Literature DB >> 23074651

Shedding of the Pandemic Swine-Origin Influenza A Virus (H1N1) after Oseltamivir Administration.

Leiyun Weng1, Qiang Wang, Wei Wang, Peijun Ren, Vincent Deubel, Tetsuya Toyoda.   

Abstract

We analyzed the virus shedding of an oseltamivir-treated patient who had been infected with the pandemic swine-origin influenza A (H1N1) virus which had an oseltamivir-sensitive neuraminidase. The virus was isolated from the pharyngeal swabs of the patient using MDCK cells, and the virus genome RNA was detected in the same samples both by real-time RT-PCR and RT-PCR. The virus was isolated until 44 h after oseltamivir administration although the virus genome was detected until one day after oseltamivir treatment was stopped. Due to their high sensitivity, RT-PCR and real-time RT-PCR may cause misdiagnosis by detection of viral genome which does not infect, and classical virus isolation and clinical symptoms are recommended for the evaluation of oseltamivir treatment.

Entities:  

Year:  2010        PMID: 23074651      PMCID: PMC3447301          DOI: 10.1155/2010/976084

Source DB:  PubMed          Journal:  Influenza Res Treat        ISSN: 2090-1380


1. Introduction

The novel swine origin influenza A virus (S-OIV) (H1N1) caused pandemic in 2009-2010 [1]. Oseltamivir (Tamiflu, Hoffmann LaRoche) is recommended for the treatment of S-OIV infection because it is naturally resistant to amantadine and rimantadine but is susceptible to the neuraminidase inhibitors, oseltamivir, and zanamivir (Relenza, Glaxo Smithkline) although the oseltamivir-resistant neuraminidase (NA) H275Y (N1 numbering) was detected in some isolates [2-4]. Here, we precisely report the virus shedding of the pandemic S-OIV after oseltamivir treatment (Table 1).
Table 1

Symptoms and detection of S-OIV.

Date (2009)Sep 16171819202122232425262728
Time (day)12345678910111213

Oseltamivir+1 +++++++++
Real-time RT-PCR+++++++++
RT-PCR++++++
Virus isolation+2 +3
Fever (>38.5°C)++
Sore throat++++++++++++++++
Headache+++++++++++++
Cough+++++++++++++++±

1Seventy-five mg of oseltamivir. The first tablet was administered around 21:00.

2Pharyngeal swab was taken around 17:00 (20 h after oseltamivir administration).

3Pharyngeal swab was taken around 17:00 (44 h after oseltamivir administration).

2. Case Presentation

A 24-year-old female in Shanghai, China was infected with the pandemic S-OIV in September 2009. She had received a seasonal flu vaccination (Sanofi Pasteur) the previous year. Her first symptom was a sore throat, and on the 4th day after the onset of her sore throat, she had a high fever (>38.5°C). The next day (the 5th day after onset), she visited a clinic. Her blood cell count was normal. Her chest X-ray did not show bronchitis or pneumonia. Oseltamivir (75 mg × 2) was administered at 36 hours after the onset of her high fever for five days. On the second day of oseltamivir administration, her high fever disappeared, and all eight segments of the S-OIV genome were cloned from her pharyngeal swabs, and the sequences of the pandemic S-OIV were confirmed. Its neuraminidase (NA) contained an oseltamivir-sensitive sequence (275H). Since then, pharyngeal swabs were collected everyday for eight days and subjected to virus isolation and examined for virus genome RNA (from the 6th to the 13th day). Each pharyngeal swab was aliquoted into three fractions: for virus isolation, for RT-PCR, and for real-time RT-PCR, and each experiment was performed in a different lab. For virus genome detection, RNA was extracted from the pharyngeal swabs using Trizol (Invitrogen). The RNA was then analyzed by real time RT-PCR for S-OIV haemagglutinin (HA), which was performed in a SmartCycler II System (Cepheid) using a QuantiTect Probe RT-PCR kit (Qiagen) with the primers (HA primer 1 and 2) and HA probe listed in Table 2. At the same time, the RNA was analyzed for the eight genome segments by RT-PCR. The cDNA was reverse transcribed by MMLV RTase (Takara) using Uni12 (AGCAAAGCAGG and AGCGAAAGCAGG) [5], before being subjected to PCR using LA-Taq (Takara) for the coding frames of the eight genome segments and the primers listed in Table 2.
Table 2

Sequences used for RT-PCR and real-time RT-PCR.

