Literature DB >> 23085378

Testosterone protects female embryonic heart H9c2 cells against severe metabolic stress by activating estrogen receptors and up-regulating IES SUR2B.

Thomas Ballantyne1, Qingyou Du, Sofija Jovanović, Andrew Neemo, Robert Holmes, Sharabh Sinha, Aleksandar Jovanović.   

Abstract

A recent clinical study demonstrated that a testosterone supplementation improves functional capacity in elderly female patients suffering from heart failure. These findings prompted us to consider possible mechanisms of testosterone-induced cardioprotection in females. To address this question we have used a pure female population of rat heart embryonic H9c2 cells. Pre-treatment of cells with testosterone for 24h significantly increased survival of H9c2 cells exposed to 2,4-dinitrophenol (DNP), an inhibitor of oxidative phosphorylation. These cells expressed low level of androgen receptors and the effect of testosterone was not modified by hydroxyflutamide, an antagonist of androgen receptor. In contrast, cyclohexamide, an inhibitor of protein biosynthesis, and tamoxifene, a partial agonist of estrogen receptors, abolished cardioprotection afforded by testosterone. In addition, finasteride, an inhibitor of 5α-reductase, and anastrazole, an inhibitor of α-aromatase, also blocked testosterone-induced cytoprotection. Real time RT-PCR revealed that testosterone did not regulate the expression of nine subunits and accessory proteins of sarcolemmal ATP-sensitive K(+) (K(ATP)) channels. On the other hand, testosterone, as well as 17β-estradiol, up-regulated a putative mitochondrial K(ATP) channel subunit, mitochondrial sulfonylurea receptor 2B intraexonics splice variant (IES SUR2B), without affecting expression of IES SUR2A. Tamoxifene inhibited testosterone-induced up-regulation of IES SUR2B without affecting IES SUR2A. In conclusion, this study has shown that testosterone protect female embryonic heart H9c2 cells against severe metabolic stress by its conversion into metabolites that activate estrogen receptors and up-regulate IES SUR2B.
Copyright © 2012 Elsevier Ltd. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23085378      PMCID: PMC3573229          DOI: 10.1016/j.biocel.2012.10.005

Source DB:  PubMed          Journal:  Int J Biochem Cell Biol        ISSN: 1357-2725            Impact factor:   5.085


Introduction

Myocardium is continuously exposed to metabolic stress. In health, it responds to episodes of increased physical activity and β-adrenergic stimulation, while in disease it suffers from lack of oxygen and inefficient metabolic waste removal (reviewed by Opie and Sack, 2005; Stanley et al., 2005). Much research has been focused on development of methods to protect the myocardium from metabolic stress. In these regards, there are studies showing that estrogen protects cardiomyocytes against stress (reviewed by Murphy and Steenbergen, 2007). As postmenopausal decline in estrogens level is associated with increase in incidence of cardiovascular diseases in women, it was considered that estrogens replacement would decrease incidence and improve prognosis of these diseases in women. However, clinical studies failed to fulfill such expectations (Rossouw et al., 2002; Vickers et al., 2007; Banks and Canfell, 2009) and, as a result, the potential use of estrogen replacement to address a problem of cardiovascular diseases in postmenopausal women is much reduced (Harman et al., 2011). On the other hand, there are some recent reports suggesting that decline of androgen in women is also a factor in development of cardiovascular diseases after menopause (Montalcini et al., 2007; Sievers et al., 2010). A recent clinical study demonstrated that a testosterone supplementation improves functional capacity in elderly female patients suffering from heart failure (Iellamo et al., 2010). In addition, more recent study reported that testosterone is cardioprotective in ovariectomised rats (Liu et al., 2012). These findings prompted us to consider possible mechanisms of testosterone-induced cardioprotection in females. In males, cardioprotection afforded by testosterone has been associated with the regulation of expression of some signaling factors including heat shock protein 70 (Liu et al., 2006), α- and β-adrenergic receptors (Tsang et al., 2008). However, these effects are mediated via androgenic receptors and it is unclear what mechanism would testosterone activate in female hearts when the level of these receptors is so low (Liu et al., 2006; Tsang et al., 2008). To address this question, we have used a pure population of female embryonic rat heart H9c2 cells, which are established model to study mechanisms of cardioprotection (Crawford et al., 2003; Jovanović et al., 2009a,b). Using this experimental model, we have found that testosterone protects female H9c2 cells by activating estrogen receptors and up-regulating a mitochondrial sulfonylurea receptor 2B intraexonics splice variant (IES SUR2B).

Methods

H9c2 cells

Experiments were performed on pure population of rat embryonic heart-derived female H9c2 cells as provided by the manufacturer (ECACC, Salisbury, UK). They were cultured in a tissue flask containing DMEM medium and were supplemented with 2 mM glutamine and 10% FCS in 96-well plate. The cells were split on two occasions before the addition of the hormones using 2 μl trypsin and were then stored at 37 °C at 5% CO2. Then either testosterone (100 nM), hydroxyflutamide (1 μM), tamoxifene (1 μM), cycloheximide (1 μg/ml), 17β-estradiol (E2; 100 nM), finasteride (100 ng/ml) and anastrozole (100 μM) alone or combined were added into the culture media and methanol was added to the control group (concentrations used were based on affinities of these ligands). The cultures were then left for a 24 h incubation period before experimentation. All experiments were run in parallel.

