Literature DB >> 23093853

Cloning of acyl-ACP thioesterase FatA from Arachis hypogaea L. and its expression in Escherichia coli.

Gao Chen1, Zhen-ying Peng, Lei Shan, Ning Xuan, Gui-ying Tang, Yan Zhang, Lan Li, Qing-fang He, Yu-ping Bi.   

Abstract

In this study, a full-length cDNA of the acyl-ACP thioesterase, AhFatA, was cloned from developing seeds of Arachis hypogaea L. by 3'-RACE. Sequence analysis showed that the open reading frame encodes a peptide of 372 amino acids and has 50-70% identity with FatA from other plants. Real-time quantitative PCR analysis revealed that AhFatA was expressed in all tissues of A. hypogaea L., but most strongly in the immature seeds harvested at 60 days after pegging. Heterologous expression of AhFatA in Escherichia coli affected bacterial growth and changed the fatty acid profiles of the membrane lipid, resulting in directed accumulation towards palmitoleic acid and oleic acid. These results indicate that AhFatA is at least partially responsible for determining the high palmitoleic acid and oleic acid composition of E. coli.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23093853      PMCID: PMC3470901          DOI: 10.1155/2012/652579

Source DB:  PubMed          Journal:  J Biomed Biotechnol        ISSN: 1110-7243


1. Introduction

In higher plants, fatty acid biosynthesis is catalyzed by the action of a type II fatty acid synthase, located in plastids [1-4]. The reaction includes the condensation of malonyl-ACP (acyl carrier protein) with acyl-ACP derivatives resulting in the acyl-ACP chain successively elongated with two carbon units [5, 6]. The final acyl chain elongation product is terminated by acyl-ACP thioesterases (Fats) that hydrolyze the thioester bond of the acyl-ACP and release free fatty acids, which are quickly exported to the cytosol via acyl-CoA synthetase [3, 7, 8]. Plant acyl-ACP thioesterases are plastid-targeted and nuclear-encoded proteins. Based on their sequence identity and substrate specificity, there are two gene families: FatA and FatB [9-11]. The FatA gene is one of the key genes involved in the plastidial fatty acid biosynthesis pathway and encodes thioesterase, with a higher specificity for 18:1-ACP and a lower activity for 18:0-ACP and 16:0-ACP [5, 12–15]. The FatA thioesterase determines which fatty acids are available for the biosynthesis of membrane lipids and allows the transport of fatty acids out of the plastids to incorporate into glycerolipids. On the other hand, the FatB gene encodes thioesterases with a preference for saturated fatty acids with 8–18 carbons [4, 5, 7, 16]. Recently, several FatA and FatB cDNAs have been cloned and characterized following recombinant expression in E. coli and in plants [4, 5, 13, 17–20]. However, there has not yet been a similar report regarding peanut Fat genes. In the present study, we report the isolation of the AhFatA gene and the characterization of the mechanisms and expression levels of FatA in A. hypogaea L. We believe this is the first such work reported for AhFatA and that it will provide information for the genetic manipulation of A. hypogaea L. fatty acid. We also demonstrate significant changes in fatty acid profiles as a result of heterologous expression in E. coli.

2. Materials and Methods

2.1. Plant Materials

Peanut cultivar ‘‘Luhua 14” was used in this study. Roots, stems, leaves, flowers, and seeds of ‘‘Luhua 14” were harvested at various developmental stages of the immature seeds at 10, 20, 30, 40, 50, 60, and 70 days after pegging (DAP). All tissues and seeds were immediately frozen in liquid nitrogen and then stored at −80°C until further use.

2.2. RNA Isolation and cDNA Synthesis

Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. First strand cDNA was synthesized using M-MLV reverse transcriptase and modified oligo (dT) following the manufacturer's instructions (TaKaRa, Dalian, China).