NameSequence (5′→3′)
PB2 f (BamHI)CTGGATCCATGGAGAGAATAAAAGAACTGAGAGATC
PB2 r (NotI)CTGCGGCCGCCTAATTGATGGCCATCCGAATTC
PB1 f (BamHI)CTGGATCCATGGATGTCAATCCGACTCTACTTTTC
PB1 r (NotI)CTGCGGCCGCTTATTTTTGCCGTCTGAGTTCTTC
PA f (BamHI)GCGGATCCATGGAAGACTTTGTGCGACAATG
PA r (NotI)GCGCGGCCGCCTACTTCAGTGCATGTGTGAGGAAGG
HA f (NheI)GCTAGCCATGAAGGCAATACTAGTAGTTCTGC
HA r (EcoRI)GAATTCTTAAATACATATTCTACACTGTAGAGACCC
NP f (KpnI)GCGGTACCATGGCGTCTCAAGGCACCA
NP r (PstI)ATCTGCAGTCAACTGTCATACTCCTCTGCATTGTC
NA fATGAATCCAAACCAAAAGATAATAACC
NA rTTACTTGTCAATGGTAAATGGCAAC
M fATGAGTCTTCTAACCGAGGTCG
M rTTACTCTAGCTCTATGTTGACAAAATG
NS fATGGACTCCAACACCATGTCAAG
NS rTTAAATAAGCTGAAACGAGAAAGCTCT
HA primer 1GTAAAGCTGGAATCAACAAGG
HA primer 2GAGACCCATTAGAGCACATC
HA probeTET-GATTGCCCCCAGGGAGACTA-BHQ1
Her pharyngeal swabs were also inoculated into MDCK cells after filtration through 0.22 μm filter (Millipore) and then incubated in DMEM with 2 μg/ml trypsin (DIFCO), 1 mg/ml BSA (Sigma), 50 units/ml of penicillin (Invitrogen), 50 μg/ml of streptomycin (Invitrogen), and 0.1 mg/ml kanamycin (Invitrogen) at 37°C for the detection of cytopathic effects (CPEs). When CPEs were detected, the pandemic S-OIV genome segments were also identified by RT-PCR of the culture supernatant. Oseltamivir is accepted as the standard treatment for S-OIV [2, 4]. Although oseltamivir was effective, the virus was isolated from her pharyngeal swabs on the second (20 hours) and third (44 hours) days of oseltamivir administration. The eight viral genome segments were detected by RT-PCR, and HA genome was detected by real-time RT-PCR until the day after the end of oseltamivir administration. No other people around her showed any symptoms. By 36 hours of oseltamivir administration in previous cases, the influenza A/Texas/91 (H1N1) virus had disappeared from the patients' nasopharyngeal swabs [6]. In this case, the virus (influenza virus A/Shanghai/P1/2009 (H1N1)) was still isolated from the patient's pharyngeal swab on the third day (44 hours) of oseltamivir administration, and the viral genome segments were detected until the day after oseltamivir administration was stopped. RT-PCR detection is more sensitive than virus isolation [7]. The +++ and ++ scores of real-time RT-PCR correlated with those of virus isolation. The prolonged detection of viral RNA without the oseltamivir-resistant mutation of NA by RT-PCR or real-time RT-PCR from the S-OIV-infected patients administrated with oseltamivir was also reported previously [8, 9]. All of these reports indicate that S-OIV could persist in the patients although shedding of S-OIV may vary from case to case. However, due to their high sensitivity, RT-PCR and real-time RT-PCR may cause misdiagnosis, and the classical virus isolation and clinical symptoms are still recommended [10].