Sex determination in H9c2 cells

Genomic DNA was extracted from the rat hearts or H9c2 cells using Wizard SV Genomic DNA Purification System (Promega, Madison, WI) according to the manufacturer's recommendations. Genomic DNA was used as a template for real rime RT-PCR. The specific primers for rat sex determining region Y (Sry) were designed using Beacon Designer 3.0 software (Bio-Rad), sense, 5′-CACACTATCATATACGGACAG-3′, antisense, 5′-TGGACAGTA AGTA GGTTAGC-3′, 211bp of PCR product. Real time RT-PCR was performed as described for androgen receptors.

Cell survival assay

The survival of H9c2 cells were assayed using Multitox-Fluor Multiplex Cytotoxicity Assay (Promega). After 24 h of pretreatment with different testosterone and/or different drugs, 2,4-dinitrophenol (DNP) was added to each well at the final concentration of 10 mM. To measure cell survival 6 h later, the peptide substrate (GF-AFC) that can be cleaved only by live cells was added to the each well. Following 30 min-long incubation at 37 °C, plates were measured using 1420 Multibabel Counter (Victor) plate reader, with excitation at 370 nm and emissions of 480 nm. The percentage of live cells was calculated based on the intensity of fluorescence according to the manufacturer instructions (Jovanović et al., 2009a,b).

Real time RT-PCR

Real time RT-PCR was performed as described in our previous papers (Du et al., 2006; Sudhir et al., 2011; Sukhodub et al., 2011). Briefly, total RNA was extracted from H9c2 cells or rat hearts using TRIZOL reagent (Invitrogen, Carlsbad, CA) and purified (Qiagen, Crawley, UK) according manufacturer's instruction. The samples were diluted 50 times by adding 98 μl of Multi-Q dH2O to 2 μl of RNA. The required weight of RNA in each was 4 μg and the total volume in each sample required was 21 μl. The reverse transcription reaction was carried out with ImProm-II™ Reverse Transcriptase System (Promega, Southhampton, UK). A final volume of 20 μl of reverse transcription reaction mix was required. The reaction mixture was prepared by the following process. The ImProm-II™ Reaction buffer (8 μl); 0.5 mM each of dATP, dCTP, dGTP, and dTTP was added along with 2 μl ImProm-II™ reverse transcriptase. RNasin® Ribonuclease inhibitor (1 μl) was added to prevent the RNA being degraded. 3 mM MgCl2 was also added to allow the reverse transcriptase enzyme to function more efficiently. Finally 2 μl of deoxynucleoside triphosphate (dNTP) was added to allow the RNA to elongate as well as 0.5 μg of oligo (dT). The reaction mix was added to 1 μg of RNA and was incubated at 42 °C for 1 h. Afterwards it was heated to 70 °C for 15 min to allow the primers to bind and was then annealed for 5 min at 25 °C. Each component of the reverse transcription reaction was multiplied by 13 to give enough template for duplicate samples for each gene for use in PCR. The resulting cDNA was used as template for real-time PCR. The specific primers for rat androgen receptor, sarcolemma KATP channel subunits and associated proteins (SUR1, SUR2A, SUR2B, Kir6.1, Kir6.2, adenylate kinase (AK), creatine kinase (CK), glyceraldehyde 3-phospho dehydrogenase (GAPDH) and muscle form of lactate dehydrogenase (M-LDH) and IES SUR2A and IES SUR2B were designed using Beacon Designer 3.0 software (Bio-Rad) and are depicted in Table 1. GAPDH was also used as a control gene and a loading control. The primers ability to produce no signal in negative controls by dimer formation was used to test specificity. The real time RT-PCR reaction used a SYBR Green I system as previously described (Jovanović et al., 2009a,b). The reaction mixture consisted of – 12.5 μl iQ™ SYBR® Green Supermix (2×), 10 μl of ddH2O, 7.5 nM of each primer, and 2 μl of cDNA. The final reaction mixture volume in each well was 25 μl. Each sample was done in duplicate. For the androgen receptor and Sry, the PCR thermal cycling conditions started with a denaturation at 95 °C for 3 min. This was followed by a 38 cycle three step process consisting of 10 s of denaturing at 95 °C, 15 s of annealing at 56 °C and 50 s of extension at 72 °C. For the sarcolemmal KATP channel subunits and associated proteins, the PCR thermal cycling conditions started with a denaturation at 95 °C for 30 s. This was followed by a 38 cycle three step process consisting of 10 s of denaturing at 95 °C, 15 s of annealing at 56 °C, and 40 s of extension at 72 °C. For the IES SUR2A and IES SUR2B, the thermal cycling conditions were as follows: an initial denaturation at 95 °C for 3 min, followed by 40 cycles of 10 s of denaturing at 95 °C, 15 s of annealing at 56 °C, and 30 s of extension at 72 °C. Following each cycle, data was collected and displayed graphically using an iCycler iQ™ Real-time Detection System Software (iCycler iQ™ Real-time Detection System Software, version 3.0A, BioRad, Hercules, CA). Real-time PCR was performed in the same wells of a 96-well plate using the iCycler iQ™ Multicolor Real-Time Detection System (Bio-Rad, Hercules, CA). The PCR efficiency was examined by analysis of standard curves and melting curves were used to check the PCR specificity. The corresponding no-RT mRNA sample was always included as a negative control. The relative expression ratio(R) of a gene encoding sarcolemmal or mitochondrial KATP channel forming protein is calculated using equation R = (EK)ΔCPk(C−T)/(ER)ΔCPR(C−T) where EK is the real time PCR efficiency of a gene of interest transcript, ER is the real time PCR efficiency of a reference gene (GAPDH), ΔCPK is the crossing point deviation of control (C)–testosterone treated (T) of gene of interest gene transcript while ΔCPR is the crossing point deviation of control (C)–testosterone treated (T) of a reference gene transcript (Sudhir et al., 2011).
Table 1

