; Sonja Nybom; Jussi Meriluoto; Maria Carmen Collado; Satu Vesterlund; Hani El-Nezami
Journal:  Curr Opin Biotechnol       Date:  2010-04-21       Impact factor: 9.740

7.  Nitric oxide is elicited and inhibits viral replication in pigs infected with porcine respiratory coronavirus but not porcine reproductive and respiratory syndrome virus.

Authors:  Kwonil Jung; Ashita Gurnani; Gourapura J Renukaradhya; Linda J Saif
Journal:  Vet Immunol Immunopathol       Date:  2010-04-01       Impact factor: 2.046

8.  Uptake and toxic effects of heavy metal ions: interactions among cadmium, copper and zinc in cultured cells.

Authors:  S Meshitsuka; M Ishizawa; T Nose
Journal:  Experientia       Date:  1987-02-15

9.  Action mechanisms of lithium chloride on cell infection by transmissible gastroenteritis coronavirus.

Authors:  Xiaofeng Ren; Fandan Meng; Jiechao Yin; Guangxing Li; Xunliang Li; Chao Wang; Georg Herrler
Journal:  PLoS One       Date:  2011-05-06       Impact factor: 3.240

Review 10.  Macrophages and cytokines in the early defence against herpes simplex virus.

Authors:  Svend Ellermann-Eriksen
Journal:  Virol J       Date:  2005-08-03       Impact factor: 4.099

View more
  23 in total

1.  Dietary Enterococcus faecium NCIMB 10415 and zinc oxide stimulate immune reactions to trivalent influenza vaccination in pigs but do not affect virological response upon challenge infection.

Authors:  Zhenya Wang; Michael Burwinkel; Weidong Chai; Elke Lange; Ulrike Blohm; Angele Breithaupt; Bernd Hoffmann; Sven Twardziok; Juliane Rieger; Pawel Janczyk; Robert Pieper; Nikolaus Osterrieder
Journal:  PLoS One       Date:  2014-01-28       Impact factor: 3.240

2.  High-dose dietary zinc oxide mitigates infection with transmissible gastroenteritis virus in piglets.

Authors:  Weidong Chai; Silke S Zakrzewski; Dorothee Günzel; Robert Pieper; Zhenya Wang; Sven Twardziok; Pawel Janczyk; Nikolaus Osterrieder; Michael Burwinkel
Journal:  BMC Vet Res       Date:  2014-03-28       Impact factor: 2.741

3.  Anti-inflammatory effects of Lactococcus lactis NCDO 2118 during the remission period of chemically induced colitis.

Authors:  Tessalia Diniz Luerce; Ana Cristina Gomes-Santos; Clarissa Santos Rocha; Thais Garcias Moreira; Déborah Nogueira Cruz; Luísa Lemos; Adna Luciana Sousa; Vanessa Bastos Pereira; Marcela de Azevedo; Kátia Moraes; Denise Carmona Cara; Jean Guy LeBlanc; Vasco Azevedo; Ana Maria Caetano Faria; Anderson Miyoshi
Journal:  Gut Pathog       Date:  2014-07-29       Impact factor: 4.181

4.  Bacillus subtilis and surfactin inhibit the transmissible gastroenteritis virus from entering the intestinal epithelial cells.

Authors:  Xiaoqing Wang; Weiwei Hu; Liqi Zhu; Qian Yang
Journal:  Biosci Rep       Date:  2017-04-10       Impact factor: 3.840

5.  Gut probiotic Lactobacillus rhamnosus attenuates PDE4B-mediated interleukin-6 induced by SARS-CoV-2 membrane glycoprotein.

Authors:  Minh Tan Pham; Albert Jackson Yang; Ming-Shan Kao; Uuganbayar Gankhuyag; Enkhbat Zayabaatar; Shiow-Lian Catherine Jin; Chun-Ming Huang
Journal:  J Nutr Biochem       Date:  2021-07-13       Impact factor: 6.048

6.  The general composition of the faecal virome of pigs depends on age, but not on feeding with a probiotic bacterium.

Authors:  Jana Sachsenröder; Sven O Twardziok; Matthias Scheuch; Reimar Johne
Journal:  PLoS One       Date:  2014-02-19       Impact factor: 3.240

7.  Cell free preparations of probiotics exerted antibacterial and antibiofilm activities against multidrug resistant E. coli.

Authors:  Ahmed G Abdelhamid; Aliaa Esaam; Mahmoud M Hazaa
Journal:  Saudi Pharm J       Date:  2018-03-12       Impact factor: 4.330

8.  Antiviral effects of Lactobacillus ruminis SPM0211 and Bifidobacterium longum SPM1205 and SPM1206 on rotavirus-infected Caco-2 cells and a neonatal mouse model.

Authors:  Joo Yeon Kang; Do Kyung Lee; Nam Joo Ha; Hea Soon Shin
Journal:  J Microbiol       Date:  2015-10-28       Impact factor: 3.422

9.  Anti-TGEV Miller Strain Infection Effect of Lactobacillus plantarum Supernatant Based on the JAK-STAT1 Signaling Pathway.

Authors:  Kai Wang; Ling Ran; Tao Yan; Zheng Niu; Zifei Kan; Yiling Zhang; Yang Yang; Luyi Xie; Shilei Huang; Qiuhan Yu; Di Wu; Zhenhui Song
Journal:  Front Microbiol       Date:  2019-11-06       Impact factor: 5.640

Review 10.  The Interaction Between Viruses and Intestinal Microbiota: A Review.

Authors:  Zhiming Lv; Dongwei Xiong; Jichao Shi; Miao Long; Zeliang Chen
Journal:  Curr Microbiol       Date:  2021-08-04       Impact factor: 2.188

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.