2.3. Analysis of the FatA Sequence in L

On the basis of expression sequence tags (ESTs) of peanut (G0260003, G0340956, and G0268105) from Genbank, sequence assembly and alignment showed that these three ESTs that contained the start codon were AhFATA fragments. To amplify 3′-end cDNA, a 3′ RACE primer (Table 1) was designed based on the ESTs, and 3′ RACE PCR was performed using a 3′-Full RACE Core Set Ver.2.0 Kit (TaKaRa) according to the manufacturer's instructions. PCR primers were then designed to obtain full length AhFATA, AhFATA-F, and AhFATA-R (Table 1). The PCR program consisted of an initial denaturation cycle at 94°C for 3 min followed by 35 cycles of 94°C for 40 s, 60°C for 35 s, 72°C for 90 s, and then final extension at 72°C for 7 min. The amplified products were separated on a 1.0% agarose gel and visualized after ethidium bromide staining. The PCR products were then cloned into a pGEM-T Easy Cloning Vector (Promega, Madison, WI) and sequenced by the High-Tech Research Center, Shandong Academy of Agricultural Science (Ji'nan, China).
Table 1

Primer sequences used in this study.

Primer nameSequence (5-3)
3 RACE primerGCTTGGAGTGATGTAGTTGAGAT
3 RACE outer primerTACCGTCGTTCCACTAGTGATTT
3 RACE inner primerCGCGGATCCTCCACTAGTGATTTCACTATAGG
AhFatA-outer-FGCTTGGAGTGATGTAGTTGAGAT
AhFatA-inner-FATGGTGTCAAGGGGAAGGGAGGGT
AhFatA-FCTACCATGGAATGTTGAAGGTTTCAT
AhFatA-RCATCACGTGGATCATAATCTTGAAGCT
Actin-FGTCCATCAGGCAACTCGTAGC
Actin-RGCCCTCGACTATGAGCAAGAG
AhFatA-FAGGCCTCATATGGGTCACTG
AhFatA-RTGACTTGATCGGTCGCATAG

2.4. Sequence Analysis of AhFatA

The AhFatA coding sequence and putative amino acid sequence were analyzed by DNAman software (Lynnon Biosoft, Vaudreuil, Quebec, Canada). Multisequence alignment was carried out by CLUSTALX. The phylogenic tree for A. hypogaea L. and other plant FatAs was constructed by DNAman 6.0.

2.5. Expression Analysis of AhFatA in Different Tissues and Seed Developmental Stages by Quantitative Real-Time PCR

Quantitative real-time PCR (qRT-PCR) examination of AhFatA expression was carried out with a Bio-Rad iQ5. Peanut β-actin (primers of Actin-F and Actin-R, Table 1) was used as an internal control for normalization of the cDNA. We also designed the AhFatA qRT-PCR primers, AhFatA-F and AhFatA-R (Table 1). Reactions were prepared following the manufacturer's instructions, and qRT-PCR was performed using the Bio-Rad iQ5. Each PCR was repeated four times in a total volume of 20 μL containing 2×SYBR Green I PCR Master Mix (TaKaRa), 100 nM of each primer, and 1 μL diluted (1 : 20) template cDNA. Reactions were carried out in 96-well optical-grade PCR plates and the matched optical-grade membrane (TaKaRa). The amplification program was as follows: an initial denature step consisting of 1 min at 95°C, followed by 42 cycles of 10 s at 95°C, 30 s at 60°C and 30 s at 72°C, and an additional cycle of 10 s at 95°C, 30 s at 58°C and 5 min at 72°C, and 10 s at 95°C for melting curve analysis. The data obtained were analyzed with Bio-Rad iQ5 software. The relative expression of AhFatA in different tissues and at various developmental stages of the immature seeds was calculated using the relative 2−ΔΔCt method [21]; the error bars indicate SD (n = 4).

2.6. Recombinant AhFatA Expression in E. coli

The 1119-bp EcoRI-SalI DNA fragment encoding AhFatA from pGEM-T Easy/AhFatA was ligated at the same sites into pGEX-4T-1 (Biovector Science Lab, Beijing, China), generating pGEX-4T-1-FATA. The control plasmid and pGEX-4T-1-FATA were transformed into E. coli BL21 (DE3) (TransGen, Beijing, China). E. coli BL21 (DE3) cells harboring the control pGEX-4T-1 and recombinant pGEX-4T-1-FATA plasmids were grown at 37°C in LB liquid medium containing 100 mg/mL ampicillin. The cultures were induced 1.5 hours after inoculation with 1 mM IPTG and were under constant shaking for defined periods of time. Induction experiments were also performed with the same set of cultures at 25°C and 1 mM IPTG.

