Literature DB >> 23133562

In vitro site selection of a consensus binding site for the Drosophila melanogaster Tbx20 homolog midline.

Nima Najand1, Jae-Ryeon Ryu, William J Brook.   

Abstract

We employed in vitro site selection to identify a consensus binding sequence for the Drosophila melanogaster Tbx20 T-box transcription factor homolog Midline. We purified a bacterially expressed T-box DNA binding domain of Midline, and used it in four rounds of precipitation and polymerase-chain-reaction based amplification. We cloned and sequenced 54 random oligonucleotides selected by Midline. Electromobility shift-assays confirmed that 27 of these could bind the Midline T-box. Sequence alignment of these 27 clones suggests that Midline binds as a monomer to a consensus sequence that contains an AGGTGT core. Thus, the Midline consensus binding site we define in this study is similar to that defined for vertebrate Tbx20, but differs from a previously reported Midline binding sequence derived through site selection.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23133562      PMCID: PMC3485041          DOI: 10.1371/journal.pone.0048176

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The T-box family of transcription factors plays numerous developmental roles in metazoans [1]. Recent evidence shows that T-box genes are an ancient family of transcription factors that predate the appearance of the Metazoa [2]. The unifying domain in this gene family is a highly conserved ∼180 amino acid DNA binding domain, called the T-box, named after the founding member Brachyury (T). The Mouse T gene was also the first T-box transcription factor for which the DNA binding motif was identified [3]. The motif consists of a 24 base-pair (bp) palindrome which has come to be known as the T-site (AATTTCACACCT-AGGTGTGAAATT). Since then, several reports have shown that other T-box family members have some affinity for the full T-site, or the T half-site which consists of only half of the palindrome [4]. Site selection experiments have also been performed on Tbx5 [5], [6], Tbx6 [7], Xbra [8], Eomsodermin [8], VegT [8], Spt [9], Ntl [9], and Tbx20 [6]. Every one of these T-box proteins has a strong preference for oligonucleotides that contain a GGTGT core with some variability in the nucleotides flanking this core. In Drosophila melanogaster Midline (Mid) (Tbx20 in vertebrates) is involved in several aspects of development including segmentation, cardiogenesis, neurogenesis, and limb formation [10], [11], [12], [13], [14], [15], [16], [17]. However, the mechanisms by which Mid regulates these developmental processes is not well understood. To date, only four direct targets of Mid have been identified. These include components of the axon guidance pathway: Frazzled, Slit, and Robo [18]; and the segment polarity gene Wingless [19]. The direct regulation of Frazzled, Slit and Robo by Mid was discovered through identification of the Mid binding motif using site selection [18]. In that study, Liu et al. determined the Mid binding motif by incubating oligonucleotides with crude embryonic nuclear lysates and used an anti-Mid antibody to co-precipitate native Mid protein and the bound oligonucleotides. This experiment suggested that Mid selectively binds a 5′ GGAAGT consensus sequence (Figure 1B). The AGGT at positions 7–10 of this sequence (in bold) resembles the core AGGT found in the classic T-site. However, outside of this similarity many of the nucleotides within the core or flanking nucleotides do not match the T-site or other site selected T-box motifs, including the motif of the vertebrate homologue Tbx20 (Figure 1B). Strikingly, the nucleotide sequence GGTCAAG was present in 100% of the oligonucleotides selected by Mid, suggesting that there is an absolute requirement for the binding motif. However, no other T-box factors have displayed either a requirement or a preference for this sequence.
Figure 1

Comparison of previously identified motifs of midline and Tbx20.

A) A schematic of D. melanogaster Midline protein based on clone RE27439 drawn using Prosite MyDomains [42]. The fragment used in our analysis – green line (amino acids 171–393) spans the DNA binding T-box domain – blue box (amino acids 187–383). The EH1domain [19] in the N-terminal region is in orange. B) The DNA binding motif of mouse Tbx20 is derived from the site selection data presented by Macindoe et al. [6], while the mid DNA binding motif was generated from data by Liu et al. [18]. Comparison of the aligned motifs show that the two homologues only have positions 0–3 in common. Nucleotides at all other positions differ, suggesting that Drosophila Mid recognizes a different consensus sequence than that bound by other Tbx20 proteins. C) The binding consensus identified by Liu et al. (GGAAGTAGGTCAAG ) [18], full Brachyury palindrome (T-palindrome AATTTCACACCTAGGTGTGAAATT) [3] and the Tbx20 consensus derived by MacIndoe et al. (GGAGGTGTGAGGCGA) [6] were tested on an EMSA for interaction with the T-box domain of bacterially expressed Mid.