Rat primers used in real time RT-PCR experiments.

mRNASenseAntisense
SUR 15′-GGAAGGACTC5′-GAGACCATC
ACCACCATC-3′AAGGCATAGG-3′
SUR 2A5′-ACTTCAGCGT5′-AGCAGGTTTGG
TGGACAGAGAC-3′ACCAGTATCG-3′
SUR 2B5′-GACGCCA5′-TCATCACAATG
CTGTCACCGAAG-3′ACCAGGTCAGC-3′
Kir 6.15′-GTCACACGCTG5′-GGCACTCCTCAG
GTCATCTTCAC-3′TCATCATTCTCC-3′
Kir 6.25′-TGGCTGACGAG5′-TGGCGGGGCTG
ATTCTGTGG-3′TGCAGAG-3′
GAPDH5′-ATAGAATTCCAGCCTCGAGTTA
ATGACAAAGTGGACGGAAATGAG
ATTGTTGCCA-3′CTTCACAAAGTT-3′
Androgen receptors5′-AGCCACC GCCTCTTCTTC -3′5′-ACCAGGATACCA CACTTCAG-3
IES SUR2A5′-AGTTGGGGTGGG AGGTCAG-35′-TGCAGAGAATGA GACACTTG-3
IES SUR2B5′-AGTTGGGGTGGG AGGTCAG-35′-ACCCGATGAGCTA TGGTTAC -3

Statistical analysis

Data are presented as mean ± S.E.M, with n representing the number of independent experiments that were run in parallel. Mean values were compared by the ANOVA followed by Student's t-test, Mann–Whitney rank sum test or by Chi-square test where appropriate using SigmaStat program (Jandel Scientific, Chicago, Illinois). P < 0.05 was considered statistically significant.

Results

Testosterone protects female H9c2 cells against severe metabolic stress

To make sure that experiments would be performed on a pure female population of H9c2 cells, we have tested whether Sry was present in genomic DNA of these cells. We have found that no Sry-specific product was obtained by real time RT-PCR in H9c2 cells (Fig. 1A), while it was found in genomic DNA from male adult hearts as well as in mixes of different proportions of male and female genomic DNAs (Fig. 1A). Similarly as in H9c2 cells, no specific Sry product was found in genomic DNA from adult female hearts (Fig. 1A).
Fig. 1

Testosterone protects female H9c2 cells against severe metabolic stress. (A) Representative progress curves for the real-time PCR amplification of Sry genomic DNA from male and female rats mixed in different ratios (as labeled on the figure; from 100% male genomic DNA to 100% female genomic DNA), and from H9c2 cells. (B) A bar graph showing a percentage of control cells, and cells pretreated with testosterone (100 nM) that died after treatment with DNP (10 mM). Each bar represent mean ± SEM (n = 32–34). *P < 0.01 when compared to the control.

DNP is known metabolic inhibitor that was used with success to induce severe metabolic stress in H9c2 cells. When applied, this compound inhibits oxidative phosphorylation and ATP production leading to cell death. Under control conditions, 49.5 ± 1.4% (n = 32) of cells died after exposure to DNP (10 mM) (Fig. 1B). When the same type of stress was imposed on cells pre-treated with testosterone (100 nM), survival in the presence of DNP (10 mM) was significantly increased (39.4 ± 1.4% cells died, n = 34, P < 0.001; Fig. 1B).

Protein synthesis de novo is required for testosterone-mediated cytoprotection, but the cytoprotection is not mediated via androgen receptors in female H9c2 cells

Cycloheximide is an inhibitor of protein biosynthesis by interfering with the translocation step in protein synthesis thus blocking translational elongation. Pretreatment with cyclohexamide (1 μg/ml) did not have an effect on cell survival on its own (50.9 ± 1.5% of cells died in the presence of 10 mM DNP, n = 13, P = 0.36 when compared to the control of 48.3 ± 1.0%, n = 13; Fig. 2A), but it abolished testosterone-induced cytoprotection (10 mM DNP induced death of 49.7 ± 1.7% cells when pre-treated with both 100 nM testosterone and 1 μg/ml cyclohexamide, n = 13, P = 0.01 when compared to testosterone group of 39.9 ± 1.3%; Fig. 2A). Such findings implied genomic effect of testosterone that is normally mediated by androgen receptors. To determine whether androgen receptors mediate observed cytoprotection afforded by testosterone, we have used hydroxyflutamide, a well established antagonist of these receptors. Hydroxyflutamide (1 μM) on its own did not affect cell survival in the presence of DNP (10 mM; 50.8 ± 3.6% of cells died after challenge with 10 mM DNP, n = 7, P = 0.70 when compared to the control of 49.6 ± 1.1%, n = 7; Fig. 2B). Hydroxyflutamide (1 μM) did not block cytoprotection afforded by 100 nM testosterone (10 mM DNP induced death of 43.8 ± 3.7% cells when pre-treated with both 100 nM testosterone and 1 μM hydroxyflutamide, n = 6, P = 0.72 when compared to testosterone group of 40.7 ± 3.7%, n = 6; Fig. 2B). In addition, real time RT-PCR revealed that the level of expression of androgen receptors in H9c2 cells was very low (Fig. 2B).
Fig. 2

Genomic effect mediates testosterone-induced cytoprotection without involving androgen receptors in female H9c2 cells. (A) A bar graph showing a percentage of control cells, cells pretreated with testosterone (100 nM) and cycloheximide (1 μg/ml) alone and together. Each bar represent mean ± SEM (n = 13 for each). *P < 0.05 when compared to the testosterone group. (B) A bar graph showing a percentage of control cells, cells pretreated with testosterone (100 nM) and hydroxyflutamide (1 μM) alone and together. Each bar represent mean ± SEM (n = 6–7). *P < 0.05 when compared to the testosterone group. (B1) Representative progress curves for the real-time PCR amplification of androgen receptor cDNA from male rats and H9c2 cells.

