Discovery of bla(OXA-199), a chromosome-based bla(OXA-48)-like variant, in Shewanella xiamenensis.

INTRODUCTION: bla(OXA-48) is a globally emerging carbapenemase-encoding gene. The progenitor of bla(OXA-48) appears to be a Shewanella species. The presence of the bla(OXA-48)-like gene was investigated for two Shewanella xiamenensis strains.
METHODS: Strain WCJ25 was recovered from post-surgical abdominal drainages, while S4 was the type strain of S. xiamenensis. Species identification for WCJ25 was established by sequencing the 16S rDNA and gyrB genes. PCR was used to screen the bla(OXA-48)-like genes and to obtain their complete sequences. A phylogenetic tree of the bla(OXA-48)-like genes was constructed. The genetic context of the bla(OXA-48)-like gene in strain WCJ25 was investigated by inverse PCR using self-ligated AseI- or RsaI-restricted WCJ25 DNA fragments as template, while that in strain S4 was determined by PCR mapping using that in WCJ25 as template.
RESULTS: A new bla(OXA-48) variant, designated bla(OXA-48b), with four silent nucleotide differences from the bla(OXA-48) (designated bla(OXA-48a)) found in the Enterobacteriaceae was identified in strain S4. Strain WCJ25 had a new bla(OXA-48)-like variant, bla(OXA-199), with five nucleotide differences from bla(OXA-48)a and bla(OXA-48b). The OXA-199 protein has three amino acid substitutions (H37Y, V44A and D153G) compared with OXA-48. Both bla(OXA-48b) and bla(OXA-199) were found adjacent to genes encoding a peptidase (indicated as orf), a protein of unknown function (sprT), an endonuclease I (endA), and a ribosomal RNA methyl transferase (rsmE) upstream and to transcriptional regulator gene lysR and an acetyl-CoA carboxylase-encoding gene downstream. In addition, the insertion sequence ISShes2 was found inserted downstream of bla(OXA-199) but not of bla(OXA-48b). The 26 bp sequences upstream and 63 bp downstream of bla(OXA-48a), bla(OXA-48b) and bla(OXA-199) were identical.
CONCLUSIONS: bla(OXA-48a), bla(OXA-48b) and bla(OXA-199) might have a common origin, suggesting that the bla(OXA-48a) gene found in the Enterobacteriaceae could have originated from the chromosome of S. xiamenensis.

Introduction

bla OXA-48, encoding the carbapenem-hydrolyzing enzyme OXA-48, was initially found in Klebsiella pneumoniae from Turkey [1] and has now been spread to other Enterobacteriaceae species in a few countries [2], [3]. Several bla OXA-48-like variants have been identified recently, including bla OXA-162 (GenBank Accession no. GU197550; one nucleotide different from bla OXA-48), bla OXA-163 (98.1% nucleotide identity with bla OXA-48) [4], bla OXA-181 (94.4% nucleotide identity with bla OXA-48) [5], bla OXA-204 (nucleotide sequence not available but encoding two amino acid substitutions compared with OXA-48) and bla OXA-232 (nucleotide sequence not available but encoding a single amino acid substitution compared with OXA-181) [3]. The bla OXA-48 gene was previously proposed as been derived from the chromosome-encoded bla OXA-54 of Shewanella oneidensis, but the two genes have only 84% nucleotide identity [6]. Through analyzing the complete genome sequences of a few strains belonging to various Shewanella species available in the GenBank, the bla OXA-48-like genes are present on the chromosome of several Shewanella species with at least 80% identity to bla OXA-48. Thus, the actual progenitor of bla OXA-48 may rather lie within a Shewanella species other than S. oneidensis. A Shewanella clinical strain previously isolated and characterized [7] and the type strain of Shewanella xiamenensis [8] were investigated for the presence of a bla OXA-48-like gene.

Methods

Strains

Shewanella isolate WCJ25 was recovered from post-surgical abdominal drainages of a patient with pancreatitis and was identified as S. xiamenensis based on the close identity (99.6% for 16S rDNA gene and 98.5% for gyrB) between WCJ25 and the S. xiamenensis type strain S4 [7]. The S. xiamenensis type strain S4 was provided by Prof. Zhang Xiaobo, Zhejiang University.