Through a site-selection experiment with bacterially expressed Mid T-box domain (Figure 1A) we identify a sequence similar to typical T-half sites but different from the site reported by Liu et al.

Comparison of previously identified motifs of midline and Tbx20.

A) A schematic of D. melanogaster Midline protein based on clone RE27439 drawn using Prosite MyDomains [42]. The fragment used in our analysis – green line (amino acids 171–393) spans the DNA binding T-box domain – blue box (amino acids 187–383). The EH1domain [19] in the N-terminal region is in orange. B) The DNA binding motif of mouse Tbx20 is derived from the site selection data presented by Macindoe et al. [6], while the mid DNA binding motif was generated from data by Liu et al. [18]. Comparison of the aligned motifs show that the two homologues only have positions 0–3 in common. Nucleotides at all other positions differ, suggesting that Drosophila Mid recognizes a different consensus sequence than that bound by other Tbx20 proteins. C) The binding consensus identified by Liu et al. (GGAAGTAGGTCAAG ) [18], full Brachyury palindrome (T-palindrome AATTTCACACCTAGGTGTGAAATT) [3] and the Tbx20 consensus derived by MacIndoe et al. (GGAGGTGTGAGGCGA) [6] were tested on an EMSA for interaction with the T-box domain of bacterially expressed Mid.

Results and Discussion

Mid T-box Domain does not Bind a GGTCAAG Motif in vitro

To investigate whether Mid is able to bind the novel T-box motif in vitro [18], we performed electro-mobility shift assays (EMSAs) using 5′ biotin-labeled oligonucleotides incubated with bacterially expressed, purified, C-terminal 6xHis-tagged Mid T-box domain (MidTbx) (Figure 1A). We used a 196 amino acid fragment of the full length Mid protein which contains the T-box domain because we were unable to express soluble, full length Mid. Research on other T-box transcription factors such as Tbx20 has been able to generate bonafide binding motifs using the DNA binding domain [6]. We found that MidTbx was able to bind and retard the migration of oligonucleotides containing either the Brachyury T-site or the vertebrate Tbx20 site. However, when MidTbx was incubated with the motif identified by Liu et al. (Figure 1B) we were unable to detect the presence of a lower mobility band (Figure 1C). This demonstrates that our bacterially expressed protein is capable of binding to DNA in vitro and that MidTbx has an affinity for the full T-site and the Tbx20 site but is unable to bind to the motif identified by Liu et al.

The MidTbx Binding Motif Resembles a Classic T-half-site

In order to determine the preferred sequences bound by Mid, we performed a site selection experiment. Using buffer conditions nearly identical to those described by Liu et al., we incubated double-stranded oligonucleotides containing a random 26 bp core flanked by 25 bp primer sequences with purified MidTbx. Following precipitation of the nucleo-protein complex using nickel beads and magnets, we washed off the unbound oligonucleotides, eluted the MidTbx-DNA complexes, and PCR amplified the selected fragments through 4 rounds of selection. We then cloned and sequenced 54 different oligonucleotides (Figure 2A). To reduce the background of oligonucleotides precipitated due to weak or non-specific binding, each cloned oligonucelotide was used to generate a biotin-labelled probe and tested by EMSA. Probes were considered unshifted if they failed to produce a visible band at least once in a minimum of three independent EMSAs (Figure 2B). MidTbx was able to shift 27 of the 54 cloned fragments in an EMSA (Figure 2B). Most (24/27) of the remaining probes displayed some evidence for binding to MidTbx such as the appearance of streaks along the edges of the gel lanes (Figure 2B arrows). However, this transient or weak binding was considered insufficient to include the sequence of those probes in our analysis.
Figure 2

Site selection workflow and EMSAs on cloned fragments.

A) Outline of the selection procedure carried out to determine the DNA binding motif of Mid. In the first round, oligonucleotides consisting of a random 26 nucleotide core flanked by primer sequences were incubated with midTbx. After purification and PCR amplification of co-precipitated fragments, the PCR amplified fragments were used in subsequent rounds of selection. B) All 54 oligonucleotide fragments were cloned and used as a template to create probes for EMSAs. Each probe was tested for recognition by MidTbx. Probes positive for shifts, such as 2, 4, 57, 67 and 57 were tested a minimum of two times. Probes negative for shifts, such as 5, 10, 22, 48, and 64 were tested 3–5 times to exclude the possibility of false negatives. Arrows point to streaks often seen in probes that were weakly bound. Probes that did not display a noticeable, shifted band were considered to be unrecognized.