2.7. Lipid Extraction and Fatty Acid Methyl Ester (FAME) Analysis of E. coli Samples

Bacterial membrane lipid extraction was carried out as described by Bligh and Dyer [22], with modifications. Wet cell samples were heated at 40°C to obtain 300 mg dry cell paste. The dry cell paste was diluted with 4 mL chloroform/methanol (1 : 10, v/v), and a suspension of 1 mL hexane containing C19:0 internal standard (1 mg/mL) was added. The mixture was heated at 80°C for 2 hours in a water bath, and then after cooling, 5 mL of 7% potash was added and mixed. After 10 min, the mixture was centrifuged at 10,000 ×g for 10 min. The supernatants (bacterial sample FAME eluate) were subjected to gas chromatography (GC) using the Elite-wax column in a Perkin-Elmer instrument (ASXL). The flame-ionization detection (FID) temperature was 250°C, and the operating temperature was maintained at 220°C. The data presented in this paper are the average of three experiments for each sample.

3. Results

3.1. Isolation and Sequence Analysis of a Cloned Thioesterase Gene from A. hypogaea L

Based on sequence assembly (G0260003, G0340956, and G0268105) and alignment (Supplementary Figure 1 of the Supplementary Material available online at doi:10.1155/2012/652579), four nested primers were designed: 3′ RACE outer primer, 3′ RACE inner primer, AhFATA-outer-F, and AhFATA-inner-F (Table 1). Using these primers, a 750-bp DNA fragment was obtained from the 3′-RACE from the extracts of developing A. hypogaea L. seeds. The full-length primers, AhFATA-F and AhFATA-R (Table 1), were used to obtain a full-length cDNA of 1650 bp that was named AhFatA (deposited to GenBank GU324446). Sequence analysis showed that the open reading frame (ORF) encodes 372 amino acids, with a calculated molecular mass of 40 kDa and a pI of 6.73. CLUXTALX was used to align the amino acid sequence of AhFatA with that from other plant species. This alignment (Supplementary Figure 1A) showed that the amino acid sequence has the highest identity to VvFatA (Vitis vinifera, 225470104c) (71%) and 58% identity to TaFatA (Triticum aestivum, 21262149). Phylogenetic analysis (Supplementary Figure 1B) indicated that AhFatA has a higher similarity to FatAs, such as GarmFatA (Garcinia mangostana, 1930076) and RcFatA (Ricinus communis, 152206073), which have preference for 18:1-ACP and 16:1-ACP [4, 13]. AhFatA showed a lower similarity to AtFatA (Arabidopsis thaliana, 186510396), CsFatA (Coriandrum sativum, 457209), and CtFatA1 (Carthamus tinctorius, 404027), which have high thioesterase activity towards 18:1-ACP and lower activity towards 16:0-ACP and 18:0-ACP [5, 12].

3.2. Expression Patterns of the AhFatA Gene

To investigate the expression patterns of the AhFatA gene in a range of organs and at different growth stages of the peanut, the relevant samples were analyzed by qRT-PCR. Results showed that in wild-type A. hypogaea L., transcripts were detected in every tissue, but most strongly in seeds and most weakly in roots (Figure 1). The expression of the AhFatA gene in seeds at different developmental stages (10, 20, 30, 40, 50, 60, and 70 DAP) was also examined by qRT-PCR, and results showed that the AhFatA transcript levels were higher at 60 DAP than at other stages (Figure 2). These results showed that AhFatA allows fatty acid accumulation in the seeds of A. hypogaea L., indicating that the seeds may have thioesterase activity that is different from that of plants with a shortage of fatty acids.
Figure 1

Real-time quantitative PCR analysis expression patterns of AhFatA in different tissues of A. hypogaea L. Actin from A. hypogaea L. was used as an internal control. Error bars SD. The transcript level of root was used as the calibrator whose AhFatA mRNA level was given as 1.

Figure 2

Real-time quantitative PCR analysis expression patterns of AhFatA at different periods of seeds development in A. hypogaea L. The cDNA were isolated from developing seeds at 10, 20, 30, 40, 50, 60, 70 DAP. Actin from A. hypogaea L. was used as an internal control. Error bars SD. The transcript level of 10 DAP was used as the calibrator whose AhFatA mRNA level was given as 1.