Screening for bla OXA-48-like Genes

PCR was used to screen bla OXA-48-like genes and to obtain the complete sequence of the bla OXA-48-like gene with primers listed in Table 1. PCR was conducted using the ExTaq mix (Takara, Dalian, China) with the conditions being 94°C for 5 min, 30 cycles (94°C for 30s, 52°C for 45 s, 72°C for 1 min) and a final elongation step at 72°C for 7 min. The amplicons were purified using the OMEGA Cycle Pure kit (Norcross, GA, USA) and sequenced.

Table 1

Primers used.

Primer	Sequence 5′-3′	Target	Source
OXA48/54IF	AGCAAGGATTTACCAATAAT	bla OXA-48-like genes,	Valenzuela JK
OXA48/54IR	GGCATATCCATATTCATC	screening	unpublished
OXA48-up1	ATTAAGCAAGGGGACGTTATG	bla OXA-48-like genes,	This study
OXA48-dw1	GAGCATCAGCATTTTGTCCA	complete sequences	This study
OXA48-IR2	GCAACTACGCCCTGTGATTT	bla OXA-48-like genes	This study
OXA48-dw2	GTTAGCGCGTATTTGTGTG	Downstream of bla OXA-199	This study
OXA199-up1	TAAGCCTGAACGCCCTAGAA	Upstream of bla OXA-199	This study
tnpA_Shewa-R1	AATAGTTTCGGCAGGGGTTT	tnpA of ISShes2	This study
orfJ25-R1	ACGGCTAATGGTTGAGGTTG	rsmE	This study
Orf25-R2	CCGTCATAGCGATTTCTTCC	rsmE	This study
aceCoA-R2	TTGGGCAATAAAGCCGATAC	acc	This study

Phylogenetic Analysis of the bla OXA-48-like Genes

Sequences of bla OXA-48-like genes were retrieved from GenBank. The bla OXA-48-like genes and their accession numbers are bla OXA-48 (AY236073), bla OXA-54 (AY500173), bla OXA-55 (AY343493), bla OXA-162 (GU197550), bla OXA-163 (HQ700343), bla OXA-181 (JN205800) and those without assigned gene names on chromosomes of Shewanella spp., i.e., S. algae oxaSH (AY066004), S. baltica BA175 (CP002767), S. baltica OS117 (CP002811), S. baltica OS155 (CP000563), S. baltica OS185 (CP000753), S. baltica OS195 (CP000891), S. baltica OS223 (CP001252), S. baltica OS678 (CP002383), S. loihica PV-4 (CP000606), S. oneidensis MR-1 (AE014299), S. putrefaciens CN-32 (CP000681), S. putrefaciens 200 (CP000681), Shewanella sp. ANA-3 (CP000469), Shewanella sp. MR-4 (CP000446), Shewanella sp. MR-7 (CP000444) and Shewanella sp. W3-18-1 (CP000563). A phylogenetic tree of the bla OXA-48-like genes was constructed using the MEGA 4.0 program [9] using the neighbour-joining method and bootstrapping (value 100) (Figure 1).

Figure 1

Neighbour-joining tree of bla OXA-48-like genes.

Constructed using the MEGA 4.0 program with bootstrap values and the bar of distance indicated. The host species and strains for the chromosome-encoded genes are indicated. Of note, bla OXA-181 has also been found in the Enterobacteriaceae [10]. It appears that bla OXA-48a, bla OXA-162 and bla OXA-163 have the S. xiamenensis origin.

Study on Genetic Context

The genetic context study of bla OXA-199 was investigated using inverse PCR. Genomic DNA of WCJ25, prepared using a commercial kit (Tiangen, Beijing, China), was restricted with AseI- or RsaI (Figure 2), self-ligated with T4 DNA ligase (New England Biolabs, Ipswich, NY, USA) and then used as a template for inverse PCR. The links between genetic elements were confirmed by overlapping PCR (Figure 2, primers listed Table 1). The genetic context of bla OXA-48 in the strain S4 was characterized by PCR mapping using that of bla OXA-199 as the template (Figure 2). Primers were designed based on available sequences using the primer3 software (http://frodo.wi.mit.edu/primer3/) with the default settings. Inverse PCR, overlapping PCR and PCR mapping were also conducted using the ExTaq mix with the conditions being 94°C for 5 min, 30 cycles (94°C for 30s, 55°C for 45 s, 72°C for 5 min) and a final elongation step at 72°C for 7 min.

Figure 2

Genetic contexts of bla OXA-199 and bla OXA-48.