Site selection workflow and EMSAs on cloned fragments.

A) Outline of the selection procedure carried out to determine the DNA binding motif of Mid. In the first round, oligonucleotides consisting of a random 26 nucleotide core flanked by primer sequences were incubated with midTbx. After purification and PCR amplification of co-precipitated fragments, the PCR amplified fragments were used in subsequent rounds of selection. B) All 54 oligonucleotide fragments were cloned and used as a template to create probes for EMSAs. Each probe was tested for recognition by MidTbx. Probes positive for shifts, such as 2, 4, 57, 67 and 57 were tested a minimum of two times. Probes negative for shifts, such as 5, 10, 22, 48, and 64 were tested 3–5 times to exclude the possibility of false negatives. Arrows point to streaks often seen in probes that were weakly bound. Probes that did not display a noticeable, shifted band were considered to be unrecognized. The corresponding sequences of the shifted probes were used to generate a binding motif using MEME software [20] and verified using SCOPE [21] and MochiView [22] (data not shown). Since all the probes were positive for an interaction with MidTbx, the parameters were set such that all 27 sequences were used to generate a motif. Our results show that MidTbx selects a 15 bp motif corresponding to the sequence [CG][ATG][AG][GA]GTG[TA][CGT][AG]A[GA]GCG or SDRRGTGWBRARGCG (Figure 3A). A similar analysis of the remaining sequences that do not shift MidT-box could not generate a binding motif using MEME (data not shown). However, manual inspection of the sequences showed that most had sequences that resemble consensus T-box sites, suggesting that they may have been included in the selected oligonucleotides because of weak affinity for MidTbx.
Figure 3

DNA motif selected by MidTbx.

A) The sequence logo corresponding to the oligonucleotide selected by MidTbx after 4 rounds of selection. The 27 EMSA verified sequences and the flanking primer sequences for some were input into MEME. MEME was set to use each nucleotide once and to generate a motif with a maximum length of 26 nucleotides. Region 1 and 2 are underlined in black and blue respectively. B) Aligned sequences of the 27 oligonucleotides used to generate the motif in A. The 15 nucleotides present in A are colour coded according to the nucleotide. Flanking sequences are in black. Nucleotides within the random 26 bp core are in uppercase, while those found within the primer sequences are in lowercase. The second potential MidTbx binding site in oligonucleotides represented by clones 2, 8, 42, 74, and 75, has been underlined. C) An EMSA using the 15 base pair consensus motif identified in this study. The migration of oligonucleotides with wild-type Mid binding motif (CAAGGTGTCAAGGCG) is slowed in the presence of MidTbx. However, MidTbx does not appear to have an affinity for oligonucleotides where region 1 has been mutated (CACCCCCCCAAGGCG). Oligonucleotides mutant for region 2 (CAAGGTGTCAAGGAA) are still bound and retarded by MidTbx.

DNA motif selected by MidTbx.

