Literature DB >> 23056495

Anion-sensitive fluorophore identifies the Drosophila swell-activated chloride channel in a genome-wide RNA interference screen.

Stephanie C Stotz1, David E Clapham.   

Abstract

When cells swell in hypo-osmotic solutions, chloride-selective ion channels (Cl(swell)) activate to reduce intracellular osmolality and prevent catastrophic cell rupture. Despite intensive efforts to assign a molecular identity to the mammalian Cl(swell) channel, it remains unknown. In an unbiased genome-wide RNA interference (RNAi) screen of Drosophila cells stably expressing an anion-sensitive fluorescent indicator, we identify Bestrophin 1 (dBest1) as the Drosophila Cl(swell) channel. Of the 23 screen hits with mammalian homologs and predicted transmembrane domains, only RNAi specifically targeting dBest1 eliminated the Cl(swell) current (I(Clswell)). We further demonstrate the essential contribution of dBest1 to Drosophila I(Clswell) with the introduction of a human Bestrophin disease-associated mutation (W94C). Overexpression of the W94C construct in Drosophila cells significantly reduced the endogenous I(Clswell). We confirm that exogenous expression of dBest1 alone in human embryonic kidney (HEK293) cells creates a clearly identifiable Drosophila-like I(Clswell). In contrast, activation of mouse Bestrophin 2 (mBest2), the closest mammalian ortholog of dBest1, is swell-insensitive. The first 64 residues of dBest1 conferred swell activation to mBest2. The chimera, however, maintains mBest2-like pore properties, strongly indicating that the Bestrophin protein forms the Cl(swell) channel itself rather than functioning as an essential auxiliary subunit. dBest1 is an anion channel clearly responsive to swell; this activation depends upon its N-terminus.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 23056495      PMCID: PMC3464265          DOI: 10.1371/journal.pone.0046865

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

All mammalian cells express chloride channels activated by decreases in extracellular osmolality, albeit with different biophysical properties [1]. The ubiquitous expression of Clswell suggests its essential cellular function. Tightly regulated Clswell channels participate in volume regulation, motility, cell survival, and cell division [1]. In contrast, de-regulated constitutively active Clswell channels exacerbate several cardiac diseases, including myocardial hypertrophy and heart failure [2]. The mammalian Clswell channel- encoding gene has yet to be identified despite the wealth of proteins nominated by candidate approaches [3]. These proteins include ClC-2 [4], ClC-3 [5], P-glycoprotein [6], [7], pICln [8], [9], p64 [10], phospholemman [11], Best1 and 2 [12], TMEM16A [13], and TMEM16F [14]. The research community has yet to agree on any of these candidates as a bona fide Clswell channel. In Drosophila, however, accumulating evidence indicates that dBest1 encodes for a Clswell channel. RNAi targeting dBest1 eliminates Drosophila Schneider (S2) cell IClswell, an effect rescued by re-introduction of dBest1 [15]. Further, swell activated dBest1 mutants have altered biophysical properties and reactivity to sulfhydryl reagents [16]. dBest1 likely forms the chloride conducting pore, but it may be an obligate auxillary subunit of Drosophila IClswell that modifies channel properties akin to CaV β subunits [17]. Assigning chloride channel function to any protein is difficult. The known chloride channel families (e.g., ClC, Anoctamin/TMEM16, CFTR, and ionotropic GABAA and GlyR) lack structural pore or gating motifs that might form the basis for in silico identification. Expression cloning approaches have also failed due to widespread Clswell channel expression that precludes the separation of endogenous and over-expressed protein activities. Moreover, known chloride channels blockers are non-specific and their affinities are far too low to encourage affinity purification. Finally, previous chloride indicators are poor tools for screening due to loading and retention issues, inconsistent results, and poor reproducibility [18]. Here we present an unbiased genome-wide, high-throughput RNAi screen designed to identify the Drosophila Clswell channel and its regulators. Our screen employed H148Q-YFP, a genetically encoded anion-sensitive yellow fluorescent protein [19], to report Clswell activity in Drosophila S2R+ cells. Of our 595 initial hits that altered chloride handling, we concentrated on characterizing proteins with mammalian homology and at least one transmembrane domain as potential Clswell channels. dBest1 emerged from our screen as the lead candidate for Drosophila Clswell. Both RNAi knockdown of dBest1 and overexpression of a dominant-negative dBest1 eliminated the Clswell current in Drosophila S2R+ cells. Conversely, dBest1 overexpression in a mammalian system (HEK cells) produced a Drosophila–like IClswell. To identify domains necessary for swell activation we characterized chimeras between the swell-sensitive dBest1 and the swell-insensitive mBest2. Swell sensitivity is only apparent in mBest2, the closest mammalian homolog of dBest1, when the protein contains the dBest1 amino (N)-terminus. This chimera maintains the pore properties of mBest2, providing additional evidence that the protein itself forms a channel rather than functioning as a necessary auxiliary subunit. We conclude that dBest1 is the channel underlying the Drosophila IClswell.

Results

Drosophila S2R+ Cells have Robust IClswell

Drosophila S2 cells are used extensively in genome-wide RNAi screens to dissect signaling pathways, determine protein functions, and assign protein molecular identity [20]. These macrophage-like cells, derived from primary culture of late stage Drosophila melanogaster embryos [21] readily take up RNAi from serum-free media. The subsequent process of targeted mRNA ablation is efficient and highly reproducible [22], [23]. For our screen we used S2R+ cells [24], an adherent S2 variant well suited for assays that require multiple solution changes. Importantly, S2R+ cells have a consistent, large IClswell that activates slowly upon a drop in extracellular osmolality (Figure 1A). IClswell starts to activate within 2 min exposure to hypo-osmotic media, reaching steady state activation by 5 min. The fully activated Clswell conductance is anion selective (Figure 1B). The relative permeability sequence of S2R+ Clswell is I = SCN>Cl>MES>aspartate (ASP) while the slope conductance sequence is I = SCN = Cl>MES>ASP (Table 1 & 2). The Clswell I–V relationship has a slight “S” shape, revealing rectification. An extended step protocol further illustrates features of S2R+ Clswell (Figure 1C). IClswell exhibits an initial instantaneous activation followed by a second slow activation phase, suggesting that more than one type of Cl− conductance is turned on in S2R+ cells with cell swelling. In contrast, Chien & Hartzell [15] reported a single phase, time-independent IClswell activation in their S2 cells, perhaps indicating Cl− channel expression differences in the two cell lines. Tail currents, normally indicating time dependence of deactivation of the channel, are evident in our recordings. However, since tail currents were not observed under symmetrical recording conditions [15], we attribute these currents to the exit of intracellular Cl− accumulated during the prolonged steps. S2R+ IClswell has an interesting pharmacological profile (Figure 2A). Even at a high concentration (100 µM), the non-specific chloride channel blocker 4,4′-diisothiocyano-2,2′-stilbenedisulfonic acid (DIDS) [25] blocks less than 25% of the S2R+ IClswell (Figure 2A). 4-2(2-butyl-6,7-dichloro-2-cyclopentyl-indan-1-on-5-yl (DCPIB), a mammalian selective IClswell blocker [26], fails to completely block S2R+ IClswell at 30 µM (Figure 2A & E). DCPIB blocks in a voltage-dependent manner (Figure 2E); at 0 mV 52% of S2R+ IClswell is blocked, while 90% is blocked at 80 mV. Surprisingly, furosemide, a Na-K-2Cl cotransporter (NKCC; SLC12A2) blocker, almost completely inhibits S2R+ IClswell at 1 mM (Figure 2A & 3C).
Figure 1

Characterization of the S2R+ cell IClswell.