Conversion into compound(s) activating estrogen receptors mediates cytoprotection afforded by testosterone

One unlikely possibility was that testosterone exhibited its effect via activation of estrogen receptors. Tamoxifene is a known partial agonist of estrogen receptors that act as an antagonist in a presence of full receptor agonist. On its own, pre-treatment with tamoxifene (1 μM) has no effect on 10 mM DNP-induced cell death (49.8 ± 1.6% cells died after challenge with 10 mM DNP, n = 9, P = 0.70 when compared to the control of 48.6 ± 1.6%, n = 9; Fig. 3A), but it abolished cytoprotection afforded by 100 nM testosterone (10 mM DNP induced death of 52.5 ± 2.6% cells when pre-treated with both 100 nM testosterone and 1 μM tamoxifene, n = 8, P = 0.006 when compared to testosterone group of 39.3 ± 1.4%; n = 9, Fig. 3A).
Fig. 3

Conversion of testosterone and activation of estrogen receptors is required for testosterone-mediated cytoprotection in female H9c2 cells. (A) A bar graph showing a percentage of control cells, cells pretreated with testosterone (100 nM) and tamoxifene (1 μM) alone and together. Each bar represent mean ± SEM (n = 9 for each). *P < 0.05 when compared to the testosterone group. (B) A bar graph showing a percentage of control cells, cells pretreated with testosterone (100 nM) and finasteride (100 ng/ml) alone and together. Each bar represent mean ± SEM (n = 6 for each). *P < 0.05 when compared to the testosterone group. (C) A bar graph showing a percentage of control cells, cells pretreated with testosterone (100 nM) and anastrozole (100 μM) alone and together. Each bar represent mean ± SEM (n = 5 for each). *P < 0.05 when compared to the testosterone group. (D) A bar graph showing a percentage of control cells, and cells pretreated with 17β-estradiol (E2; 100 nM) that died after treatment with DNP (10 mM). Each bar represent mean ± SEM (n = 6 for each). *P < 0.01 when compared to the control.

Testosterone is not an agonist of estrogen receptors and it was therefore unlikely that testosterone-induced cytoprotection was mediated via direct interaction with estrogen receptors. However, it is known that testosterone can be converted into metabolites that activate estrogen receptors by 5α-reductase and aromatase. To explore a possibility that cytoprotection by testosterone is due to its conversion, we have tested the effect of inhibitors of 5α-reductase and α-aromatase. Finasteride and anastrozole are well established inhibitors of 5α-reductase and aromatase respectively. On its own, finasteride (100 ng/ml) did not significantly affect cellular susceptibility to DNP (10 mM; DNP induced death of 54.8 ± 1.9% cells pretreated with finasteride, n = 6, P = 0.26 when compared to the control of 49.5 ± 1.7%, n = 6, Fig. 3B), but its presence abolished cytoprotection by testosterone (100 nM), and even exacerbated the effect of DNP (10 mM) as 80.2 ± 5.4% of H9c2 cells died when pretreated with finasteride (100 ng/ml) and testosterone (100 nM) combined (Fig. 3B). On its own anastrozole (100 μM), exacerbated the effect of DNP (10 mM; 73.7 ± 7.1% cells pretreated with anastrozole died in response to DNP), but the difference was not significantly different from controls of 55.7 ± 4.9% (P = 0.07 when compared with control, n = 5 for each, Fig. 3C). Testosterone (100 nM) did not increase survival of cells challenged with DNP (10 mM) when incubated in combination with anastrozole (100 μM; 66.7 ± 3.4% cells died, n = 5 for each, P = 0.40 when compared with anastrozole alone, Fig. 3C). As these results supported idea that conversion of testosterone and the activation of estrogen receptors protects female H9c2 cells against severe metabolic stress, we have tested whether known agonist of these receptors 17β-estradiol (E2) would have similar cytoprotective effect. Pretreatment of H9c2 cells for 24 h with E2 (100 nM) significantly improve cellular survival in response to DNP (10 mM) as 53.3 ± 5.4% cells died under control conditions and only 30.7 ± 2.7% cells died when pretreated by E2 (100 nM, P = 0.003, n = 6 for each, Fig. 3D).

Testosterone does not affect expression of sarcolemmal KATP channel subunits and accessory proteins