A) The sequence logo corresponding to the oligonucleotide selected by MidTbx after 4 rounds of selection. The 27 EMSA verified sequences and the flanking primer sequences for some were input into MEME. MEME was set to use each nucleotide once and to generate a motif with a maximum length of 26 nucleotides. Region 1 and 2 are underlined in black and blue respectively. B) Aligned sequences of the 27 oligonucleotides used to generate the motif in A. The 15 nucleotides present in A are colour coded according to the nucleotide. Flanking sequences are in black. Nucleotides within the random 26 bp core are in uppercase, while those found within the primer sequences are in lowercase. The second potential MidTbx binding site in oligonucleotides represented by clones 2, 8, 42, 74, and 75, has been underlined. C) An EMSA using the 15 base pair consensus motif identified in this study. The migration of oligonucleotides with wild-type Mid binding motif (CAAGGTGTCAAGGCG) is slowed in the presence of MidTbx. However, MidTbx does not appear to have an affinity for oligonucleotides where region 1 has been mutated (CACCCCCCCAAGGCG). Oligonucleotides mutant for region 2 (CAAGGTGTCAAGGAA) are still bound and retarded by MidTbx. The most frequent nucleotide at each position results in CA as a consensus MidTbx binding motif. This motif is comprised of two regions where MidTbx displays a strong preference for particular nucleotides. Region 1 (Figure 3A – black underline) spans positions 3–8 and consists of an AGGTGT sequence identical to the T-half-site. Region 2 (Figure 3A – blue underline) consists of a CG at positions 14 and 15. The two regions are separated by 5 bases where there is a less strict requirement for particular nucleotides. The nucleotides in region 1 (3–8) resemble the T-half-site that MidTbx is able to bind specifically (Figure 1C). Furthermore, region 1 is similar to sites selected by other T-box family members [5], [6], [7], [8], [9]. In region 1, MidTbx has a strong requirement for a GTG at positions 5–7 with the T at position 6 occasionally being substituted for a C. This substitution is not correlated to the presence of another nucleotide at other positions within the motif. Positions 3 and 4 appear to be more variable, most commonly consisting of purines while position 8 is often a T or A. This demonstrates that MidTbx binds to a motif recognized by other members of the T-box family. Region 2, consisting of CG at positions 14 and 15 has not yet been found in the binding motif of other T-box genes. We considered whether the presence of the CG was an artifact since it often appears in the primer sequence included in our analysis (Figure 3B). Two lines of evidence demonstrate that this is likely not the case. First, analysis of the same 27 clones without the primer sequences using MEME still produces a motif with a CG at positions 14 and 15 (not shown). This demonstrates that MidTbx selects a CG dinucleotide at positions 14 and 15 within the random 26 nucleotide core or primer sequence. Second, the number of nucleotides between region 2 and region 1 is invariant between the clones. If region 2 was not specifically selected by MidTbx, we would expect region 1 to vary in its location with respect to the primer sequence. However, since the spacing between region 1 and 2 is always exactly 5 nucleotides, we argue that there is a real preference for a CG dinucleotide at positions 14 and 15. However, there is not an absolute requirement for a CG in region 2 since MidTbx can bind to clones 43, 50 and 72 which lack it (Figure 3). In addition, MidTbx can bind the T-site and the Tbx20 motif, which both lack a CG (Figure 1C). The mouse Tbx20 site does contain a CG dinucleotide (GGAGGTGTGAGG), but it is not as frequently represented as the CG in the Mid consensus and it is shifted over by one position such that it corresponds to nucleotides 13 and 14 numbered with respect to the Mid motif. Furthermore, the CG in the mouse Tbx20 motif is likely an artifact since it falls in the primer region. In order to test whether region 2 is necessary for binding, we generated a 15 base oligonucleotide corresponding to our consensus (CA). The bases in region 1 or region 2 (underlined) were mutated in order to assess their effect on binding (Figure 3C). We found that mutating region 1 disrupted binding of MidTbx on an EMSA, suggesting that region 1 is necessary and region 2 is not sufficient. Mutating the CG of region 2 did not appear to affect binding on an EMSA, suggesting that region 1 is necessary and region 2 is not. There is no strong requirement for specific nucleotides between regions 1 and 2, as most nucleotides are represented at each position. Three of the four possible nucleotides are permitted while one is excluded at each position except at position 10, where MidTbx seems to favour a purine.