(A) Hypo-osmotic solutions slowly activate IClswell. IClswell begins to activate 1.7±0.3 min after exposure to 200 mOSM solution and reaches steady state activation within 5±0.3 min (n = 13). IClswell was assessed in ramp protocols and reported at +84.5 mV (upper trace) and -115.5 mV (lower trace). 240 mOSM stimulates IClswell activation slightly more slowly (1.8±0.3 min to initiation and 5.2±0.6 min to steady state, n = 12; data not shown). (B) The S2R+ cell IClswell is anion-selective. IClswell was activated by 200 mOSM solution; relative permeability and slope conductance sequences were determined for the steady state IClswell by replacing Cl− with equimolar anion concentrations. (C) An extended step protocol (red inset) reveals more than one set of activation kinetics with offset activation initiation times.

Table 1

Relative Permeabilities.

PX/PCl n
ISCNClMESASP
S2R+1.5±0.121.6±0.1510.74±0.150.07±0.0153
dBest11.8±0.052±0.0410.63±0.040.09±0.00175
mBest21.7±0.152.9±0.6810.45±0.140.05±0.0066
d64m2.2±0.342.6±0.1110.43±0.140.07±0.0114
HEK1.5±0.061.8±0.210.62±0.0050.11±0.0036
Table 2

Slope Conductance.

Slope Conductance (G; I/V)n
ISCNClMESASP
S2R+29.6±6.826.9±5.928±7.516.4±3.57.6±1.53
dBest18.2±1.56.6±1.15.2±0.73.3±0.41.9±0.35
mBest210±4.92.4±0.956.6±3.42±1.31.7±1.16
d64m10±3.52.5±0.364.4±0.31.9±0.51.7±0.33
HEK26.2±8.224.9±7.126.9±7.99.5±5.45.4±2.76
Figure 2

Pharmacological profiles of S2R+ IClswell and IdBest1 match and differ from those of HEK IClswell and Id64m.

(A–D) % Block of S2R+ IClswell, IdBest1, HEK IClswell and Id64m by 1 mM furosemide, 100 µM DIDS, and 30 µM DCPIB. Block at 0 mV is presented to emphasize the incomplete voltage-dependent DCPIB block of S2R+ IClswell and IdBest1. (A) Steady state S2R+ IClswell activated by 200 mOSM stimulation was blocked 96% ±1.6 by furosemide, 19% ±4 by DIDS, and 52% ±10.6 by DCPIB. * no difference compared to IdBest1 block and significantly different compared to HEK IClswell and Id64m (ANOVA, p<0.05). (B) IdBest1, stimulated for 2 min by 200 mOSM, was blocked 96% ±1.7 by furosemide, 44% ±10 by DIDS, and 47% ±10.9 by DCPIB. * no difference compared to S2R+ IClswell block and significantly different compared to HEK IClswell and Id64m (ANOVA, p<0.05). (C) Steady-state HEK IClswell activated by 200 mOSM stimulation was blocked 7% ±3.5 by furosemide, 77% ±3 by DIDS, and 99% ±0.7 by DCPIB. (D) Constitutive Id64m (320 mOSM) was blocked 77% ±3 by furosemide, 98% ±1.5 by DIDS, and 98% ±1.2 by DCPIB. significantly different compared to S2R+ IClswell, HEK IClswell and Id64m (ANOVA, p<0.05). (E–F) I–V relations for S2R+ IClswell and IdBest1 demonstrate DCPIB voltage-dependent block. At 80 mV, DCPIB block of S2R+ IClswell is 90% ±3.6 (n = 6), and 82% ±6.5 for IdBest1 (n = 7).

Figure 3

H148Q-YFP stably expressed in S2R+ cells reports the entry of I− through activated Clswell channels.

(A) Cellular swelling in 240 mOSM Cl− did not alter fluorescence intensity as Clswell channels activate (Student’s t-test, p = 0.65; n = 76). Replacement of Cl− with I− evoked a 51% ±1.3 decrease in fluorescence (Student’s t-test, p<0.001; n = 76). Imaging assay; fluorescence is in arbitrary units (a.u.). (B) Clswell channels must be open for I–induced fluorescence suppression to occur. 320 mOSM NaI suppresses fluorescence by 16% ±0.7 (Student’s t-test, p = 0.1; n = 54). (C) Furosemide, an NKCC2 blocker, completely inhibits the S2R+ cell Clswell channels at 1 mM (n = 3). (D) 1 mM Furosemide block of Clswell prevents significant I–induced suppression of H148Q-YFP fluorescence (Student’s t-test, p = 0.54; n = 16).

Characterization of the S2R+ cell IClswell.

(A) Hypo-osmotic solutions slowly activate IClswell. IClswell begins to activate 1.7±0.3 min after exposure to 200 mOSM solution and reaches steady state activation within 5±0.3 min (n = 13). IClswell was assessed in ramp protocols and reported at +84.5 mV (upper trace) and -115.5 mV (lower trace). 240 mOSM stimulates IClswell activation slightly more slowly (1.8±0.3 min to initiation and 5.2±0.6 min to steady state, n = 12; data not shown). (B) The S2R+ cell IClswell is anion-selective. IClswell was activated by 200 mOSM solution; relative permeability and slope conductance sequences were determined for the steady state IClswell by replacing Cl− with equimolar anion concentrations. (C) An extended step protocol (red inset) reveals more than one set of activation kinetics with offset activation initiation times.

Pharmacological profiles of S2R+ IClswell and IdBest1 match and differ from those of HEK IClswell and Id64m.

(A–D) % Block of S2R+ IClswell, IdBest1, HEK IClswell and Id64m by 1 mM furosemide, 100 µM DIDS, and 30 µM DCPIB. Block at 0 mV is presented to emphasize the incomplete voltage-dependent DCPIB block of S2R+ IClswell and IdBest1. (A) Steady state S2R+ IClswell activated by 200 mOSM stimulation was blocked 96% ±1.6 by furosemide, 19% ±4 by DIDS, and 52% ±10.6 by DCPIB. * no difference compared to IdBest1 block and significantly different compared to HEK IClswell and Id64m (ANOVA, p<0.05). (B) IdBest1, stimulated for 2 min by 200 mOSM, was blocked 96% ±1.7 by furosemide, 44% ±10 by DIDS, and 47% ±10.9 by DCPIB. * no difference compared to S2R+ IClswell block and significantly different compared to HEK IClswell and Id64m (ANOVA, p<0.05). (C) Steady-state HEK IClswell activated by 200 mOSM stimulation was blocked 7% ±3.5 by furosemide, 77% ±3 by DIDS, and 99% ±0.7 by DCPIB. (D) Constitutive Id64m (320 mOSM) was blocked 77% ±3 by furosemide, 98% ±1.5 by DIDS, and 98% ±1.2 by DCPIB. significantly different compared to S2R+ IClswell, HEK IClswell and Id64m (ANOVA, p<0.05). (E–F) I–V relations for S2R+ IClswell and IdBest1 demonstrate DCPIB voltage-dependent block. At 80 mV, DCPIB block of S2R+ IClswell is 90% ±3.6 (n = 6), and 82% ±6.5 for IdBest1 (n = 7).

H148Q-YFP stably expressed in S2R+ cells reports the entry of I− through activated Clswell channels.