3. Conclusions

The classical virus isolation and clinical symptoms are recommended for the evaluation of oseltamivir treatment although RT-PCR and real-time RT-PCR are convenient.

Consent

Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.

Conflict of Interests

The authors declare that they have no conflict of interests.

Authors' Contributions

L. Weng and Q. Wang collected samples and performed RT-PCR, W. Wang, P. Ren, and V. Deubel performed virus isolation and real-time RT-PCR, and L. Weng and T. Toyoda wrote the paper.
  9 in total

1.  Quantification of the influenza virus load by real-time polymerase chain reaction in nasopharyngeal swabs of patients treated with oseltamivir.

Authors:  Guy Boivin; Zoé Coulombe; Cynthia Wat
Journal:  J Infect Dis       Date:  2003-08-05       Impact factor: 5.226

2.  Prolonged shedding of influenza A(H1N1)v virus: two case reports from France 2009.

Authors:  H Fleury; S Burrel; C Balick Weber; R Hadrien; P Blanco; C Cazanave; M Dupon
Journal:  Euro Surveill       Date:  2009-12-10

3.  Pandemic influenza A(H1N1)v viruses currently circulating in New Zealand are sensitive to oseltamivir.

Authors:  R J Hall; M P Peacey; J C Ralston; J Bocacao; M Ziki; W Gunn; A Quirk; Q S Huang
Journal:  Euro Surveill       Date:  2009-07-30

4.  Effects of early oseltamivir therapy on viral shedding in 2009 pandemic influenza A (H1N1) virus infection.

Authors:  Li M Ling; Angela L Chow; David C Lye; Adriana S Tan; Prabha Krishnan; Lin Cui; Nwe N Win; Monica Chan; Poh L Lim; Cheng C Lee; Yee S Leo
Journal:  Clin Infect Dis       Date:  2010-04-01       Impact factor: 9.079

5.  Universal primer set for the full-length amplification of all influenza A viruses.

Authors:  E Hoffmann; J Stech; Y Guan; R G Webster; D R Perez
Journal:  Arch Virol       Date:  2001-12       Impact factor: 2.574

6.  Use of the oral neuraminidase inhibitor oseltamivir in experimental human influenza: randomized controlled trials for prevention and treatment.

Authors:  F G Hayden; J J Treanor; R S Fritz; M Lobo; R F Betts; M Miller; N Kinnersley; R G Mills; P Ward; S E Straus
Journal:  JAMA       Date:  1999-10-06       Impact factor: 56.272

7.  Clinical features of the initial cases of 2009 pandemic influenza A (H1N1) virus infection in China.

Authors:  Bin Cao; Xing-Wang Li; Yu Mao; Jian Wang; Hong-Zhou Lu; Yu-Sheng Chen; Zong-An Liang; Lirong Liang; Su-Juan Zhang; Bin Zhang; Li Gu; Lian-He Lu; Da-Yan Wang; Chen Wang
Journal:  N Engl J Med       Date:  2009-12-09       Impact factor: 91.245

8.  Duration of influenza A virus shedding in hospitalized patients and implications for infection control.

Authors:  Surbhi Leekha; Nicole L Zitterkopf; Mark J Espy; Thomas F Smith; Rodney L Thompson; Priya Sampathkumar
Journal:  Infect Control Hosp Epidemiol       Date:  2007-07-06       Impact factor: 3.254

9.  Evaluation of a rapid molecular algorithm for detection of pandemic influenza A (H1N1) 2009 virus and screening for a key oseltamivir resistance (H275Y) substitution in neuraminidase.

Authors:  E van der Vries; M Jonges; S Herfst; J Maaskant; A Van der Linden; J Guldemeester; G I Aron; T M Bestebroer; M Koopmans; A Meijer; R A M Fouchier; A D M E Osterhaus; C A Boucher; M Schutten
Journal:  J Clin Virol       Date:  2009-10-25       Impact factor: 3.168

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.