MidTbx Binds as a Monomer to the Identified Motif

Previous studies on members of the T-box transcription factor family have shown that T-box genes such as human Tbx2 [23], Tbx3 [24], [25], Tbx5 [5], and mouse T [3], [26], T-bet [27], Tbx2 [28], Tbx6 [7] and Tbx20 [6] bind as monomers. Examples of T-box factors that bind DNA as dimers include human Tbx1 [23], Tbx6 [29] and Xbra [8], [23], [30]. Our data suggests that MidTbx binds DNA as a monomer. On EMSAs we only observe one band when Mid is bound to the palindromic T-site which consists of two potential binding sites (Figure 1C). Transcription factors that bind DNA as a homodimer often display two bands on an EMSA - a higher mobility band belonging to a single protein bound to the DNA, and a lower mobility band representing a homodimer bound DNA. Some examples of T-box proteins displaying multiple EMSA bands on oligonucleotides with more than one binding site include T, Tbx5 and Tbx6 [5], [29], [31]. It is unlikely that the single band present in our study is due to an inability of MidTbx to bind DNA as a monomer, since the single band appears at the same mobility as MidTbx bound to the Tbx20 motif which contains only a single potential T-site (Figure 1C). Furthermore, we observe that MidTbx is able to bind a Tbx20 motif that consists of only a “half-site” suggesting that a “full-site” containing two potential binding motifs is not necessary and thus MidTbx is not an obligate dimer. Finally, 22 out of 27 oligonucleotides selected in our study only contain one apparent T-site while five others (clones 2, 8, 42, 74 and 75) have two sites present in different orientations and spacing (Figure 3B). This suggests that each site was selected by a MidTbx monomer rather than a dimer, which would impose strict requirements on orientation and spacing. The five oligonucleotides with more than one potential binding site show only a single band on EMSAs. Because this band has the same mobility as oligonucleotides with only a single binding site, it suggests that either the two MidTbx monomers bound to a single oligonucleotide are not sufficiently stable to resolve on a gel, or that one monomer sterically hinders the binding of another, or that there is enough excess probe that the proteins always bind a unique probe. The sequences necessary for dimerization in other T-box factors are not conserved in Mid, which is also consistent with Mid binding as a monomer (Figure 4). Xbra homodimerizes through a relatively small interface of 250 Å2 found near the centre of the T-box domain [30]. The small polar N129 residue in Xbra is replaced with a large hydrophobic F281 in Mid and F130 in Xbra is replaced by S282 in Mid. Likewise Xbra M85 is substituted with R235, and Xbra V173 corresponds to L326 in Mid. Overall, 4 of the 8 dimerization residues are not conserved in Drosophila Mid. Furthermore, Tbx20 also differs from both Mid and Xbra at these same 4 positions (Figure 4). The crystal structure of Tbx3 bound to a palindromic T-site shows that the two monomers are rotated with respect to one another on the DNA strand and use different residues (238–241 on Tbx3) to contact one another [25]. These residues fall within a poorly conserved region of the T-box domain. Comparison to the corresponding Mid residues (327–330) shows that none of these amino acids are conserved (Figure 4). Similarly, only Tbx3 D239 is identical to the corresponding Tbx20 residue. The small monomer-monomer contacts defined in the Tbx3 crystal structure are thought to be insufficient to facilitate dimerization and as such, Tbx3 is believed to bind as a monomer [25]. Finally, the crystal structure of Tbx5 bound to a half-site shows that the regions responsible for monomer-monomer contacts in Tbx3 have low electron density suggesting that these domains are conformationally flexible and thus are unlikely to be in involved in dimerization [32].
Figure 4

Protein sequence alignment of the T-box domain of select T-box genes.

The T-box domain of Mid is aligned with its vertebrate homologue Tbx20 as well as T-box genes for which the crystal structure has been solved (obtained from Pfam and modified to remove gaps [43]). Amino acid residues conserved in all 5 members are in dark blue, while those found in 4 out of 5 are in a lighter shade of blue. Residues implicated in direct interactions with the DNA based on the crystal structures of Tbx3, Tbx5 and Xbra are highlighted in black [25], [30], [32]. Those that are involved in dimerization or monomer-monomer contacts in the Xbra cystals are highlighted in brown [25], [30]. Amino acids involved in the small monomer interface of Tbx3 are highlighted in red.

Protein sequence alignment of the T-box domain of select T-box genes.

The T-box domain of Mid is aligned with its vertebrate homologue Tbx20 as well as T-box genes for which the crystal structure has been solved (obtained from Pfam and modified to remove gaps [43]). Amino acid residues conserved in all 5 members are in dark blue, while those found in 4 out of 5 are in a lighter shade of blue. Residues implicated in direct interactions with the DNA based on the crystal structures of Tbx3, Tbx5 and Xbra are highlighted in black [25], [30], [32]. Those that are involved in dimerization or monomer-monomer contacts in the Xbra cystals are highlighted in brown [25], [30]. Amino acids involved in the small monomer interface of Tbx3 are highlighted in red. Taken together, the site selection data and the comparison of the Mid amino acid sequence with evidence from the crystal structures of the Xbra, Tbx3 and Tbx5 suggest that Mid binds DNA as a monomer. We have also found that Mid is able to directly regulate the transcription of the wingless gene, in vivo, by binding to sequences within the wg enhancer [19]. The sequences Mid binds in order to regulate wg resemble the motif we present in this study (Figure 3). These in vivo Mid binding sites provide additional evidence that Mid is acting as a monomer.