3.3. Overexpression of Recombinant AhFatA in E. coli Leads to the Accumulation of Palmitoleic Acid and Oleic Acid

The E. coli cells with pGEX-4T-1 and pGEX-4T-1-AhFatA plasmids were induced by 1 mM IPTG. A GST protein with a molecular mass of 26 kDa and a fusion protein with a molecular mass of 72 kDa were expressed in E. coli strains as determined by SDS-PAGE (Figure 3). Our results indicated that AhFatA had the highest expression levels, and the fusion protein GST-AhFatA was soluble after being induced by IPTG for 4 h at 37°C. The E. coli cells with the pGEX-4T-1 plasmid also had the same expression levels of AhFatA (Figure 3).
Figure 3

SDS-PAGE analysis of the fusion protein produced in the recombinant E. coli BL 21 (DE3). M: Protein Marker; (1) E. coli strain; (2) E. coli strain harboring pGEX-4T-1-AhFatA; (3) E. coli strain harboring pGEX-4T-1.

It has been reported that thioesterases of type A can improve the palmitoleic acid and oleic acid composition of plants such as Garcinia mangostana [13], Arabidopsis thaliana, Coriandrum sativum [5], Brassica campestris [23], and Ricinus communis L. [4]. To study the changes in fatty acid composition caused by recombinant AhFatA activity in vivo, we performed GC analysis of the FAMEs prepared from E. coli expressing heterologous AhFatA. At 37°C we observed approximate increases by 149%, 20%, and 157% in C16:1, C18:0, and C18:1 fatty acid content, respectively, in bacteria, and 18%, 28%, 0.6%, and 31.4% decreases in C12:0, C14:0, C16:0, and others (such as C14:1, C17:0, C17:1, C18:2, C18:3, C20:2), respectively, compared to vector controls (Supplementary Figure 2A). When the bacteria were grown at 25°C, C12:0, C14:0, C16:0, C18:0, and others were reduced by 33%, 27%, 7%, 23%, and 13.8%, respectively, along with a 26% increase in C16:1 and a 146% increase in C18:1 content compared to vector controls (Supplementary Figure 2B). These results demonstrate that the fatty acid composition of recombinant bacteria changed greatly towards C18:1 when the AhFatA gene was expressed in E. coli BL21 (DE3).

3.4. Overexpression of AhFatA in E. coli Affects Bacterial Growth

The AhFatA gene was expressed from the lac promoter in E. coli BL21 (DE3) and induced by IPTG. Our results showed no significant change in bacterial growth rate of either control cells or transformants before IPTG induction in 37°C. In contrast, after IPTG induction, the growth rate of E. coli BL21 (DE3) with pGEX-4T-1-AhFatA decreased over time compared to the cells with pGEX-4T-1, and cells with pGEX-4T-1 plasmid maintained the higher growth rate at 37°C (Supplementary Figure 3A). Approximately 5 hours after-induction, growth of the E. coli cells harboring pGEX-4T-1-AhFatA, or pGEX-4T-1 slowed and eventually stopped. The growth rate of the E. coli cells (control and transformants) showed the same trends at 25°C (Supplementary Figure 3B) as at 37°C, although growth was slower at 25°C.