Experiments with pharmacological tools up to that particular point suggested that testosterone is cytoprotective by activating estrogen receptors which seemed to be due to conversion of testosterone to a compound that activates these receptors. It has been previously shown that 17β-estradiol (E2), a main estrogen, confers cytoprotection in H9c2 cells by up-regulating SUR2A, an ABC protein serving as a regulatory subunit of sarcolemmal ATP-sensitive K+ (KATP) channels (Jovanović and Jovanović, 2009). An increase in SUR2A increases levels of sarcolemmal KATP channels (Du et al., 2006) that confers cytoprotection by virtue of their channel and non-channel properties (Du et al., 2010). In addition, sarcolemmal KATP channels have been suggested to be end-effectors of cardioprotective signaling pathway activated by ischemic preconditioning (Budas et al., 2004; Sukhodub et al., 2007). It has been established that sarcolemmal KATP channels are composed of Kir6.2 and SUR2A subunits (reviewed by Jovanović and Jovanović, 2009). However, more recent studies suggested sarcolemmal KATP channel protein complex can contain more subunits/accessory proteins including Kir6.1, Kir6.2, SUR1, SUR2A, SUR2B, adenylate kinase (AK), creatine kinase (CK), muscle form of lactate dehydrogenase (M-LDH) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Carrasco et al., 2001; Crawford et al., 2002a,b; Jovanović et al., 2005). Real time RT-PCR did not reveal any statistically significant difference in mRNA levels of GAPDH as a control gene as well as eight additional KATP channel-forming subunits between untreated and 100 nM testosterone-treated female H9c2 cells (Fig. 4). At the same time, pretreatment with E2 (100 nM) did result in increased SUR2A mRNA levels (Fig. 4; threshold cycles under control conditions and when pretreated with E2 were 27.4 ± 0.2 and 26.7 ± 0.2 respectively, n = 9 for each, P = 0.017), while E2 did not have effect on GAPDH as a control gene (threshold cycles under control conditions and when pretreated with E2 were 14.7 ± 0.2 and 14.6 ± 0.1 respectively, n = 9 for each, P = 0.55).
Fig. 4

Testosterone does not regulate the expression of sarcolemmal KATP channel subunits and accessory proteins in female H9c2 cells. Relative expression ratio (treated/untreated ratio of mRNA calculated as described in Section 2) of depicted channel subunits and accessory proteins pretreated with either testosterone (100 nM) or E2. Each bar represents mean ± SEM (n = 6).

Testosterone regulates expression of mitochondrial sulfonylurea receptor 2B (IES SUR2B) splice variants and this seems to mediate cytoprotection

In many studies, mitochondrial KATP (mKATP) channels have been suggested to play a central role in cardioprotective signaling (reviewed by Garlid et al., 2009). Mitochondrial KATP channels have been described for the first time in 1991 (Inoue et al., 1991), but they are not yet fully understood. One of the most studied and disputed issue about mKATP channels is their structure. From 1997 until these days different proteins and subunits have been suggested to form mKATP channels (Suzuki et al., 1997; Seharaseyon et al., 2000; Lacza et al., 2003; Zhou et al., 2005). Most recently, it has been shown that SUR2A and SUR2B generated by non-conventional intraexonic splicing (IES SUR2A and B) physically associate with Kir6.2 to form mKATP channels (Ye et al., 2009). Both of these variants regulate Kir6.2 activity and IES SUR2B has been shown to be involved in cardioprotection (Ye et al., 2009). Therefore, we have assessed whether testosterone regulates the expression of IES SUR2A and IES SUR2B. For IES SUR2A under control conditions the threshold cycles value was 28.5 ± 0.6 (n = 6) and that was not significantly different from this value in cells pretreated with 100 nM testosterone (threshold cycles: 28.6 ± 0.7, n = 6, P = 0.98). For IES SUR2B threshold cycles value was 33.7 ± 0.3 (n = 6) and this was significantly higher than those value for cells pretreated with 100 nM testosterone (threshold cycles: 31.8 ± 0.3, n = 6, P < 0.001). GAPDH as a control gene was not affected (threshold cycles under control conditions and when pretreated with testosterone were 16.5 ± 0.3 and 16.2 ± 0.2 respectively, n = 6 for each, P = 0.70). Although IES SUR2B has been already associated with cardioprotection (Ye et al., 2009), we looked for more evidence about connection between testosterone-induced cardioprotection and IES SUR2B up-regulation. Therefore, we have examined whether tamoxifene, a partial agonist of estrogen receptors that abolished testosterone-mediated effect on female H9c2 cells, would affect in any way testosterone-induced up-regulation of IES SUR2B. On its own, tamoxifene (1 μM) did not significantly alter levels of IES SUR2A and IES SUR2B mRNA levels in comparison to control one (IES SUR2A: threshold cycles under control conditions and when pretreated with tamoxifene were 28.9 ± 0.2 and 28.8 ± 0.3 respectively, n = 6 for each, P = 0.91, Fig. 5; IES SUR2B: threshold cycles under control conditions and when pretreated with tamoxifene were 33.3 ± 0.2 and 33.4 ± 0.3 respectively, n = 6 for each, P = 0.97, n = 6 for each, Fig. 5) neither it affected the expression of GAPDH (threshold cycles under control conditions and when pretreated with testosterone were 16.0 ± 0.1 and 16.1 ± 0.1 respectively, n = 6 for each, P = 0.88). However, testosterone (100 nM) was unable to up-regulate IES SUR2A and IES SUR2B in the presence of tamoxifene (1 μM) (threshold cycles in this case was 28.3 ± 0.3, n = 6 for IES SUR2A and 32.9 ± 0.3 for IES SUR2B; Fig. 5) and also did not affect expression of control GAPDH (threshold cycles under control conditions and when pretreated with testosterone were 16.0 ± 0.1 and 16.1 ± 0.1 respectively, n = 6 for each, P = 0.88). We have then examined whether E2 would affect the expression of IES SUR2A and IES SUR2B. Pretreatment of female H9c2 cells with E2 (100 nM) did not affect level of IES SUR2A (threshold cycles when pretreated with E2 was 28.7 ± 0.2 respectively, n = 6, P = 0.64 when compared to the control value; Fig. 5). In contrast, E2 (100 nM) did up-regulate IES SUR2B (threshold cycles when pretreated with E2 was 32.2 ± 0.2 respectively, n = 6, P = 0.003 when compared to the control value; Fig. 5). The level of a control gene, GAPDH, was not affected (threshold cycles under control conditions and when pretreated with testosterone were 16.7 ± 0.2 and 16.8 ± 0.1 respectively, n = 6 for each, P = 0.75).
Fig. 5

Testosterone regulates the expression of IES SUR2B, but not IES SUR2A. Relative expression ratio (treated/untreated ratio of mRNA calculated as described in Section 2) of IES SUR2A and IES SUR2B under conditions depicted on graphs. Each bar represents mean ± SEM (n = 6). *P < 0.05 when compared to the control.