The orientations of insertion sequences are indicated using arrows and the IRs are depicted as poles. Amplicons and sizes for PCR mapping are shown. Panel A, the genetic context of bla OXA-199. Restriction sites of enzymes that were used to generate DNA fragments as templates for inverse PCR are indicated. Common structures in the contexts of bla OXA-199, bla OXA-48b and bla OXA-48a are illustrated by broken lines. ISShes2 is inserted between bla OXA-199 and lysR, generating 3-bp DR (CCT). The acc gene was only partially sequenced. The gene encoding peptidase C15 is indicated as ‘orf’. Panel B, the genetic context of bla OXA-48b in S. xiamenensis strain S4. Panel C, the genetic context of bla OXA-48a in K. pneumoniae strain 11978 (AY236073). Two copies of IS1999 formed a composite transposon and was inserted into the tir gene (responsible for transfer inhibition), which is part of the IncFII plasmid backbone, generating 9-bp DR (CGTTCAGCA). Panel D, the alignment of right-hand IR (IRR) and left-hand IR (IRL) of ISShes2.

Amplicons were sequenced using an ABI 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA) at the Beijing Genomics Institute (Beijing, China). Sequences were assembled using the SeqMan II program in the Lasergene package (DNASTAR Inc, Madison, WI) and similarity searches were carried out using BLAST programs (http://www.ncbi.nlm.nih.gov/BLAST/).

GenBank accession number

The genetic context of bla OXA-199 in WCJ25 and that of bla OXA-48 in the strain S4 have been deposited in GenBank as JN704570 and JX644945, respectively.

Results and Discussion

S. xiamenensis is a newly-recognized species originally found in the coastal sea sediment in Xiamen, China [8] and has also been recovered from gutters in India very recently [10]. The identification of S. xiamenensis in India and two distant parts of China suggested that this species might be an underrecognized member of Shewanella with a wide geographical distribution.

The bla OXA-48-like gene of strain S4 was confirmed as a variant of bla OXA-48, designated bla OXA-48b here, which had four silent nucleotide differences from the bla OXA-48 variant (AY236073), designated bla OXA-48a here, found in the Enterobacteriaceae. Strain WCJ25 harboured a novel bla OXA-48-like gene, designated bla OXA-199 by the β-lactamases numbering system available at www.lahey.org. The bla OXA-199 gene had five nucleotide differences from both bla OXA-48a and bla OXA-48b (99.4% identity), specifying the OXA-199 protein with three amino acid substitutions (H37Y, V44A and D153G) compared to OXA-48. During the process of this work, bla OXA-181 was identified in a S. xiamenensis isolate from India [10]. However, bla OXA-181 was significantly divergent from bla OXA-48b (94.7% identity, 42 nucleotide differences), bla OXA-48a (94.4% identity, 45 nucleotide differences) and bla OXA-199 (94.1% identity, 47 nucleotide differences). Based on a phylogenetic tree (Figure 1) constructed by the MEGA program, the results showed that the bla OXA-48-like genes could be divided into three clusters among which bla OXA-48a, -48b, -162, -163, -181 and -199 were of a cluster different from the chromosome-encoded bla OXA-48-like genes of Shewanella species other than S. xiamenensis. The bla OXA-48-like genes of the same Shewanella species clustered together, suggesting that the divergence of the bla OXA-48-like gene might reflect the phylogeny of Shewanella species.

Genetic contexts of bla OXA-48b and bla OXA-199 were shown in Figure 2. The 26 bp sequence upstream and 63 bp downstream of bla OXA-199 were identical to those of bla OXA-48a and bla OXA-48b, also suggesting a common origin of these genes. Both bla OXA-48b and bla OXA-199 genes were adjacent to several genes upstream, i.e. an orf encoding the peptidase C15, sprT encoding a SprT-like protein of unknown function, endA encoding the endonuclease I and rsmE encoding a ribosomal RNA small subunit methyltransferase. Variants of these genes are also present adjacent to the bla OXA-48-like gene in S. oneidensis MR-1 (AE014299), Shewanella sp. MR-4 (CP000446), Shewanella sp. MR-7 (CP000444) and Shewanella sp. ANA-3 (CP000469). The nucleotide identities of these genes among Shewanella species are shown in Figure 3. The insertion sequence ISEcp1 has been found upstream of bla OXA-181 [5] but was not detected upstream of bla OXA-48b and bla OXA-199 using long-range PCR.