4. Discussion

In this study, we cloned a 1119-bp gene from A. hypogaea L. and showed that it had high similarity with the FatA genes from other plants. The gene, called AhFatA, represents the first FatA from A. hypogaea L. to be studied. Real-time quantitative PCR analysis of the AhFatA expression pattern revealed that AhFatA was expressed in all tissues and was quite similar to AtFatA from A. thaliana and many other plants [1, 24]. Of all plant thioesterases, FatA is essential for plant viability and plays an important role in transferring acyl chains to the extraplastidial glycerolipid and determining the metabolic flux into triacylglycerols. AhFatA transcript levels were higher in seeds and higher at 60 DAP than at other stages, showing that this gene functions largely in fatty acid accumulation, which is in accordance with the oil accumulation in seeds. It has been reported that thioesterase types A have a higher specificity for 18:1-ACP. We expressed AhFatA in E. coli BL21 (DE3) using the pGEX-4T-1 vector with the lac promoter and demonstrated high levels of expression of AhFatA. Our results showed that the fatty acid composition of the recombinants changed greatly towards C18:1 and C16:1. There is also a relative increase in the accumulation of C18:2 in direct of the proportion of 18:1. Therefore, it could be hypothesized that the bacteria compensate for the available fatty acids by increasing the saturated fatty acids. The results are similar to those in other plants such as Garcinia mangostana [13], Arabidopsis thaliana, Coriandrum sativum [2], Brassica campestris [23], and Ricinus communis L. [4]. Therefore, AhFatA may function mainly to provide palmitoleic acid and oleic acid. The effect of AhFatA gene overexpression on cell growth at different temperature was examined. The specific growth rates of E. coli BL21 (DE3) harboring pGEX-4T-1-AhFatA during the exponential phase were much lower than the host with pGEX-4T-1 plasmid. This phenomenon may due to the following reasons. The accumulation of AhFatA protein affected the lipid metabolism in the E. coli BL21 (DE3) harboring pGEX-4T-1-AhFatA, and then the release of free fatty acids limited the cells growth. The presented results demonstrate that the transformed cells may use the plasmid-encoded FatA gene to produce fatty acids.

5. Conclusions

In conclusion, we cloned the AhFatA gene of A. hypogaea L., a member of the acyl-ACP thioesterases and described the functional characterization of AhFatA in E. coli BL21 (DE3). Our results showed that the expression of AhFatA, which was higher in seeds than other tissues, has a high specificity for 18:1-ACP and 16:1-ACP. Overexpression of AhFatA in E. coli BL21 (DE3) leads to the accumulation of palmitoleic acid and oleic acid. This research provides the basis not only for the cloning and expression of the AhFatA gene, but also for modifying fatty acid composition through genetic engineering of the acyl-ACP thioesterases in plants and microorganisms. We are currently developing transgenic A. hypogaea L. and cyanobacteria to enhance downstream fatty acid production by termination of fatty acyl chain-elongation with AhFatA. We believe that the AhFatA gene will be helpful in transgenic lines and that it will be a suitable tool for genetic modification of oil crops to generate improved crops in the future. Supplementary Figure 1: Sequence analysis of AhFatA and any other plants. (A) Amino acid sequence alignment of AhFatA and the FatA sequences of other plants. The identical amino acids were showed in white with black background and the conserved amino acids were showed in white and gray background. The three conserved residues are indicated by arrows. (B) Phylogenetic comparison of AhFatA and other FatAs, according to ClustalX-derived protein alignments, generated by MEGA 4.0. The amino acid sequence derived from AhFatA (Arabidopsis thaliana, 186510396); BjFatA (Brassica juncea, 14148965); BnFatA1 (Brassica napus, 435010); BrFatA1 (Brassica rapa, 595956); CcFatA (Capsicum chinense, 11386000); ChFatA1 (Cuphea hookeriana, 3859831); CsFatA1 (Coriandrum sativum, 457209); CsFatA1 (Carthamus tinctorius, 404027); CtFatA2 (Carthamus tinctorius, 404025); GarmFatA1 (Garcinia mangostana, 1930076); HaFatA1 (Helianthus annuus, 33325241); IgFatA (Iris germanica, 12004038); ItFatA (Iris tectorum, 18653907); PfFatA1 (Perilla frutescens, 18653911); RcFatA1 (Ricinus communis, 152206073); TaFatA (Triticum aestivum, 21262149); VvFatA (Vitis vinifera, 225470104c). Supplementary Figure 2:Changes of fatty acids profiles in the membrane lipid of E. coli that expressing AhFatA thioesterase at different temperatures. Individual fatty acids are represented by standard symbol. Supplementary FIGURE 3: Growth curve of E. coli BL21 (DE3) cells that harboring pGEX-4T-1 plasmid control (□) and pGEX-4T-1-AhFatA plasmid (▲) at 37°C (A) and 25°C (B) of the culture induced with 1mM IPTG after 1.5 hours of starter culture. Click here for additional data file.
  23 in total

1.  Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.

Authors:  K J Livak; T D Schmittgen
Journal:  Methods       Date:  2001-12       Impact factor: 3.608

Review 2.  Carbon flux and fatty acid synthesis in plants.