(A) Cellular swelling in 240 mOSM Cl− did not alter fluorescence intensity as Clswell channels activate (Student’s t-test, p = 0.65; n = 76). Replacement of Cl− with I− evoked a 51% ±1.3 decrease in fluorescence (Student’s t-test, p<0.001; n = 76). Imaging assay; fluorescence is in arbitrary units (a.u.). (B) Clswell channels must be open for I–induced fluorescence suppression to occur. 320 mOSM NaI suppresses fluorescence by 16% ±0.7 (Student’s t-test, p = 0.1; n = 54). (C) Furosemide, an NKCC2 blocker, completely inhibits the S2R+ cell Clswell channels at 1 mM (n = 3). (D) 1 mM Furosemide block of Clswell prevents significant I–induced suppression of H148Q-YFP fluorescence (Student’s t-test, p = 0.54; n = 16).

H148Q-YFP Reliably Reports the Activity of S2R+ Cell Clswell Channels

Clswell conducts iodide better than chloride, favoring the use of the H148Q-YFP indicator as a reporter of its activity (I− KD = 20 mM and Cl− KD = 100 mM [19], [27], [28]). Several anion-sensitive YFP variants accurately quantify intracellular Cl− concentration or changes [27], [29]–[31]; anion binding near the YFP chromophore suppresses fluorescence emission by altering chromophore resonance [19]. H148Q-YFP was chosen for Clswell detection because it is bright and potently suppressed by I−; these properties are critical for good signal-to-noise ratios during screening. H148Q-YFP (pKa = 6.7) is also sensitive to intracellular pH changes [19], [28]. S2R+ cells stably expressing H148Q-YFP maintain their fluorescence in 240 mOSM NaCl however (Figure 3A), indicating that cell swelling does not appreciably alter intracellular pH. Subsequent replacement of bath Cl− with I− rapidly suppresses indicator fluorescence by 50% as I− enters the cells through open channels and interacts with the probe. The large fluorescence change and low intrinsic assay variability favor clear separation of potential hits. In the absence of hypo-osmotic solution, I− is unable to enter the S2R+ cells and fluorescence is maintained (Figure 3B), indicating that S2R+ cells lack alternative constitutively active I− entry pathways that could confound our ability to identify the Clswell channel. Further, furosemide block of open Clswell channels prevents appreciable fluorescence suppression (Figure 3C & D), suggesting that RNAi effectively targeting the Clswell channel will be readily identifiable as hits.

Genome-wide RNAi Screening of H148Q-YFP S2R+ Cells Identifies dBest1 as the Clswell Channel

The primary screen was conducted at the Harvard/HHMI Drosophila RNAi Screening Center using our stable H148Q-YFP-expressing S2R+ cell line. Each well of sixty-six 384-well assay plates contained a dsRNA targeting 1 of 13,900 genes encoding proteins or non-coding RNAs (DRSC 2.0; Figure 4A). Five days after S2R+ cells were treated with RNAi, we assessed cellular fluorescence under swell conditions in the presence of Cl− and I−. Wells with fluorescence or ratio (I− fluorescence/Cl− fluorescence) changes greater than 1.5 times the standard deviation of the plate mean were initially considered as hits (Clswell channel candidates or regulators of its activation pathway). We pared the list of 595 hits to genes with mammalian homologs and those with predicted transmembrane domains (Figure 4B, ). In a secondary screen, we confirmed that each RNAi significantly reduced swelling-induced fluorescence and targeted only the mRNA from the identified gene (qPCR). We then directly measured IClswell via whole-cell voltage clamp. Candidates genes, whose RNAi significantly reduced the S2R+ cell IClswell, were cloned and expressed in HEK293 or CHO-K1 cells. IClswell was then measured via whole-cell recording and compared with currents from untransfected cells. The only candidate of our screen to satisfy all the criteria for a Clswell channel was dBest1 ().
Figure 4

Genome-wide RNAi screening of H148Q-YFP S2R+ cells identifies Clswell channel candidates and regulators.

(A) RNAi treatment alters S2R+ cell H148Q-YFP fluorescence levels. Heat map plate reader data following 5d RNAi treatment (240 mOSM Cl−). Fluorescence was subsequently measured in 240 I−. Wells where the I− to Cl−fluorescence ratio was high are hits. Control RNAis are found in columns 13 and 14. Thread RNAi is in 13B, 13G, 14K, and 14N. Rho RNAi is in 13D, 13E, 14J, and 14O. GFP RNAi is in 13C, 13F, 14L, and 14M. Wells with elevated fluorescence in 240 mOSM Cl− are shown in red and orange. (B) Functional classification of the 595 hits identified in our screen. 21 hits were transmembrane proteins of unknown function, putative ion channels, or transporters. 9 candidates with human homology were further evaluated (Table S1). (C) Protein sequence alignment of dBest1 and mBest2 (Multalign; multalin.toulouse.inra.fr/multalin/). Green bars indicate transmembrane domains. Yellow bars indicate other putative α-helices (SOSUI; bp.nuap.nagoya-u.ac.jp/sosui/). A red star indicates the W94C mutation. A blue star indicates the Ca2+-binding bowl. A pink arrow indicates Stop 383. A pink box outlines the region switched in the d64m chimera.

Genome-wide RNAi screening of H148Q-YFP S2R+ cells identifies Clswell channel candidates and regulators.

(A) RNAi treatment alters S2R+ cell H148Q-YFP fluorescence levels. Heat map plate reader data following 5d RNAi treatment (240 mOSM Cl−). Fluorescence was subsequently measured in 240 I−. Wells where the I− to Cl−fluorescence ratio was high are hits. Control RNAis are found in columns 13 and 14. Thread RNAi is in 13B, 13G, 14K, and 14N. Rho RNAi is in 13D, 13E, 14J, and 14O. GFP RNAi is in 13C, 13F, 14L, and 14M. Wells with elevated fluorescence in 240 mOSM Cl− are shown in red and orange. (B) Functional classification of the 595 hits identified in our screen. 21 hits were transmembrane proteins of unknown function, putative ion channels, or transporters. 9 candidates with human homology were further evaluated (Table S1). (C) Protein sequence alignment of dBest1 and mBest2 (Multalign; multalin.toulouse.inra.fr/multalin/). Green bars indicate transmembrane domains. Yellow bars indicate other putative α-helices (SOSUI; bp.nuap.nagoya-u.ac.jp/sosui/). A red star indicates the W94C mutation. A blue star indicates the Ca2+-binding bowl. A pink arrow indicates Stop 383. A pink box outlines the region switched in the d64m chimera.

DRSC26457 RNAi Targeting dBest1 Eliminates IClswell

dBest1 is a protein of 769 amino acids containing 4 transmembrane domains [32], [33] (Figure 4C). It is one of four Bestrophin family members in Drosophila, with highest homology to mBest2/hBest2 (51% identity and 67% similarity; BLAST). Hartzell and colleagues first proposed that dBest1 was a chloride channel activated by high intracellular Ca2+ and cell swelling [15], [16]. In our H148Q-YFP fluorescence assay dBest1 RNAi DRSC26457 abrogated the fluorescence change normally observed when I− enters the S2R+ cells through activated Clswell conductances (Figure 5A, B). Interestingly, DRSC26457 also decreased the baseline fluorescence variability of S2R+ cells (Figure 5B), suggesting that IdBest1 contributes to resting intracellular Cl− concentrations. S2R+ IClswell was essentially eliminated by dBest1 RNAi DRSC26457 treatment (Figure 5C). This RNAi specifically and effectively reduced dBest1 mRNA by 91.5% ±0.5 (n = 3; qPCR); mRNA levels for the 3 remaining Bestrophin members and other Clswell candidates were unaffected. A second RNAi targeting dBest1 (DRSC16909; corresponds with dB1S [15]) was part of our initial screen. It was less effective at knocking down dBest1 mRNA (85% reduction, n = 3; significantly less than DRSC26457; p<0.001, Student’s t-test) and had two predicted off-target hits: CG4623 (20/20) and CG16711 (18/18). DRSC16909 did not significantly alter H148Q-YFP I–induced fluorescence suppression (Figure 5A), and was not a hit in our initial screen. It is possible that the 15% remaining mRNA translated sufficient amounts of functional dBest1/Clswell channels to exclude it as a hit in our screen. This prospect emphasizes the importance of validated, effective RNAi for accurate screening.
Figure 5

DRSC26457 identifies dBest1 as Clswell.

