| Literature DB >> 23109821 |
Ji-Yeon Lee1,2, Dong-Hyuk Lee1, Byoung-Hee Choi1.
Abstract
To evaluate the population genetics structure as a means of devising conservation strategies, we developed microsatellite primers for Sophora koreensis, a narrowly endemic and endangered species in Korea. Thirteen polymorphic microsatellite markers were developed in Korean populations of S. koreensis. Genetic diversity was analyzed in 40 individuals from two populations. The number of alleles per locus ranged from 4 to 14, with observed and expected heterozygosities ranging from 0.200 to 1.000 and from 0.189 to 0.864, respectively. The microsatellite markers described here are valuable tools for the population genetics research of S. koreensis. They can be used to obtain information for creating suitable management strategies to conserve this endemic and endangered species.Entities:
Keywords: Sophora koreensis; endemic species; genetic diversity; microsatellite
Mesh:
Substances:
Year: 2012 PMID: 23109821 PMCID: PMC3472713 DOI: 10.3390/ijms130910765
Source DB: PubMed Journal: Int J Mol Sci ISSN: 1422-0067 Impact factor: 6.208
Results of initial primer screening in Sophora koreensis. Na, number of alleles; Ho, observed heterozygosity; and He, expected heterozygosity. p-Values for Hardy-Weinberg equilibrium (HWE) tests are given for each marker.
| Locus | Mt. Bibong ( | Hanjeon-ri ( | ||||||
|---|---|---|---|---|---|---|---|---|
|
|
| |||||||
| Skor1 | 4 | 0.733 | 0.642 | 0.043 | 3 | 0.800 | 0.556 | 0.367 |
| Skor2 | 8 | 0.768 | 0.783 | 0.036 | 4 | 0.600 | 0.611 | 0.213 |
| Skor3 | 4 | 0.367 | 0.375 | 0.495 | 3 | 0.800 | 0.556 | 0.368 |
| Skor4 | 4 | 0.700 | 0.544 | 0.092 | 3 | 0.800 | 0.644 | 0.834 |
| Skor5 | 4 | 0.700 | 0.578 | 0.176 | 2 | 0.800 | 0.489 | 0.176 |
| Skor6 | 9 | 0.667 | 0.602 | 0.378 | 5 | 1.000 | 0.744 | 0.004 |
| Skor7 | 7 | 0.900 | 0.807 | 0.000 | 4 | 1.000 | 0.744 | 0.291 |
| Skor8 | 7 | 0.867 | 0.795 | 0.230 | 5 | 0.800 | 0.800 | 0.010 |
| Skor9 | 7 | 0.533 | 0.726 | 0.010 | 6 | 0.800 | 0.717 | 0.133 |
| Skor10 | 13 | 0.933 | 0.864 | 0.000 | 5 | 0.800 | 0.761 | 0.003 |
| Skor11 | 7 | 0.533 | 0.638 | 0.147 | 3 | 0.200 | 0.367 | 0.007 |
| Skor12 | 4 | 0.267 | 0.571 | 0.000 | 2 | 0.200 | 0.189 | 1.000 |
| Skor13 | 6 | 0.467 | 0.699 | 0.000 | 4 | 0.400 | 0.661 | 0.044 |
Significant deviation from HWE after correction for multiple tests (p < 0.005).
Characteristics of 13 microsatellite markers developed in Sophora koreensis. All forward primers were M13 (5′-TGTAAAACGACGGCCAGT-3′)-tailed at the 5′ end. Annealing temperature for each round of PCR was 52 °C.
| Locus | Primer sequences (5′→3′) | Repeat motif | Size range (bp) | GenBank Accession No. |
|---|---|---|---|---|
| Skor1 | F: ACTCAAAGCTGGAAGGGT | (TG)13 | 251–273 | JX131650 |
| Skor2 | F: TGAACTACTACTCCGCTT | (AG)14 | 266–292 | JX131651 |
| Skor3 | F: ATTCTGACTATTGGGCTAGTG | (GT)20 | 222–244 | JX131652 |
| Skor4 | F: TCAATCACTATAAGGGTTCAG | (CAA)12 | 240–252 | JX131653 |
| Skor5 | F: ATCAACTACTTCATGCGC | (TG)14 | 260–276 | JX131654 |
| Skor6 | F: ACAAAAAGAAATGGTCGCG | (CA)21(GA)10 | 242–294 | JX131655 |
| Skor7 | F: TTGAAAAGTCCCACCTAGC | (GA)26 | 273–291 | JX131656 |
| Skor8 | F: TCTAGGAGGAAATAGGGAG | (CA)12 | 285–297 | JX131657 |
| Skor9 | F: TGGACACCCCTTATGGCTG | (AG)19 | 248–278 | JX131658 |
| Skor10 | F: TTGGGATAGAGTCACGTCC | (GT)11(GA)15 | 222–270 | JX131659 |
| Skor11 | F: TAAAGTGCATGTTCCCAG | (CA)10 | 256–296 | JX131660 |
| Skor12 | F: TGAACTTAGCATTCCATTC | (GA)10 | 253–267 | JX131661 |
| Skor13 | F: TTCAATGGGTTATTGGTCC | (TG)14 | 238–250 | JX131662 |