Discrepancy with Previously Reported Mid Binding Motif

The motif we identified does not contain the AGGTCAAG sequence identified by Liu et al. [18]. Furthermore, the AGGTCAAG motif was not detected in any of the oligonucleotides recovered in our site selection (Figure 3), nor was our purified protein able to shift the Liu et al. sequence on an EMSA (Figure 1C). The striking difference between the two motifs could arise for a number of reasons. First, in our study we used a bacterially expressed, C-terminally 6xHis-tagged Mid T-box domain (Figure 1A) whereas the previous motif was identified using a full-length protein purified from Drosophila nuclear lysates. It is possible that the full-length protein has different binding properties compared to the T-box domain. However, our motif resembles those from other studies which have used either full-length or the T-box domain of T-box genes to generate a binding motif [3], [5], [7], [8], [9], [33], [34]. This suggests that using the Mid DNA-binding domain should produce a valid binding motif. Purification of native protein from nuclear lysates has the additional caveats that the purified protein may be post-translationally modified and that additional co-factors may be co-purified. While little is known about their post-translational modification, T-box factors have been shown to bind a variety of transcriptional co-factors. For example, Mid can bind the cardiac transcription factors Tinman and Pannier [35] while Tbx20 can bind the vertebrate homologues Nkx2.5 and Gata4 [33]. Mid and mouse Tbx15 and Tbx18 (closely related to Tbx20) bind the Groucho/Tle co-repressor [19], [34] and Mouse Tbx20, Tbx5 and Xbra have been shown to bind Smads [36], [37]. Tpit can bind the homeodomain protein Pitx [38] and VegT can physically interact with Tcf3 [39]. However, it is not known whether these factors influence the preferred T-box binding site. Furthermore, the predicted binding site for mouse Tbx20 generated from a genome-wide ChIP-seq experiment is very similar to other T-box consensus sequences including our own [40]. This makes it seem less likely that the differences between our study and that of Liu et al. are simply due to the source of the protein. Finally, it is possible that non-specific binding of the antibody to other proteins within the lysate may in fact produce a motif for a different protein than that being studied. This possibility may explain the discrepancy between the Liu et al. motif and all other T-box transcription factors including the motif identified for Mid in the present study.

Conclusions

T-box transcription factors have been shown to bind variations of the 24 bp palindromic Brachyury DNA binding motif called the T-site. It has been suggested that the specificity of T-box proteins for particular binding sites arises from the spacing and orientation of the two half-sites as well as the nucleotides flanking the core AGGTGT of each half-site [8]. We employed a site selection technique and identified DRRGTGWBRARGCG as the DNA binding motif for the Drosophila melanogaster Mid protein (Figure 3). The CG found at positions 14 and 15 in this motif appear to be specifically selected by MidTbx but are not essential for binding in an EMSA (Figure 3C). The motif identified in Figure 3 resembles that of most other T-box transcription factors and in particular is very close to the motif identified for the vertebrate homologue of Mid, Tbx20 [6]. It does not, however, resemble the motif previously identified for Mid (Figure 1B) [18]. Furthermore, we find that MidTbx is unable to shift the sequence identified by Liu et al. in an EMSA (Figure 1C). Based on our results and analysis we propose that Mid binds DNA targets as a monomer. Five lines of evidence support this hypothesis: 1) Most oligonucleotides had a single site and when two half-sites were found (4/27 oligonucleotides) they were oriented and spaced randomly with respect to one another; 2) MidTbx is able to bind oligonucleotides containing only a single binding site; 3) EMSAs using oligonucleotides containing two potential binding sites only display a single band that runs at approximately the same mobility as MidTbx bound to a half-site; 4) The residues required for dimerization of Xbra and the non-stabilizing monomer-monomer contacts of Tbx3 are not conserved in Mid; 5) in vivo binding sites responsive to Mid are half-sites [19]. The possibility that region 2 in our motif is a variant half-site bound by a second MidTbx monomer cannot be excluded and therefore a crystal structure of MidTbx bound to this motif would be necessary to definitively conclude the nature of the MidTbx-DNA complex.

Materials and Methods

Expression of Mid T-box Domain

Drosophila melanogaster Midline T-box domain (residues 171–393), containing the T-box domain, were PCR amplified from clone RE27439 using 5′ GGGGCCGGATCCCATATGGCACCCAAAATTGTCGGCTCCTGCAAT and 5′ GGGGCCCTCGAGCATCGGATCGCGATCGAAGTCGGTGAGGCG primers. The PCR product was digested with Nde I and Xho I and ligated to a pET-21a vector digested with the same enzymes, resulting in a C-terminal 6xHis-tagged Mid T-box domain. 25 ml of Lauri-Bertani medium was inoculated with an overnight culture of Rosetta-gami cells (Novagen) transformed with the MidTbx in pET-21a, grown to an OD of 0.6 and induced with 0.5 mM IPTG. After 3 hours the cells were harvested, resuspended and lysed in 500 µl of buffer containing 20 mM HEPES pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.2 mM EGTA, 10% glycerol, 0.5 mM DTT, 10 mM imidazole and Complete EDTA-free protease inhibitor (Roche). The lysate was added to 300 µl of Ni-NTA magnetic agarose beads (Qiagen) with the original buffer removed and rocked on ice for 1 hour. The beads were washed 3 times and eluted in the same buffer as above except the washes and elution buffers contained 20 mM and 250 mM of imidazole respectively.