Discussion

The effect of testosterone on myocardial resistance to ischemia has been studied and recent reports suggest that chronic treatment with this hormone is cardioprotective in males (Liu et al., 2006; Tsang et al., 2008). In females, testosterone effect on the heart has not been extensively studied, but there are clinical and experimental in vivo reports supporting a possible cardioprotective role of testosterone in females (Montalcini et al., 2007; Sievers et al., 2010). The results obtained in the present study would support such notion, as we have found that testosterone protected female H9c2 cells against severe metabolic stress induced by DNP. Testosterone is a steroid hormone that exhibits its physiological effects mostly by regulating the expression of certain genes (reviewed by Rahman and Christian, 2007). In the present study, we have shown that cyclohexamide, an inhibitor of protein synthesis, abolished testosterone-mediated cytoprotection suggesting that genomic effect is responsible for the observed testosterone action. As one would expect, testosterone mediate its effects mainly by activating androgen receptors (Tsang et al., 2007). However, our experiments by real time RT-PCR has demonstrated that there is a low level of expression of androgen receptors in female H9c2 cells, which would make cytoprotection via androgen receptors rather unlikely. Indeed, antagonist of androgen receptors, hydroxyflutamide (Berrevoets et al., 2002), did not alter the effect of testosterone whatsoever, effectively excluding a possibility that androgen receptors mediate testosterone-induced cytoprotection in female H9c2 cells. It has been previously described that the activation of estrogen receptors (ER) in female cells results in increase in cellular resistance to a range of different stresses (Jovanović et al., 2000; Murphy and Steenbergen, 2007). Testosterone has low affinity and intrinsic activity for ER (Rahman and Christian, 2007), but we have still tested an unlikely possibility that these receptors could be involved in testosterone-induced cytoprotection. Tamoxifene is a partial agonist that acts as antagonist of ER in the presence of a full agonist (Ellmann et al., 2009). This compound did not significantly affect cell survival under DNP on its own, suggesting that full agonistic activity at ER is essential if cytoprotection is to be achieved. On the other hand, tamoxifene blocked the effect of testosterone. This would suggest that the activation of ER mediate testosterone-induced increase in cellular resistance to metabolic stress. This was surprising result when considering that testosterone cannot activate ER (Rahman and Christian, 2007). In both sexes testosterone acts not only as a ligand for androgen receptors but also as a precursor for other steroids. Importantly testosterone can be converted to 5α-dihydrotestosterone (DHT) by the 5α-reductase enzyme or to estradiol in a number of tissues by the aromatase enzyme (Handa et al., 2009). To test a possibility that testosterone-induced cytoprotection is mediated by conversion of this hormone to its metabolites, we conducted cell survival experiments with finasteride and anastrozole. We found that both finasteride, a 5α-reductase inhibitor (Schmidt et al., 2006), and anastrozole, an aromatase inhibitor (Schmidt et al., 2006), abolished the protective effect of testosterone. This strongly suggests that conversion of testosterone is required for observed cytoprotective effect. The identity of the metabolite(s) mediating cardioprotection afforded by testosterone is yet to be determined, but there are many possibilities. Besides obvious one, estradiol, which cardioprotective effect was also confirmed in this study, 3β-diol or 3α-diol are also realistic option as 5α-reductase converts testosterone to DHT which is then subsequently converted to these metabolites. It has been demonstrated that 3β-diol and 3α-diol can bind and activate ER (Pak et al., 2005; Wang et al., 2009). In addition to that, a role of some other metabolite of testosterone cannot be excluded. In the heart, testosterone can be metabolized into androstendione, 5α-androstane, 2α-HT, 6α-HT, 7α-HT, 16α-HT, 6β-HT and 5α-androstane (Thum and Borlak, 2002). This is a whole array of metabolites and a substantial research is further required to identify all testosterone metabolites occurring in our experimental conditions and link them to the observed effect of cytoprotection. Nevertheless, at the present moment in time, we can suggest that testosterone metabolite(s), and not testosterone directly, mediate cytoprotection in female H9c2 cells. Cardioprotection by activation of ER is not a surprise, as there are reports showing that different isoforms of ER are important in mediating myocardial protection in females (Wang et al., 2006, 2009). Wang et al. (2006) demonstrated that ERα contributes to acute myocardial protection in females possibly via differential activation of mitogen-activated protein kinase (MAPK). The same group then went on to show in a later study that ERβ also improves myocardial function in female mice hearts after acute ischemia by activation of the phosphoinositide 3 kinase/protein kinase B (PI3K/PKB) signaling system (Wang et al., 2009). We have previously shown that estrogens up-regulate SUR2A, a regulatory subunit of sarcolemmal KATP channels, and consequently increase the number of these channels. KATP channels have been suggested as end-effectors of ischemic preconditioning (Budas et al., 2004) and acute increase in number of KATP channels in sarcolemma is a feature of preconditioning (Sukhodub et al., 2007). An up-regulation of SUR2A alone is sufficient to increase numbers of sarcolemmal KATP channels, which in turn increases cardiac resistance to stress by virtue of channel and non-channel properties of these channels (Jovanović and Jovanović, 2009; Du et al., 2010). As SUR2A expression is regulated by estrogens (Ranki et al., 2002; also confirmed in the present study) and testosterone-derived metabolites that activate ER mediate observed cytoprotection, it was logical to test whether testosterone would up-regulate SUR2A. Our experiments showed that it did not. In addition, testosterone also did not affect expression of any other KATP channel-forming subunit or accessory protein showing that testosterone-mediated cytoprotection is not associated with up-regulation of sarcolemmal KATP channels. Why SUR2A is not increased following activation of ER is not clear at the moment. It is possible that metabolites other than E2, such as 3β-diol and/or 3α-diol or some others, play a crucial role in mediating such effect or that simultaneous presence of E2 and/or other metabolites competing with E2 to ER modify the signaling outcome of ER activation. Nevertheless, the obtained results strongly suggest that regulation of expression of SUR2A is not a part of signaling pathway mediating testosterone effect on female H9c2 cells. In addition to sarcolemmal KATP channels, KATP channels localized on mitochondrial inner membrane (mKATP channels) have been also implicated into cardioprotection. In fact, there are a lot reports claiming that these channels play a central role in the cardioprotective signaling pathway(s) (reviewed by Garlid et al., 2009). The composition of these channels is not yet established (Suzuki et al., 1997; Seharaseyon et al., 2000; Lacza et al., 2003; Zhou et al., 2005). The most recent suggestion is that mitochondrial KATP channels are composed of Kir6.2, as a pore-forming subunit, and IES SUR 2A or IES SUR2B (Ye et al., 2009). It has been demonstrated that IES SUR2B regulate myocardial resistance to metabolic stress (Ye et al., 2009). Therefore, we have examined a possibility that IES SUR2A and IES SUR2B are regulated by testosterone. The obtained results suggested that IES SUR2A is not regulated by testosterone. In contrast, IES SUR2B was up-regulated by testosterone and this is the first report ever identifying a factor/hormone that regulates IES SUR2B. It has been previously shown that increased level of IES SUR2B generates cardioprotective phenotype (Ye et al., 2009) and from this prospective it would be logical to conclude that up-regulation of IES SUR2B mediates cardioprotection afforded by testosterone. However, as there are no tools available to inhibit up-regulation of IES SUR2B, we have looked for additional circumstantial evidence. As tamoxifene inhibits cytoprotection afforded by testosterone, it would be expected that this compound would also affect testosterone-induced up-regulation of IES SUR2B, as opposed to the same for IES SUR2A. This is exactly what happened in our experimentation, confirming a notion that testosterone protect embryonic rat heart H9c2 cells against severe metabolic stress by up-regulating IES SUR2B. This is further supported by our finding that E2 also specifically up-regulates IES SUR2B. This is the first time ever that a regulation of IES SUR2B expression was demonstrated to be a part of cytoprotective signaling. It is quite possible that IES SUR2B regulate the number of functional mKATP channels in a similar manner as SUR2A subunit regulate the number of fully assembled sarcolemmal KATP channels (Jovanović and Jovanović, 2009). Consequently, an increase in number of cardioprotective mKATP channels induced by testosterone would foster a cardioprotective outcome. In conclusion, this study has shown that testosterone protect female embryonic heart H9c2 cells against severe metabolic stress by its conversion into metabolite(s) that activate estrogen receptors and up-regulate IES SUR2B. The obtained results suggest that testosterone could be used as a therapeutic in females in conditions where increased resistance to metabolic stress would be beneficial, such as ischemic heart disease, heart failure and others. Testosterone is here recognized as the hormone/signaling factor that regulates expression of IES SUR2B, a likely subunit of mKATP channels.
  46 in total