Authors:  Stephen Rawsthorne
Journal:  Prog Lipid Res       Date:  2002-03       Impact factor: 16.195

3.  Palmitoyl-acyl carrier protein (ACP) thioesterase and the evolutionary origin of plant acyl-ACP thioesterases.

Authors:  A Jones; H M Davies; T A Voelker
Journal:  Plant Cell       Date:  1995-03       Impact factor: 11.277

4.  Cloning, characterization and structural model of a FatA-type thioesterase from sunflower seeds (Helianthus annuus L.).

Authors:  M J Serrano-Vega; R Garcés; E Martínez-Force
Journal:  Planta       Date:  2005-04-20       Impact factor: 4.116

5.  Cloning and functional expression of an acyl-ACP thioesterase FatB type from Diploknema (Madhuca) butyracea seeds in Escherichia coli.

Authors:  J K Jha; M K Maiti; A Bhattacharjee; A Basu; P C Sen; S K Sen
Journal:  Plant Physiol Biochem       Date:  2006-11-07       Impact factor: 4.270

6.  Cloning and expression analysis of PtFATB gene encoding the acyl-acyl carrier protein thioesterase in Populus tomentosa Carr.

Authors:  Zhou Zhou; Deqiang Zhang; Mengzhu Lu
Journal:  J Genet Genomics       Date:  2007-03       Impact factor: 4.275

7.  Characterization of acyl-ACP thioesterases of mangosteen (Garcinia mangostana) seed and high levels of stearate production in transgenic canola.

Authors:  D J Hawkins; J C Kridl
Journal:  Plant J       Date:  1998-03       Impact factor: 6.417

8.  Cloning and expression in Escherichia coli of a cDNA coding for the oleoyl-acyl carrier protein thioesterase from coriander (Coriandrum sativum L.).

Authors:  P Dörmann; J C Kridl; J B Ohlrogge
Journal:  Biochim Biophys Acta       Date:  1994-04-14

9.  Induction, purification and characterisation of acyl-ACP thioesterase from developing seeds of oil seed rape (Brassica napus).

Authors:  A Hellyer; P F Leadlay; A R Slabas
Journal:  Plant Mol Biol       Date:  1992-12       Impact factor: 4.076

10.  Cloning and functional characterization of an acyl-acyl carrier protein thioesterase (JcFATB1) from Jatropha curcas.

Authors:  Ping-Zhi Wu; Jun Li; Qian Wei; Ling Zeng; Ya-Ping Chen; Mei-Ru Li; Hua-Wu Jiang; Guo-Jiang Wu
Journal:  Tree Physiol       Date:  2009-08-10       Impact factor: 4.196

View more
  3 in total

Review 1.  Escherichia coli as a fatty acid and biodiesel factory: current challenges and future directions.

Authors:  Ziaur Rahman; Naim Rashid; Javed Nawab; Muhammad Ilyas; Bong Hyun Sung; Sun Chang Kim
Journal:  Environ Sci Pollut Res Int       Date:  2016-03-10       Impact factor: 4.223

2.  Heterologous Expression of Jatropha curcas Fatty Acyl-ACP Thioesterase A (JcFATA) and B (JcFATB) Affects Fatty Acid Accumulation and Promotes Plant Growth and Development in Arabidopsis.

Authors:  Ying Liu; Jing Han; Zhijie Li; Zuojie Jiang; Liangfeng Luo; Yingzhe Zhang; Minghao Chen; Yuesheng Yang; Zhenlan Liu
Journal:  Int J Mol Sci       Date:  2022-04-11       Impact factor: 6.208

3.  Computational Redesign of Acyl-ACP Thioesterase with Improved Selectivity toward Medium-Chain-Length Fatty Acids.

Authors:  Matthew J Grisewood; Néstor J Hernandez Lozada; James B Thoden; Nathanael P Gifford; Daniel Mendez-Perez; Haley A Schoenberger; Matthew F Allan; Martha E Floy; Rung-Yi Lai; Hazel M Holden; Brian F Pfleger; Costas D Maranas
Journal:  ACS Catal       Date:  2017-04-20       Impact factor: 13.084

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.