Site Selection

Site selection was carried out essentially as described [28] with modifications such that it could be carried out non-radioactively. Oligonucleotide R76: CAGGTCAGTTCAGCGGATCCTGTCG(N26)GAGGCGAATTCAGTGCAACTGCAGC, which consists of a 26 nucleotide random core flanked by primer sequences was rendered double stranded using Taq DNA polymerase and primer F (GCTGCAGTTGCACTGAATTCGCCTC), and was purified using High Pure PCR Cleanup Micro Kit (Roche). A 25 µl reaction containing 0.4 ng of purified, double-stranded primer F, 550 ng of purified 6x-His MidTbx protein and binding buffer (20 mM HEPES pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.2 mM EGTA, 20% glycerol, 0.1% Nonidet P40, 0.5 mM DTT, 10 mg/ml BSA, 8 ng/µl poly(dI-dC)•poly(dI-dC)) was assembled and incubated at room temperature for 1 hr. The reaction was added to 10 µl of 5% Ni-NTA magnetic beads (Qiagen) which were washed with binding buffer prior to adding the reaction. The beads were allowed to bind the nucleoprotein complex for 1 hr then washed with 400 µl of wash buffer (20 mM HEPES pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.2 mM EGTA, 20% glycerol, 0.1% nonidet P40, 0.5 mM DTT, 20 mM imidazole) for 5 min. Following the wash, the bound nucleoprotein complexes were eluted with elution buffer (wash buffer with 250 mM imidazole). 10 µl of the purified complex was PCR amplified with primer F and primer R (CAGGTCAGTTCAGCGGATCCTGTCG) for 15 cycles. The amplification product was purified using High Pure PCR Cleanup Micro Kit (Roche) and quantified using Picogreen (Invitrogen). 0.2 ng of the purified oligonucleotide was used in subsequent rounds of site selection. After 4 rounds of selection, the PCR amplified oligonucleotides were ethanol precipitated and cloned into pCRII-TOPO or pCR2.1-TOPO using TOPO-TA cloning (Invitrogen). Each pCRII or pCR2.1 clone was then sequenced using M13-reverse or M13-forward primers respectively. In total, 54 clones generated usable sequences.

Motif Generation

The 27 clones which tested positive for binding to Mid in an EMSA were entered into MEME to generate a motif [10]. The relevant parameters were set such that every sequence was used once to generate a motif with a length of 6–26 nucleotides. The sequences of primer F and primer R were used as negative sequences. Motifs in. Figure 1B were generated using WebLogo [41]. Sequences for the Tbx20 motif were obtained from MacIndoe et al. [6], while those for Mid were generated from data from Liu et al. [18].

Non-Radioactive Electro-mobility Shift Assays

Probes used for EMSAs were generated from pCRII or pCR2.1 clones by PCR amplification of the cloned oligonucleotide using 5′-biotin-labelled primer F and primer R (see above for sequence). The PCR product was phenol/chloroform extracted and ethanol precipitated in the presence of glycogen. The T-site probe corresponding to the Bs.p palindrome (AATTTCACACCTAGGTGTGAAATT) was obtained as a self-complimentary primer with 5′ biotin labels. Tbx20.MacIndoe (GGAGGTGTGAGGCGA and TCGCCTCACACCTCC), mid.Liu (GGAAGTAGGTCAAG and CTTGACCTACTTCC), mid.Najand (CAAGGTGTCAAGGCG and CGCCTTGACACCTTG), mid.Najand Region 1 (CACCCCCCCAAGGCG and CGCCTTGGGGGGGTG) and mid.Najand Region 2 (CAAGGTGTCAAGGAA and TTCCTTGACACCTTG) were ordered as 5′ biotin-labelled primers and annealed to their complement in 1X Taq polymerase buffer. A 10 µl reaction containing 15 fmol of each biotin-labeled probe, 375 ng of purified 6x-His MidTbx and binding buffer (20 mM HEPES pH 7.9, 100 mM KCl, 0.2 mM EDTA, 0.2 mM EGTA, 20% glycerol, 0.1% nonidet P40, 0.5 mM DTT, 10 mg/ml BSA, 8 ng/µl poly(dI-dC)•poly(dI-dC)) was assembled and incubated at room temperature for 1 hr. The sample was loaded onto a 8×10 cm 5% polyacrylamide, 2.5% glycerol gel in 0.5X TAE running buffer, pre-run at 85V for 1 hour. mid.Najand oligonucleotides were run on a 10% polyacrylamide gel containing 10% glycerol. Once loaded the sample was run for 5 min at 120 V and 1 hour at 85 V for 5% gels, and 2 hours for 10% gels. The oligonucleotide was transferred onto a Hybond-N+ nylon membrane (Amersham) at 85 V for 30 min in 0.5X TAE. Following transfer, the oligonucleotides were cross-linked to the membrane using a transilluminator and visualized using the chemiluminescent nucleic acid detection module (Pierce) according to the manufacturer’s directions. All probes were run a minimum of 2 times to confirm that MidTbx is able to bind and retard their mobility. Probes that showed no binding were run 3–5 times to ensure a negative result.
  43 in total

Review 1.  T-box genes in development: from hydra to humans.