1.  Testosterone is required for delayed cardioprotection and enhanced heat shock protein 70 expression induced by preconditioning.

Authors:  Jing Liu; Sharon Tsang; Tak Ming Wong
Journal:  Endocrinology       Date:  2006-06-22       Impact factor: 4.736

Review 2.  Non-classical actions of testosterone: an update.

Authors:  Faisal Rahman; Helen C Christian
Journal:  Trends Endocrinol Metab       Date:  2007-11-09       Impact factor: 12.015

3.  Low testosterone levels predict all-cause mortality and cardiovascular events in women: a prospective cohort study in German primary care patients.

Authors:  Caroline Sievers; Jens Klotsche; Lars Pieper; Harald J Schneider; Winfried März; Hans Ulrich Wittchen; Günter K Stalla; Christos Mantzoros
Journal:  Eur J Endocrinol       Date:  2010-08-04       Impact factor: 6.664

Review 4.  Inflammation and sex hormone metabolism.

Authors:  Martin Schmidt; Heidrun Naumann; Claudia Weidler; Martina Schellenberg; Sven Anders; Rainer H Straub
Journal:  Ann N Y Acad Sci       Date:  2006-06       Impact factor: 5.691

5.  Low concentrations of 17beta-estradiol protect single cardiac cells against metabolic stress-induced Ca2+ loading.

Authors:  S Jovanović; A Jovanović; W K Shen; A Terzic
Journal:  J Am Coll Cardiol       Date:  2000-09       Impact factor: 24.094

Review 6.  Antiandrogens: selective androgen receptor modulators.