(A & B) RNAi efficiently targeting dBest1 prevents significant I–induced H148Q-YFP suppression following hypo-osmotic stimulation. Fluorescence is in arbitrary units (a.u.). (A) Plate reader assay. DRSC26457 RNAi treatment resulted in a fluorescence decrease of 6.4% ±19. Control and DRSC16909 RNAi treatment resulted in fluorescence decreases of 40.5% ±9.1 and 43.7% ±6.2 respectively. * 240 mOSM NaCl and NaI fluorescence levels are significantly different (Student’s t-test, p<0.05). (B) Imaging assay. The fluorescence levels of individual S2R+ cells treated with control or dBest1 DRSC26457 RNAi were measured during hypo-osmotic stimulation in the sequential presence of Cl− and I−. The fluorescence of control cells decreased by 56% (n = 44); in contrast, the fluorescence of dBest1 DRSC26457 RNAi treated cells was suppressed by 15% (n = 174). (C) dBest1 DRSC26457 RNAi eliminated IClswell in S2R+ cells. Following dBest1 RNAi treatment I320 is not significantly different from I240 (Student’s t-test, p = 0.1). * control and RNAi treated I240 are significantly different (Student’s t-test, p = 0.02). (D) dBest1 W94C-gfp overexpression suppresses S2R+ IClswell. * control and W94C-gfp I200 mOSM are significantly different (Student’s t-test, p = 0.02). (E) Confocal images of dBest1 W94C-gfp overexpression in S2R+ cells. Images were obtained before (320 mOSM) and after swell (200 mOSM). Scale bar indicates 10 µm.

DRSC26457 identifies dBest1 as Clswell.

(A & B) RNAi efficiently targeting dBest1 prevents significant I–induced H148Q-YFP suppression following hypo-osmotic stimulation. Fluorescence is in arbitrary units (a.u.). (A) Plate reader assay. DRSC26457 RNAi treatment resulted in a fluorescence decrease of 6.4% ±19. Control and DRSC16909 RNAi treatment resulted in fluorescence decreases of 40.5% ±9.1 and 43.7% ±6.2 respectively. * 240 mOSM NaCl and NaI fluorescence levels are significantly different (Student’s t-test, p<0.05). (B) Imaging assay. The fluorescence levels of individual S2R+ cells treated with control or dBest1 DRSC26457 RNAi were measured during hypo-osmotic stimulation in the sequential presence of Cl− and I−. The fluorescence of control cells decreased by 56% (n = 44); in contrast, the fluorescence of dBest1 DRSC26457 RNAi treated cells was suppressed by 15% (n = 174). (C) dBest1 DRSC26457 RNAi eliminated IClswell in S2R+ cells. Following dBest1 RNAi treatment I320 is not significantly different from I240 (Student’s t-test, p = 0.1). * control and RNAi treated I240 are significantly different (Student’s t-test, p = 0.02). (D) dBest1 W94C-gfp overexpression suppresses S2R+ IClswell. * control and W94C-gfp I200 mOSM are significantly different (Student’s t-test, p = 0.02). (E) Confocal images of dBest1 W94C-gfp overexpression in S2R+ cells. Images were obtained before (320 mOSM) and after swell (200 mOSM). Scale bar indicates 10 µm.

Mutant dBest1 W94C Significantly Reduces S2R+ IClswell

To substantiate the conclusion that dBest1 is an essential component of the Clswell channel, we tested whether a mutant dBest1 would act as a dominant negative regulator of IClswell. In humans, Bestrophin 1 is mutant in vitelliform macular dystrophy (Best’s disease [34], [35]). One mutation, W93C, occurs in a conserved sequence of the channel’s putative pore [36], [37] (Figure 4C). When we expressed the homolog dBest1 W94C-gfp in S2R+ cells, IClswell was significantly reduced (Figure 5D). Interestingly, the late activating component of IClswell remained clearly evident at depolarized potentials (Figure S1). We could not study this current in more detail as a loss of cell membrane integrity rapidly ensued. We conclude that dBest1 is responsible for the early activating S2R+ cell IClswell. W94C might interact with WT dBest1 to disrupt the Clswell channel pore or it may prevent proper protein trafficking [38]. In S2R+ cells, dBest1 W94C-gfp has a distinct intracellular expression pattern unaltered by osmotic changes (Figure 5E), suggesting the latter explanation over the former. Regardless, dBest1 W94C has a dominant negative impact on IClswell, further evidence that dBest1 is integral to the Clswell channel. Another disease-associated Bestrophin mutation, D308A, occurs in a putative Ca2+ -binding bowl located in the channel’s C-terminus (Figure 4C; blue star). D308A is proposed to eliminate Bestrophin activation by disruption of calcium binding [39]. We introduced this mutation into dBest1 to determine if activation by calcium and cell swelling could be separated. Unfortunately dBest1 D308A-gfp was not functional in HEK cells (data not shown). Three possible explanations may underlie this result: 1) activation by multi-modal stimuli is simultaneously disrupted by the mutation; 2) the mutation causes protein misfolding and the channel function has been eliminated for reasons unrelated to activation; 3) the mutant channel is mislocalized. Our GFP-tagged protein was expressed (data not shown), but we cannot exclude the possibility that it mislocalizes or fails to interact appropriately with other proteins necessary for IClswell activation or channel function [34].

Exogenous dBest1 Expression Creates a Drosophila-like IClswell

Exogenous expression of a candidate protein substantiates whether the protein is necessary and/or sufficient in a given process. Our secondary screen assessed whether candidate protein expression resulted in a novel IClswell or augmented the endogenous HEK IClswell (). The HEK cell line chosen for candidate over-expression lacked constitutive ICl and ISCN (potentially contaminating conductances attributable to SLC1A family member expression [40]; data not shown). The endogenous HEK IClswell develops very slowly (Figure 6A & B); a two fold increase was noted within the first 2 min of swell. Once the HEK IClswell reaches steady state, however, it has increased more than forty fold (44.4±10.7 fold, n = 29; Student’s t-test, p<0.000005). Tail currents are absent (Figure 6B & C). Characteristic voltage-dependent inactivation develops during steps to positive potentials (Figure 6C). HEK IClswell is anion selective; its permeability and conductance sequences match closely to those of S2R+ IClswell (Figure 6D; Table 1 & 2). The HEK IClswell pharmacological profile (Figure 2C) correlates well with the literature. 100 µM DIDS, slightly above the reported IC50 [41], blocks 78% of the HEK IClswell at +80 mV (Figure 2C). DCPIB has an IC50 of 4 µM [26]; at 30 µM 100% of HEK IClswell is blocked (Figure 2C). 1 mM furosemide barely inhibits HEK IClswell (Figure 2C). The endogenous HEK IClswell recapitulates the key features noted for the mammalian IClswell [1].
Figure 6

The endogenous HEK cell IClswell has characteristic mammalian IClswell properties.