Authors:  V E Papaioannou
Journal:  Int Rev Cytol       Date:  2001

2.  PROSITE: a documented database using patterns and profiles as motif descriptors.

Authors:  Christian J A Sigrist; Lorenzo Cerutti; Nicolas Hulo; Alexandre Gattiker; Laurent Falquet; Marco Pagni; Amos Bairoch; Philipp Bucher
Journal:  Brief Bioinform       Date:  2002-09       Impact factor: 11.622

3.  Structural basis of TBX5-DNA recognition: the T-box domain in its DNA-bound and -unbound form.

Authors:  Christian U Stirnimann; Denis Ptchelkine; Clemens Grimm; Christoph W Müller
Journal:  J Mol Biol       Date:  2010-05-05       Impact factor: 5.469

4.  POU-V factors antagonize maternal VegT activity and beta-Catenin signaling in Xenopus embryos.

Authors:  Ying Cao; Doreen Siegel; Cornelia Donow; Sigrun Knöchel; Li Yuan; Walter Knöchel
Journal:  EMBO J       Date:  2007-05-31       Impact factor: 11.598

5.  Functions of the segment polarity genes midline and H15 in Drosophila melanogaster neurogenesis.

Authors:  Marita Buescher; Murni Tio; Guy Tear; Paul M Overton; William J Brook; William Chia
Journal:  Dev Biol       Date:  2006-02-23       Impact factor: 3.582

6.  Conformational stability and DNA binding specificity of the cardiac T-box transcription factor Tbx20.

Authors:  Ingrid Macindoe; Laura Glockner; Paul Vukasin; Fiona A Stennard; Mauro W Costa; Richard P Harvey; Joel P Mackay; Margaret Sunde
Journal:  J Mol Biol       Date:  2009-05-03       Impact factor: 5.469

7.  The Tbx20 homolog Midline represses wingless in conjunction with Groucho during the maintenance of segment polarity.

Authors:  Ann Formaz-Preston; Jae-Ryeon Ryu; Pia C Svendsen; William J Brook
Journal:  Dev Biol       Date:  2012-07-16       Impact factor: 3.582

8.  Structure of the DNA-bound T-box domain of human TBX3, a transcription factor responsible for ulnar-mammary syndrome.

Authors:  Miquel Coll; Jonathan G Seidman; Christoph W Müller
Journal:  Structure       Date:  2002-03       Impact factor: 5.006

9.  The T-box repressors TBX2 and TBX3 specifically regulate the tumor suppressor gene p14ARF via a variant T-site in the initiator.

Authors:  Merel E Lingbeek; Jacqueline J L Jacobs; Maarten van Lohuizen
Journal:  J Biol Chem       Date:  2002-05-08       Impact factor: 5.157

10.  The T protein encoded by Brachyury is a tissue-specific transcription factor.

Authors:  A Kispert; B Koschorz; B G Herrmann
Journal:  EMBO J       Date:  1995-10-02       Impact factor: 11.598

View more
  3 in total

1.  midline represses Dpp signaling and target gene expression in Drosophila ventral leg development.

Authors:  Lindsay A Phillips; Markle L Atienza; Jae-Ryeon Ryu; Pia C Svendsen; Lynn K Kelemen; William J Brook
Journal:  Biol Open       Date:  2022-05-24       Impact factor: 2.643

2.  The expression of the T-box selector gene midline in the leg imaginal disc is controlled by both transcriptional regulation and cell lineage.

Authors:  Pia C Svendsen; Jae-Ryeon Ryu; William J Brook
Journal:  Biol Open       Date:  2015-11-18       Impact factor: 2.422

3.  Dynamics of promoter bivalency and RNAP II pausing in mouse stem and differentiated cells.

Authors:  Anna Mantsoki; Guillaume Devailly; Anagha Joshi
Journal:  BMC Dev Biol       Date:  2018-02-20       Impact factor: 1.978

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.