| Literature DB >> 23091354 |
Lifang Yu1, Dangcong Peng, Ruiling Pan.
Abstract
This study used two laboratory-scale sequencing batch reactors (SBRs) to evaluate the shifts in nitrification kinetics and microbial communities of an activated sludge sewage treatment system (main stream) during bioaugmentation with nitrifiers cultivated on real sludge reject water (side stream). Although bioaugmentation exerted a strong influence on the microbial community and the nitrification kinetics in the main stream, there was 58% of maximum ammonia uptake rate (AUR) and 80% of maximum nitrite uptake rate (NUR) loss of the seed source after bioaugmentation. In addition, nitrite accumulation occurred during bioaugmentation due to the unequal and asynchronous increase of the AUR (from 2.88 to 13.36 mg N/L · h) and NUR (from 0.76 to 4.34 mg N/L · h). FISH results showed that ammonia oxidizing bacteria (AOB) was inclined to be washed out with effluent in contrast to nitrite oxidizing bacteria (NOB), and Nitrosococcus mobilis lineage was the dominant AOB, while the dominant NOB in the main stream gradually transferred from Nitrospira to Nitrobacter. Nitrospina and Nitrococcus which existed in the seed source could not be detected in the main stream. It can be inferred that nitrite accumulation occurred due to the mismatch of NOB structure but washed out with effluent.Entities:
Mesh:
Substances:
Year: 2012 PMID: 23091354 PMCID: PMC3468161 DOI: 10.1155/2012/691894
Source DB: PubMed Journal: J Biomed Biotechnol ISSN: 1110-7243
List of 16S rRNA-targeted oligonucleotide probes used in the study.
| Probe | Sequence (5′-3′) | Specificity | Concentration*(%) | Reference |
|---|---|---|---|---|
| NSO1225 | CGCCATTGTATTACGTGTGA | Ammonia oxidizing beta-proteobacteria | 35 | Mobarry et al. [ |
| Nsv443 | CCGTGACCGTTTCGTTCCG |
| 30 | Mobarry et al. [ |
| Nmv (Ncmob) | TCCTCAGAGACTACGCGG |
| 35 | Juretschko et al. [ |
| Ntspa662 | GGAATTCCGCGCTCCTCT |
| 35 | Daims et al. [ |
| NIT3 | CCTGTGCTCCATGCTCCG |
| 40 | Wagner et al. [ |
| Ntcoc206 | CGGTGCGAGCTTGCAAGC |
| 10 | Juretschko et al. [ |
| Ntspn693 | TTCCCAATATCAACGCATT |
| 20 | Juretschko et al. [ |
*Concentrations presented as percentage of formamide in hybridization buffer (v/v).
Figure 1Influent and effluent N concentrations for the side-stream reactor.
AOB and NOB composition in seed source (“—” no signals were detected).
| Species (probe) | Percentage relative to DAPI |
|---|---|
| AOB | |
| | 13.1% (±3.4%) |
| | — |
|
| |
| Total AOB (Nso1225) | 18.8% (±2.7%) |
|
| |
| NOB | |
| | 9.4% (±1.6%) |
| | 2.7% (±0.47%) |
| | 0.86% (±0.11%) |
| | 1.2% (±0.62%) |
|
| |
| Total NOB | 14.4% (±2.8%) |
|
| |
| AOB + NOB | 33.2 |
| AOB/NOB | 1.31 |
Figure 2Effluent profiles of main-stream reactor.
Figure 3The ammonia uptake rate and nitrite uptake rate of the activated sludge in main-stream reactor.
AOB and NOB percentages relative to DAPI in the main stream reactor (%).
| Time (day) | 30 | 38 | 57 | 77 | |
|---|---|---|---|---|---|
| AOB/DAPI | 3.7 ± 1.2 | 7.0 ± 2.2 | 9.1 ± 3.1 | 8.7 ± 2.7 | |
| Sludge | NOB/DAPI | 0.1 ± 0.1 | 3.4 ± 1.1 | 5.0 ± 1.7 | 5.0 ± 2.5 |
| ΔAOB/ΔNOB | — | 0.97 | 1.1 | 1.0 | |
|
| |||||
| Effluent | AOB/DAPI | — | 18.2 ± 4.6 | 11.3 ± 2.8 | 10.0 ± 3.4 |
| NOB/DAPI | — | 3.9 ± 2.0 | 3.6 ± 1.5 | 1.4 ± 1.2 | |
Figure 4(a) Community structure shifts in AOB in the main-stream reactor. (b) Community structure shifts in NOB in the main-stream reactor.