Authors:  Cor A Berrevoets; Arzu Umar; Albert O Brinkmann
Journal:  Mol Cell Endocrinol       Date:  2002-12-30       Impact factor: 4.102

7.  Invited Commentary: Hormone therapy risks and benefits--The Women's Health Initiative findings and the postmenopausal estrogen timing hypothesis.

Authors:  Emily Banks; Karen Canfell
Journal:  Am J Epidemiol       Date:  2009-05-25       Impact factor: 4.897

8.  M-LDH serves as a sarcolemmal K(ATP) channel subunit essential for cell protection against ischemia.

Authors:  Russell M Crawford; Grant R Budas; Sofija Jovanović; Harri J Ranki; Timothy J Wilson; Anthony M Davies; Aleksandar Jovanović
Journal:  EMBO J       Date:  2002-08-01       Impact factor: 11.598

9.  Hypoxia-induced preconditioning in adult stimulated cardiomyocytes is mediated by the opening and trafficking of sarcolemmal KATP channels.

Authors:  Grant R Budas; Sofija Jovanovic; Russell M Crawford; Aleksandar Jovanovic
Journal:  FASEB J       Date:  2004-04-14       Impact factor: 5.191

10.  M-LDH physically associated with sarcolemmal K ATP channels mediates cytoprotection in heart embryonic H9C2 cells.

Authors:  Sofija Jovanović; Qingyou Du; Andriy Sukhodub; Aleksandar Jovanović
Journal:  Int J Biochem Cell Biol       Date:  2009-05-21       Impact factor: 5.085

View more
  14 in total

1.  ATP-sensitive potassium currents from channels formed by Kir6 and a modified cardiac mitochondrial SUR2 variant.

Authors:  Nitin T Aggarwal; Nian-Qing Shi; Jonathan C Makielski
Journal:  Channels (Austin)       Date:  2013-09-13       Impact factor: 2.581

2.  Mild hypoxia in vivo regulates cardioprotective SUR2A: A role for Akt and LDH.

Authors:  Khaja Shameem Mohammed Abdul; Sofija Jovanović; Qingyou Du; Andriy Sukhodub; Aleksandar Jovanović
Journal:  Biochim Biophys Acta       Date:  2015-01-08

3.  E2/ER β Enhances Calcineurin Protein Degradation and PI3K/Akt/MDM2 Signal Transduction to Inhibit ISO-Induced Myocardial Cell Apoptosis.

Authors:  Kuan-Ho Lin; Wei-Wen Kuo; Marthandam Asokan Shibu; Cecilia-Hsuan Day; You-Liang Hsieh; Li-Chin Chung; Ray-Jade Chen; Su-Ying Wen; Vijaya Padma Viswanadha; Chih-Yang Huang
Journal:  Int J Mol Sci       Date:  2017-04-24       Impact factor: 5.923

4.  Exposure to 15% oxygen in vivo up-regulates cardioprotective SUR2A without affecting ERK1/2 and AKT: a crucial role for AMPK.

Authors:  Khaja Shameem Mohammed Abdul; Sofija Jovanović; Aleksandar Jovanović
Journal:  J Cell Mol Med       Date:  2017-01-25       Impact factor: 5.310

5.  Insulin down-regulates cardioprotective SUR2A in the heart-derived H9c2 cells: A possible explanation for some adverse effects of insulin therapy.

Authors:  Qingyou Du; Sofija Jovanović; Andriy Sukhodub; Yong Shi Ngoi; Aashray Lal; Marina Zheleva; Aleksandar Jovanović
Journal:  Biochem Biophys Rep       Date:  2018-09-06

Review 6.  Testosterone, cardiomyopathies, and heart failure: a narrative review.

Authors:  Rodica Diaconu; Ionuţ Donoiu; Oana Mirea; Tudor Adrian Bălşeanu
Journal:  Asian J Androl       Date:  2021 Jul-Aug       Impact factor: 3.285

7.  Testosterone Antagonizes Doxorubicin-Induced Senescence of Cardiomyocytes.

Authors:  Paola Altieri; Chiara Barisione; Edoardo Lazzarini; Anna Garuti; Gian Paolo Bezante; Marco Canepa; Paolo Spallarossa; Carlo Gabriele Tocchetti; Sveva Bollini; Claudio Brunelli; Pietro Ameri
Journal:  J Am Heart Assoc       Date:  2016-01-08       Impact factor: 5.501

8.  Phenylephrine preconditioning in embryonic heart H9c2 cells is mediated by up-regulation of SUR2B/Kir6.2: A first evidence for functional role of SUR2B in sarcolemmal KATP channels and cardioprotection.

Authors:  Sofija Jovanović; Thomas Ballantyne; Qingyou Du; Miloš Blagojević; Aleksandar Jovanović
Journal:  Int J Biochem Cell Biol       Date:  2015-11-10       Impact factor: 5.085

9.  Effects of corticotropin-releasing hormone on the expression of adenosine triphosphate-sensitive potassium channels (Kir6.1/SUR2B) in human term pregnant myometrium.

Authors:  Joo Young Kim; Wen Hao Wu; Jin Hyun Jun; Jeenah Sohn; Yong Soo Seo
Journal:  Obstet Gynecol Sci       Date:  2017-12-11

10.  Transgenic overexpression of the SUR2A-55 splice variant in mouse heart reduces infract size and promotes protective mitochondrial function.

Authors:  Mohun Ramratnam; Barrett Kenny; John W Kyle; Brandi Wiedmeyer; Timothy A Hacker; David Y Barefield; Elizabeth M McNally; Jonathan C Makielski
Journal:  Heliyon       Date:  2018-07-04
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.