Figure 3

Genetic components surrounding bla OXA-48-like genes in Shewanella strains WCJ25, S4, MR-1, MR-4 MR-7 and ANA-3.

Variants of the same gene are depicted in the same colour with nucleotide identities compared to the counterparts of WCJ25 being indicated underneath. Of note, the acc genes of strains MR-1, MR-4 MR-7 and ANA-3 are complete with 4554 bp in length but only 333 bp were included into the analysis in parallel with the available partial acc sequence of strains WCJ25 and S4.

As seen in the contexts of bla OXA-48a in K. pneumoniae strain 11978 (AY236073) [1], a putative lysR transcriptional regulator gene was located downstream of bla OXA-48b and bla OXA-199. The lysR gene was adjacent to an acc gene that encoded an acetyl-CoA carboxylase multifunctional enzyme at the other side. In K. pneumoniae 11978, the acc gene is truncated by the insertion of IS1999 (an insertion sequence also called IS10A) and two copies of IS1999 bracketing bla OXA-48a-lysR-accΔ formed a composite transposon, which could mobilize bla OXA-48a to different locations [1], [11]. The lysR and acc genes are commonly present downstream of bla OXA-48-like genes on chromosomes of Shewanella spp (Figure 3). As mentioned above, genes located either upstream or downstream of the bla OXA-48-like genes from different Shewanella spp. displayed variable degrees of identities, suggesting that these genes might have different mutation rates.

An insertion sequence was inserted between bla OXA-199 and lysR, evidenced by the presence of 3 bp direct target repeats (DR) (Figure 2). This 1299-bp IS was 98.1% identical to ISShes2 of the IS3 family in nucleotide sequences and had 25-bp inverted repeat sequences (IR) with 23 bp perfectly matched (Figure 2). The ISShes2 element has also been seen in several Shewanella strains whose complete genome sequences are available at GenBank, including Shewanella sp. MR-4 (7 copies; CP000446), Shewanella sp. MR-7 (9 copies plus a truncated version; CP000444), Shewanella sp. ANA-3 (4 copies; CP000469), S. baltica OS195 (2 copies; CP000891), S. baltica OS678 (2 copies; CP002383) and S. baltica OS185 (1 copy; CP000753). Other Shewanella strains with complete genome sequences released, including S. baltica OS223 (CP001252), S. baltica BA175 (CP002767), S. baltica OS117 (CP002811), S. baltica OS155 (CP000563), S. woodyi ATCC 51908 (CP000961), S. oneidensis MR-1 (AE014299) and S. pealeana ATCC 700345 (CP000851) did not harbour ISShes2 but instead carried other insertion sequences sharing 65.7 to 85.9% nucleotide identity with ISShes2.

Based on the significant similarity among contexts of bla OXA-48a, bla OXA-48b and bla OXA-199, it is reasonable to hypothesize that two copies of IS1999, one inserted at 26 bp upstream of a bla OXA-48-like gene and another inserted in acc, could move bla OXA-48-like-lysR-accΔ from the chromosome of S. xiamenensis to a plasmid. Such plasmid could have been transferred to Enterobacteriaceae later on resulting in the emergence of bla OXA-48-like genes. Of note, bla OXA-48a and bla OXA-181 have always been found in distinct genetic contexts as bla OXA-48a is bracketed by two copies of IS1999 while bla OXA-181 is downstream of ISEcp1 [3]. In light of the distinct genetics and the significant nucleotide differences (94.4% identity) between bla OXA-48a and bla OXA-181, it seems unlikely that the two genes derived from each other through mutations but had different origins from two Shewanella strains [3].

Conclusions

From the phylogenetic analysis performed in this study, it appears that bla OXA-48a might have originated from the bla OXA genes such as bla OXA-48b and bla OXA-199 on the chromosome of certain S. xiamenensis strains. The significant nucleotide differences (<95% identity) between bla OXA-181 and bla OXA-48b or bla OXA-199 might represent the divergence of the chromosome-encoded bla OXA-48-like genes between different S. xiamenensis strains in different geographical regions and could also suggest that bla OXA-48a and bla OXA-181 were mobilized independently from different S. xiamenensis strains. The bla OXA-48a and bla OXA-181 determinants appeared to have distinct origins and the emergence of bla OXA-48-like genes in Enterobacteriaceae thus probably can not be attributed to a single mobilization event in the species S. xiamenensis but likely is a result of parallel or successive events occurring in multiple strains of S. xiamenensis.