(A) HEK cell IClswell develops slowly, reaching steady state after 5 min exposure to 200 mOSM solution. ⧫ indicate min in 200 mOSM. (B) Ramp protocol (inset) assessment of the HEK IClswell. Little IClswell has developed after 2 min in 200 mOSM solution. The steady state IClswell is outwardly rectifying and inactivating at positive potentials. No tail currents are apparent. (C) Step protocol (inset) assessment of the HEK IClswell. Rapid inactivation is observed at positive potentials. No tail currents are apparent. (D) Relative permeability and slope conductance sequences for the endogenous HEK IClswell are SCN = I>Cl>>MES>ASP vs SCN = I = Cl>>MES>ASP.

The endogenous HEK cell IClswell has characteristic mammalian IClswell properties.

(A) HEK cell IClswell develops slowly, reaching steady state after 5 min exposure to 200 mOSM solution. ⧫ indicate min in 200 mOSM. (B) Ramp protocol (inset) assessment of the HEK IClswell. Little IClswell has developed after 2 min in 200 mOSM solution. The steady state IClswell is outwardly rectifying and inactivating at positive potentials. No tail currents are apparent. (C) Step protocol (inset) assessment of the HEK IClswell. Rapid inactivation is observed at positive potentials. No tail currents are apparent. (D) Relative permeability and slope conductance sequences for the endogenous HEK IClswell are SCN = I>Cl>>MES>ASP vs SCN = I = Cl>>MES>ASP. Bestrophin proteins are not universally accepted as bona fide chloride channels; alternatively they are intracellular ion channel regulators [33], [42], [43]. dBest1-gfp is clearly observed on or near the surface of HEK-293 cells (Figure 7A). Its expression results in a Drosophila-like IClswell (Figure 7B–E). Constitutively active IdBest1 is apparent in iso-osmotic 320 mOSM solution and is significantly increased 16±4.5 fold (Student’s t-test, p<0.005) during the first 2 min of hypo-osmotic stimulation (Figure 7B). IdBest1 has the same “S”-shaped rectification as Drosophila IClswell during ramps (Figure 7C); tail currents and time-dependent activation are both apparent in the step protocol (Figure 7d). IdBest1 is anion selective; it has the same permeability and conductance sequences as S2R+ IClswell and HEK IClswell (Figure 7E; Table 1 & 2). Strikingly, IdBest1 and the endogenous S2R+ IClswell share a similar pharmacological profile that differs significantly from HEK IClswell (Figure 2A–C). 100 µM DIDS inhibits 35% of IdBest, while 30 µM DCPIB blocks 45%. 1 mM furosemide blocks nearly 100% of the IdBest1. We conclude that dBest1 expression results in a Drosophila-like IClswell; it cannot be attributed to endogenous HEK IClswell upregulation.
Figure 7

dBest1 overexpression in HEK cells produces a S2R+ cell-like IClswell.

(A) dBest1-gfp targets to the membrane of HEK cells. Confocal images of dBest1-gfp overexpressed in HEK-293 cells. The DIC image is on the left, GFP in the middle, overlapped images on the right. Scale bar indicates 10 µm. (B) IdBest1 rapidly develops within the first 2 min of hypo-osmotic stimulation. (C) The developing IdBest1 has the same “S” shape rectification as the endogenous S2R+ cell IClswell. (D) Step protocol shows that IdBest1 shares time-dependent activation and tail current properties with S2R+ cell IClswell. (E) The constitutively active IdBest1 and S2R+ cell IClswell selectivity sequences are very similar. (F) IdBest1 is clearly separable from the endogenous HEK cell IClswell. IdBest1 increases 15.8 fold ±4.5 (n = 18; ** paired Student’s t-test, p<0.005) in the first 2 min of hypo-osmotic stimulation; the endogenous HEK cell IClswell increases 2.1 fold ±0.4 (n = 29; * paired Student’s t-test, p<0.05).

dBest1 overexpression in HEK cells produces a S2R+ cell-like IClswell.

(A) dBest1-gfp targets to the membrane of HEK cells. Confocal images of dBest1-gfp overexpressed in HEK-293 cells. The DIC image is on the left, GFP in the middle, overlapped images on the right. Scale bar indicates 10 µm. (B) IdBest1 rapidly develops within the first 2 min of hypo-osmotic stimulation. (C) The developing IdBest1 has the same “S” shape rectification as the endogenous S2R+ cell IClswell. (D) Step protocol shows that IdBest1 shares time-dependent activation and tail current properties with S2R+ cell IClswell. (E) The constitutively active IdBest1 and S2R+ cell IClswell selectivity sequences are very similar. (F) IdBest1 is clearly separable from the endogenous HEK cell IClswell. IdBest1 increases 15.8 fold ±4.5 (n = 18; ** paired Student’s t-test, p<0.005) in the first 2 min of hypo-osmotic stimulation; the endogenous HEK cell IClswell increases 2.1 fold ±0.4 (n = 29; * paired Student’s t-test, p<0.05).

dBest1 Swell Activation can be Conferred on the Swell-insensitive mBest2

The structural domains necessary for swell-induced channel activation are unknown. Although dBest1 has a long poorly conserved C-terminus (Figure 4C), it is not necessary for swell activation. dBest1 remains swell-sensitive despite the removal of up to 338 of its C-terminal amino acid residues (Stop 383, Figure 4C; Figure 8A). Next we examined whether chimeras might reveal the domains underlying swell activation. dBest1’s closest mammalian homolog, mBest2, is not activated by hypo-osmotic solutions (Figure 8B). Chimera d64m (the first 64 residues are dBest1; the remaining residues are identical to those of mBest2; Figure 4C) expression resulted in a constitutively active current that more than doubled with swelling (2.3 fold ±0.3 increase; Student’s t-test, p<0.05; Figure 8B–D). The d64m chimera maintained the relative permeability and slope conductance of mBest2 (Figure 8E & F; Table 1 & 2), suggesting that the channel’s pore domain is downstream of residue 64. Two other groups have assessed mBest2 selectivity [44], [45] and found greater permeability for SCN than we report here. Both groups used high intracellular calcium to activate ImBest2; we report constitutive ImBest2 measured with high internal calcium buffering (i.e. <10 nM free calcium). Our HEK cell line was also screened for potentially contaminating ISCN (data not shown) attributable to SLC1A family member expression [40]. The pharmacological profile of Id64m noticeably diverged from both that of HEK IClswell and IdBest1 (Figure 2). Furosemide blocked 75% of Id64m, while DIDS and DCPIB both blocked Id64m to near completion (Figure 2D). We conclude that the dBest1 N-terminal domain is required for swell activation of the mBest2 channel. The reverse chimera (m64d) was nonfunctional; exogenous currents were not observed with swelling or in the presence of high intracellular Ca2+ (data not shown). We cannot conclude with this data however, that the N-terminus is a “swelling” domain as it lacks any predictive motifs. We hypothesize that it works in concert with domains present both in dBest1 and mBest2 to facilitate swell activation. The strong correlation between S2R+ IClswell and IdBest1, combined with the unique selectivity and pharmacology of the d64m chimera, support the conclusion that the Bestrophin protein itself forms the Clswell channel rather than functioning as an auxiliary subunit.
Figure 8

Chimeras between dBest1 and mBest2 confer swell activation on mBest2.

(A) Truncation of dBest1 does not interfere with swell sensitivity. Constitutive currents are apparent with both dBest1 and Stop 383 overexpression in iso-osmotic solutions (320 mOSM). With swell, current increased dramatically for both constructs (Student’s t-test, * p<0.05, ** p<0.005). (B) d94m current increases significantly within the first 2 min of swelling (* Student’s t-test, p<0.05). (C) Time course for d64m swell activation. (D) Current-voltage relations for constitutive d64m, and following 2 min 200 mOSM solution. (E) Selectivity sequence for the constitutively active d64m current. (F) Selectivity sequence for the constitutively active mBest2 currents.

Chimeras between dBest1 and mBest2 confer swell activation on mBest2.

(A) Truncation of dBest1 does not interfere with swell sensitivity. Constitutive currents are apparent with both dBest1 and Stop 383 overexpression in iso-osmotic solutions (320 mOSM). With swell, current increased dramatically for both constructs (Student’s t-test, * p<0.05, ** p<0.005). (B) d94m current increases significantly within the first 2 min of swelling (* Student’s t-test, p<0.05). (C) Time course for d64m swell activation. (D) Current-voltage relations for constitutive d64m, and following 2 min 200 mOSM solution. (E) Selectivity sequence for the constitutively active d64m current. (F) Selectivity sequence for the constitutively active mBest2 currents.

Discussion

Our study validates the H148Q-YFP fluorophore as a reliable reporter of Clswell channel activity in genome-wide RNAi screening studies. H148Q-YFP has been employed very effectively in the identification of novel chloride channel activators, modulators, and blockers of CFTR and Ca2+-activated Cl− channels [18]. This is the first reported RNAi screen using an anion-sensitive fluorescent protein to assign molecular identity to a chloride channel. Our screen supports the findings of the Hartzell lab [15]: dBest1 RNAi eliminates Drosophila IClswell. We found that the RNAi effectiveness was essential for Clswell candidate identification. Two separate dBest1-targeting RNAi’s were part of our initial screen: DRSC26457 and DRSC16909 (which corresponds to dB1S [15]), but only DRSC26457 was a hit. qPCR reported a 95% reduction in dBest1 mRNA with DRSC26457 treatment versus an 85% reduction with DRSC16909. Hartzell and colleagues found that S2 cell IClswell was significantly reduced following treatment with 0.4 µg of DRSC16909 [15], while in our screen each assay well had a standardized 0.25 µg of RNAi. Using more RNAi may have effected greater target knockdown and resulted in the detection of DRSC16909 as a hit in our screen. This result emphasizes the importance of RNAi effectiveness in hit identification. Exogenously expressed IdBest1 and endogenous S2R+ IClswell share similar characteristics, including time-dependent activation, tail currents, relative permeability sequences, slope conductance sequences, and pharmacological profiles. The shared properties of Drosophila IClswell and IdBest1 suggest that the same protein forms the channel responsible for both. Bestrophin is a known ion channel modulator, altering voltage-gated calcium channel activity [46]. If dBest1 expression simply modulated or upregulated the endogenous HEK Clswell channel expression, we would have expected the resulting IClswell to maintain the properties of HEK IClswell. Instead we observed that dBest1 introduced an exogenous Drosophila-like IClswell whose development preceeded that of the endogenous HEK IClswell. IdBest1 matched the pharmacological profile of the S2R+ IClswell. Moreover, we found that the exogenous Drosophila-like IClswell permeability and conductance sequence could be transformed into that of mBest2 with the d64m chimera. The pharmacological profile of Id64m was again significantly different from the endogenous HEK IClswell. We conclude that dBest1 is the Drosophila Clswell channel. Several Bestrophin mutations are associated with vitelliform macular dystrophy [36], [37]. How these mutations are causally linked to the disease is not clear. Here we found that overexpression of the disease-linked W94C dBest1 mutant in S2R+ cells significantly suppressed the endogenous Drosophila IClswell. The W94C mutation occurs in the putative pore of dBest1 and thus may disrupt Clswell conductance. However, the fluorescently tagged W94C dBest1 protein appears to localize to intracellular compartments, consistent with mislocalization. Milenkovic et al, have recently proposed that disease-associated Bestrophin mutations cause defects in intracellular trafficking [38]. Both scenarios may explain the dominant negative effect of dBest1 W94C on Drosophila IClswell: non-functional, pore-disrupting, mutant Bestrophin proteins complexing with wild-type dBest1 may be largely retained within the endoplasmic reticulum. The end result would be the elimination of endogenous Drosophila IClswell. Our experiments support the hypothesis that mutant Bestrophin W93C expression could significantly disrupt chloride flux and homeostasis in the human macula, contributing to the disease state. The distinction of Bestrophin function in Drosophila versus mammalian cells is most clearly illustrated by Hartzell and colleagues [16]. IClswell measured in peritoneal mast cells isolated from mBest1 −/−, mBest2 −/−, and mBest1/2 double knockout mice was identical to wild-type IClswell. hBest1 and mBest2 are swell sensitive in that their currents are inhibited by hyperosmotic solutions. However, their activity does not increase with swell [12]. We confirm here that mBest2 activation does not increase when cells swell. Our d64m chimera contained only a small portion of dBest1, yet it responded to cellular swelling. The crucial N-terminal region contains no distinct association domains or predictive structures that might explain its coupling to changes in cell stretch, tension, or osmolality. We speculate that the N-terminus contributes to a required tertiary structure that enables swell signaling events to activate the dBest1 channel. Our genome-wide RNAi screen of S2R+ cells and follow-up study firmly establishes that the dBest1 protein forms the Drosophila Clswell channel. It further validates a live cell genetically engineered fluorescent screening platform to identify other mammalian chloride channels.

Materials and Methods

Generation of the S2R+ YFP- H148Q Stable Cell Line

The stable S2R+ cell line expressing a halide-sensitive YFP (H148Q-YFP; kindly provided by Dr. Alan Verkman, UCSF) was generated with a selection vector (pCoBlast). H148Q-YFP was subcloned into the pAc5.1/V5-HisA vector (Invitrogen, CA). The S2R+ cells were transfected by electroporation (Amaxa cell line nucleofector kit V; Lonza). Cells were placed under selective pressure with 25 µg/ml blasticidin for 2 weeks. Two rounds of fluorescence-activated cell sorting (FACS; DFCI Flow Cytometry Core Facility) normalized YFP fluorescence intensities. These S2R+ cells exhibited a robust IClswell as described in Figure 1. S2R+ cells were maintained in Schneider’s Drosophila medium (Invitrogen), with 10% heat inactivated fetal bovine serum (Invitrogen), and 1% penicillin/streptomycin (Sigma-Aldrich). For the primary screen, cells were spun down and resuspended in serum-free medium at a density of 9×104 cells/ml. 10 µl of the cell suspension was added to each of the 384 wells using the Matrix Wellmate 8-channel microplate dispenser (ThermoScientific; DRSC). Cells were incubated for 30 min, then 30 µl of serum containing medium were added to each well. Cells were cultured for 5 d before the swell assay was performed (5 d RNAi treatment is necessary to sufficiently knock down proteins with slow turnover rates). For the secondary screen, cells were plated at a density of 40% in a 6 well dish. Once cells were adherent, the medium was replaced with 1 ml of serum-free medium containing 0.015 µg/µl dsRNA. Cells were incubated for 30 min at room temperature followed by addition of 3 ml of serum-containing medium to each well. Transfections were performed in duplicate; 1 well was used for functional studies and the other for qPCR analysis of knockdown at day 5.

Screening Solutions

Iso-osmotic (320 milliOsm/kg; mOSM) solutions contained in mM: 105 NaCl or NaI, 2 CaCl2, 1 MgCl2, 5 KCl, 10 HEPES, 10 Glucose, 90 Mannitol (pH 7.4 NaOH). For hypo-osmotic (240 mOSM) solutions, mannitol was omitted. 1 mM furosemide (Sigma-Aldrich) blocked 100% of the S2R+ IClswell and prevented significant H148Q-YFP suppression. Furosemide is a specific blocker of Na-K-2Cl co-transporters (SLC12A2) at concentrations in the µM range.

The Primary Screen

Our genome-wide screen was conducted at the Harvard/HHMI Drosophila RNAi Screening Center using the DRSC 2.0 Genomewide RNAi Library. DRSC 2.0 is a collection of dsRNAs for genome-wide RNAi knockdown covering ∼ 13,900 genes encoding proteins and non-coding RNAs while minimizing off-target effects due to sequence similarity to other genes. Each gene is targeted by 1.3 dsRNA/gene. The screen consisted of 66 384-well assay plates in duplicate. Each well of the 384-well plate contained 5 µl of 0.05 µg/µl dsRNA in water (0.25 µg dsRNA/well). Each plate contained control RNAi specific for Thread (Drosophila inhibitor of apoptosis protein), Rho (a small GTPase activator of the EGFR signaling pathway), and GFP. On day 5 of RNAi treatment, the cellular fluorescence of the H148Q-YFP probe was measured under several treatment conditions using the Analyst GT plate reader (Molecular Devices; DRSC). The probe was excited at 485 nm and emissions collected at 530 nm. Before fluorescence measurements were taken, the media was aspirated (384-well aspirator; VP Scientific) and the cells were equilibrated in 80 µl of 320 mOSM NaCl solution. After 10 min this solution was removed by aspiration and cells incubated in 240 mOSM NaCl for 5 min. Fluorescence was then measured, the NaCl solution removed and cells were incubated in 240 mOSM NaI for 5 min. Fluorescence was again measured; the change in fluorescence was determined by dividing the fluorescence in 240 mOSM NaI by that in 240 mOSM NaCl. Wells with fluorescence or ratio changes (240 mOSM I− fluorescence/240 mOSM Cl− fluorescence) greater than 1.5 times the standard deviation (1.5×S.D.) of the plate mean were initially considered as hits (candidates of Clswell channel or regulators of its activation pathway). False positives could potentially result if the RNAi treatment caused a high internal pH as H148Q-YFP has a pKa of 6.7. Cell death was detected in control wells indicating effective RNAi treatment.

Generation of dsRNA

cDNA templates were generated by PCR amplification of genomic DNA using primers designed by the DRSC (SnapDragon tool). These primers had the T7 promoter sequence (TAATACGACTCACTATAGGG) added to the 5' end of both primers. The templates generally corresponded to exons but occasionally sequences with two or more exons interrupted by introns were used. The PCR fragments were ∼150–600 base pairs in length, and any complete 19-mer homology to other genes that could lead to non-specific dsRNA are reported. Individual RNAi sequences used here are found in the DRSC website (www.flyrnai.org). dsRNAs against Drosophila were synthesized with the MEGAscript in vitro transcription kit (Ambion). RNA was purified with the RNeasyPlus mini kit (Qiagen) and stored at −80°C.

qPCR Analysis of RNAi Efficiency

After 5 d RNAi treatment, RNA was prepared from the S2R+ cells using the RNeasy Plus mini kit (Qiagen). 2.5 µg RNA was used for each first-strand cDNA synthesis reaction (SuperScript Vilo cDNA Synthesis kit, Invitrogen). Primers for qPCR were designed on the NCBI/PrimerBlast site (http://www.ncbi.nlm. nih.gov/tools/primer-blast/) with the following restrictions: PCR product size was between 70 and 300 bp, primer melting temperatures were between 57 and 63°C, primers spanned an exon-exon junction, and primers were specific to the intended PCR template as determined by BLAST analysis of the Drosophila melanogaster Refseq mRNA database. Primer sets were only used if the melting curve had a single peak. The RT2 Real-Time SYBR Green/Rox PCR master mix (SABiosciences) was used for qPCR. qPCR reactions were set up in quadruplicate to minimize pipetting errors, and run on the Mastercycler ep Realplex real-time PCR system (Eppendorf). Average cycle numbers for each primer set were normalized to either dTaf8 or dAct79b average cycle numbers.

Secondary Screening of Candidates

Comprehensive bioinformatics analysis of the hit list was performed to identify potential candidates for Clswell. Hits were limited to those with human homologs and at least a single transmembrane domain. Potential regulators of the Clswell activation pathway were left for future consideration. The effects of RNAi on fluorescence changes were confirmed by plate reader or imaging experiments. The specificity and effectiveness of the RNAi was assessed by qPCR. S2R+ cells treated with RNAi were patch clamped and IClswell was directly measured. Candidates were cloned and expressed in HEK293 or CHO-K1 cells. IClswell was measured by whole-cell patch clamp recording.

Electrophysiology

Whole-cell patch clamp recordings were made at room temperature. Recordings were obtained using an Axopatch 200B amplifier, Digidata 1322A analog-to-digital converter, and pClamp 8.01 software (Molecular Devices, Union City, CA). Data were low-pass filtered at 2 kHz and digitized at 5 kHz. Fire-polished thin or thick wall borosilicate glass pipettes of 3–4 MΩ resistances were used for recordings; access resistance was compensated to >80%. Cells were held at −70 mV to clearly eliminate cells with leaky seals and voltage ramps (400 ms in duration) from −100 to +100 mV were applied every 2–5 s. Liquid junction potentials were corrected during analysis, and ramp data were plotted between –100 and +80 mV.

Recording Solutions

Internal pipette solution contained (in mM): 160 CsASP, 10 Cs4BAPTA, 4 MgATP, 2 MgCl2, 8 NaCl, and 10 HEPES (pH 7.4 with CsOH). 10 mM BAPTA was used to prevent activation of channels by calcium and to reduce the endogenous HEK cell IClswell, which is optimally activated with 100 nM Cai [47]. 240 mOSM solution composition is detailed in ‘Screening solutions’. 200 mOSM solutions contained in mM: 82.5 NaCl, NaI, NaSCN, NaMES, or NaASP, 2 CaCl2, 1 MgCl2, 5 KCl, 10 HEPES, and 10 Glucose (pH 7.4 with NaOH). 90 mM mannitol was added to bring osmolality to 320 mOSM. The relative permeabilities were estimated from the Goldman-Hodgkin-Katz equation. For our calculations, the [Cl]i was set to 0 mM. Cells were held at -70 mV during all recordings, rapidly depleting Cli. Cation permeability was essentially nil, as replacement of 200 mOSM NaCl solution with 200 mOSM NMDG-Cl solution did not change the reversal potential (Erev; data not shown). Slope conductances were calculated for each anionic substitution between the Erev and +80 mV. For the S2R+ and HEK cells Erev and I+80 mV were measured in 200 mOSM solutions. For exogenously expressed dBest1, mBest2, and d64m Erev and I+80 mV were measured in 320 mOSM solutions to prevent contamination with the endogenous HEK cell IClswell. The HEK cell line chosen for over-expression studies had no constitutive ICl (I320 mOSM did not change when switching between Cl and ASP), the endogenous IClswell developed very slowly, and the cells did not have an endogenous ISCN (attributable to SLC1A family member expression [40].

Pharmacology

Stock solutions of DIDS (0.1 M in DMSO; Sigma), DCPIB (50 mM in EtOH; Tocris), and furosemide (1M in DMSO; Sigma) were prepared and diluted in 320 mOSM or 200 mOSM NaCl solution to their final concentrations.

Molecular Biology

dBest1 was a kind gift from Dr. Criss Hartzell (Emory University). All other constructs were either ordered from Open Biosystems or cloned from a Drosophila cDNA library or Human Brain (whole Marathon ready cDNA library; BD Biosciences). Candidate cDNAs were subcloned into pEGFP-N3 (C-terminal tag; BD Biosciences) and an engineered Red pTracer vector (untagged). We found that an N-terminal EGFP tag rendered dBest1 nonfunctional (data not shown). Using site-directed mutagenesis we introduced the W94C mutation into dBest1 pEGFP-N3 (GeneArt site-directed mutagenesis, Invitrogen, CA). dBest1 W94C-gfp was then subcloned into the pAc5.1 V5-HisA vector (Invitrogen, CA). The late activating component of S2R+ I (A) The late activating component of S2R+ IClswell is isolated after dominant negative elimination of IdBest1. Inset: Step protocol. (B) The late activating component of S2R+ IClswell is sharply rectifying (ramp protocol; inset). Red trace is 320 mOSM solution, blue trace is 80 s after the 200 mOSM solution change. The late activating IClswell develops after 36 s in 200 mOSM solution. (TIF) Click here for additional data file. Secondary screening identifies Best1 as the Cl Candidates with transmembrane domains and human homologs were further studied to determine if they formed the Clswell channel. ✓ indicates a positive secondary screening result; X indicates a negative result. indicates that several qPCR primer sets consistently had more than 1 melting point peak suggesting nonspecific primer binding. The effectiveness of RNAi knockdown, therefore, could not be determined by qPCR. ?? indicates that two cells overexpressing SLC1A2 had substantial ISCN- currents but small IClswell. Thus, SLC1A2 overexpression may upregulate endogenous HEK cell IClswell in the majority of the population but does not form the channel itself. HeLa cells treated with SLC1A3 siRNA (which reduced SLC1A2 and SLC1A3 mRNA by 90% and 92% respectively) had unaltered IClswell (data not shown). (TIF) Click here for additional data file.
  47 in total

Review 1.  Ca2+ channel beta-subunits: structural insights AID our understanding.

Authors:  Mark W Richards; Adrian J Butcher; Annette C Dolphin
Journal:  Trends Pharmacol Sci       Date:  2004-12       Impact factor: 14.819

Review 2.  Calcium-activated chloride channels.

Authors:  Criss Hartzell; Ilva Putzier; Jorge Arreola
Journal:  Annu Rev Physiol       Date:  2005       Impact factor: 19.318

Review 3.  Calcium-activated chloride channels: (un)known, (un)loved?

Authors:  Jan Eggermont
Journal:  Proc Am Thorac Soc       Date:  2004

Review 4.  Calcium-dependent chloride conductance in epithelia: is there a contribution by Bestrophin?

Authors:  Karl Kunzelmann; Vladimir M Milenkovic; Melanie Spitzner; René Barro Soria; Rainer Schreiber
Journal:  Pflugers Arch       Date:  2007-03-15       Impact factor: 3.657

Review 5.  Properties of volume-regulated anion channels in mammalian cells.

Authors:  B Nilius; J Eggermont; T Voets; G Buyse; V Manolopoulos; G Droogmans
Journal:  Prog Biophys Mol Biol       Date:  1997       Impact factor: 3.667

6.  Molecular identification of a volume-regulated chloride channel.

Authors:  D Duan; C Winter; S Cowley; J R Hume; B Horowitz
Journal:  Nature       Date:  1997-11-27       Impact factor: 49.962

7.  Volume sensitivity of the bestrophin family of chloride channels.

Authors:  Rodolphe Fischmeister; H Criss Hartzell
Journal:  J Physiol       Date:  2004-11-25       Impact factor: 5.182

8.  Targeted disruption of gene function in Drosophila by RNA interference (RNA-i): a role for nautilus in embryonic somatic muscle formation.

Authors:  L Misquitta; B M Paterson
Journal:  Proc Natl Acad Sci U S A       Date:  1999-02-16       Impact factor: 11.205

9.  Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway.

Authors:  J R Kennerdell; R W Carthew
Journal:  Cell       Date:  1998-12-23       Impact factor: 41.582

10.  Drosophila bestrophin-1 chloride current is dually regulated by calcium and cell volume.

Authors:  Li-Ting Chien; H Criss Hartzell
Journal:  J Gen Physiol       Date:  2007-11       Impact factor: 4.086

View more
  15 in total

Review 1.  Bestrophin 1 and retinal disease.

Authors:  Adiv A Johnson; Karina E Guziewicz; C Justin Lee; Ravi C Kalathur; Jose S Pulido; Lihua Y Marmorstein; Alan D Marmorstein
Journal:  Prog Retin Eye Res       Date:  2017-01-30       Impact factor: 21.198

2.  Structure and insights into the function of a Ca(2+)-activated Cl(-) channel.

Authors:  Veronica Kane Dickson; Leanne Pedi; Stephen B Long
Journal:  Nature       Date:  2014-10-22       Impact factor: 49.962

Review 3.  VRACs and other ion channels and transporters in the regulation of cell volume and beyond.

Authors:  Thomas J Jentsch
Journal:  Nat Rev Mol Cell Biol       Date:  2016-04-01       Impact factor: 94.444

4.  Bestrophin 1 is indispensable for volume regulation in human retinal pigment epithelium cells.

Authors:  Andrea Milenkovic; Caroline Brandl; Vladimir M Milenkovic; Thomas Jendryke; Lalida Sirianant; Potchanart Wanitchakool; Stephanie Zimmermann; Charlotte M Reiff; Franziska Horling; Heinrich Schrewe; Rainer Schreiber; Karl Kunzelmann; Christian H Wetzel; Bernhard H F Weber
Journal:  Proc Natl Acad Sci U S A       Date:  2015-05-04       Impact factor: 11.205

5.  Glial Chloride Channels in the Function of the Nervous System Across Species.

Authors:  Jesus Fernandez-Abascal; Bianca Graziano; Nicole Encalada; Laura Bianchi
Journal:  Adv Exp Med Biol       Date:  2021       Impact factor: 2.622

6.  Mitochondrial calcium uniporter regulator 1 (MCUR1) regulates the calcium threshold for the mitochondrial permeability transition.

Authors:  Dipayan Chaudhuri; Daniel J Artiga; Sunday A Abiria; David E Clapham
Journal:  Proc Natl Acad Sci U S A       Date:  2016-03-14       Impact factor: 11.205

Review 7.  Biophysics and Physiology of the Volume-Regulated Anion Channel (VRAC)/Volume-Sensitive Outwardly Rectifying Anion Channel (VSOR).

Authors:  Stine F Pedersen; Yasunobu Okada; Bernd Nilius
Journal:  Pflugers Arch       Date:  2016-01-06       Impact factor: 3.657

8.  Distinct regions that control ion selectivity and calcium-dependent activation in the bestrophin ion channel.

Authors:  George Vaisey; Alexandria N Miller; Stephen B Long
Journal:  Proc Natl Acad Sci U S A       Date:  2016-11-07       Impact factor: 11.205

9.  Hypotonicity stimulates potassium flux through the WNK-SPAK/OSR1 kinase cascade and the Ncc69 sodium-potassium-2-chloride cotransporter in the Drosophila renal tubule.

Authors:  Yipin Wu; Jeffrey N Schellinger; Chou-Long Huang; Aylin R Rodan
Journal:  J Biol Chem       Date:  2014-08-01       Impact factor: 5.157

10.  SWELL1, a plasma membrane protein, is an essential component of volume-regulated anion channel.

Authors:  Zhaozhu Qiu; Adrienne E Dubin; Jayanti Mathur; Buu Tu; Kritika Reddy; Loren J Miraglia; Jürgen Reinhardt; Anthony P Orth; Ardem Patapoutian
Journal:  Cell       Date:  2014-04-10       Impact factor: 41.582

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.