| Literature DB >> 23056373 |
Mathias Ackermann1, Maxim Koriabine, Fabienne Hartmann-Fritsch, Pieter J de Jong, Teresa D Lewis, Nelli Schetle, Thierry M Work, Julie Dagenais, George H Balazs, Jo-Ann C Leong.
Abstract
The Chelonid fibropapilloma-associatedEntities:
Mesh:
Year: 2012 PMID: 23056373 PMCID: PMC3462797 DOI: 10.1371/journal.pone.0046623
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Oligonucleotides used for identification of BAC CH-651-60O9.
| Designation | oligonucleotide sequence (5′ to 3′) |
| UL10-F |
|
| UL10-R |
|
| UL27F |
|
| UL27R |
|
| UL28-F |
|
| UL28-R |
|
| 5′-pol |
|
| 3′-pol |
|
| pol-probe | [6FAM]-CGATGAAAACCGCACCGAGCGA-[TAMRA] |
| UL12-OVa |
|
| UL12-OVb |
|
|
32P-dsUL12 probe |
|
| UL22-OVa |
|
| UL22-OVb |
|
|
32P-dsUL22 probe |
|
| UL30-OVa |
|
| UL30-OVb |
|
|
32P-dsUL30 probe |
|
= PCR primers (F = forward; R = reverse)
= Taqman primers
= Taqman probe
= oligonucleotide for hybridization (overlapping variants a and b were used to generate 32P-labeled probes
= double stranded probe
Figure 1Genomic Map of ChHV5 as determined from BAC CH-651-60O9.
The linearized, double stranded map, drawn to scale, shows the Repeat Sequences (TRS and IRS) in brown, the Unique Sequences (US and UL) in grey, and the predicted open reading frames (ORFs) in yellow. The relative orientation of each ORF is symbolized in the direction of its arrow shape. The ORF designations and the scale refer to the information provided in Tables 2 through 4.
ORFs in the inverted repeats and their predicted features.
| Designation | Map position | Predicted Features |
| HP1/HP1′ | F(163..570)/C(26563..27591) | Secretory pathway; transmembrane region |
| F-LANA/F-LANA′ | F(3391..4416)/C(26563..27591) | Nuclear localization; N-terminal DNA-binding domain |
| F-ICP0/F-ICP0′ | F(6387..7202)/C(23780..24595) | Similar to TAF9 RNA polymerase II; Nucleotidylylation signature |
| HP4/HP4′ | F(6484..7146)/C(23836..24498) | Hypothetical protein; ORF overlapping with F-ICP0 |
| HP6/HP13 | F(8063..8833)/C(22137..22919) | Nuclear localization; ORFs extending into US; N-terminally identical proteins |
| HP7/HP11 | F(8349..8900)/C(22118..22633) | Nuclear localization; ORFs overlapping with HP6/13 and extending into US; N-terminally identical proteins |
| LF3-like/LF3-like′ | C(12..1916)/F(29066..30970) | Leucine Zipper motif; C-termianl RNA-binding domain; similar to LF3 of Cercopithecine herpesvirus 15; nuclear localization; |
| F-ICP4a/F-ICP4a′ | C(86..2041)/F(28941..30896) | Nuclear localization; remote similarity to ICP4; Nucleotidylylation signature |
| HP2/HP2′ | C(3693..4373)/F(26609..27289) | Similarity to germ line helicase; overlapping F-LANA on the opposite strand |
| HP3/HP3′ | C(4782..5105)/F(25877..26200) | Putative membrane protein; transmembrane helix: aa 33–55 |
| HP5/HP5′ | C(7007..7543)/F(23439..23975 | Secretory pathway; transmembrane region: aa 10–27 |
| HP8/HP12 | C(8289..8831)/F(22127..22693) | Nuclear localization; products identical within C-terminus |
ORFs in the Unique Short sequence and their predicted features.
| Designation | Map position | Predicted Features |
| F-US11 | F(10382..11209) | Nuclear localization |
| F-US10 | F(11140..12168) | Similarity to virion protein US10 of Anatid herpesvirus 1 |
| HP9 | F(12238..12642) | RGRG Proteasomal degradation domain |
| F-US2 | F(18137..19027) | Ser/Arg-rich protein |
| F-US1 | F(19204..22140) | Secretory pathway; Signal sequence; transmembrane region |
| F-US12 | C(9293..10345) | Nuclear localization; N-terminal RNA-binding domain; similarity to RNA-binding splicing factor |
| F-US8 | C(12223..13842) | Glycoprotein E (gE); signal sequence; transmembrane region |
| HP10 | C(14015..14482) | Nuclear localization; leuzine-rich |
| F-US4 | C(14752..15549) | Glycoprotein; signal sequence; transmembrane region; IG_like domain; a |
| F-US3B | C(15650..16591) | Similarity to US3 serine/threonine protein kinase US3 (PK) and to cyclin-dependent kinase 2 |
| F-US3A | C(16566..17714) | Similarity to US3 PK and catalytic domain of the Protein Serine/Threonine Kinase |
ORFs in the Unique Long sequence and their predicted features.
| Designation | Map position | Predicted features |
| F-UL0.5 | c(32683..33594) | Putative nuclear protein |
| F-UL01 | 34789..35169 | Glycoprotein L (gL) |
| F-UL02 | 35138..35980 | Uracil DNA glycosylase (UDG) |
| F-UL03 | 36025..36708 | Nuclear phosphoprotein |
| F-UL04 | c(37192..37779) | Nuclear protein |
| F-UL05 | c(37823..40357) | Putative component of DNA helicase/primase complex; helicase signature |
| HP14 | 38921..39544 | Similarity to hypothetical protein of Gallid herpesvirus 1 |
| F-UL06 | 40356..42338 | Putative capsid portal protein |
| HP15 | 41039..41554 | Hypothetical nuclear protein |
| F-UL07 | 42211..43125 | Herpes_UL7 superfamily |
| F-UL08 | c(43118..45361) | Putative UL8 Herpesvirus DNA helicase/primase complex associated protein |
| F-UL09 | c(45306..47780) | Putative Origin-binding protein; Domain: DEAD-like helicases superfamily; ATP binding site on conserved domain DEXDc; putative Mg++ binding site on conserved domain DEXDc. |
| F-UL10 | 47779..49044 | Glycoprotein M (gM); 99% identical to AAU84515.1 in GenBank |
| F-UL11 | c(49134..49418) | Putative myristylated protein |
| F-UL12 | c(49325..51004) | 99% identity with gb|AAU84516.1| UL12 [Fibropapilloma-associated turtle herpesvirus]; YqaJ-like viral recombinase domain; herpesvirus alkaline exonuclease |
| HP16 | 50429..51067 | Hypothetical protein; predicted bipartite NLS |
| F-UL14 | c(51058..51594) | 96% identity with gb|AAU84517.1| UL14 [Fibropapilloma-associated turtle herpesvirus] |
| F-UL15A | 51593..52606 | Probable DNA packing protein, N-terminus; 97% identity with gb|AAU84518.1| UL15A [Fibropapilloma-associated turtle herpesvirus] |
| F-UL16 | c(52618..53673) | 97% identical to gb|AAU84520.1| UL16 [Fibropapilloma-associated turtle herpesvirus]; herpesvirus UL16/UL94 family; capsid maturation, DNA packaging/cleavage. |
| F-UL17 | c(53613..55568) | DNA packaging tegument protein; Multi domain PFAM: pfam04559, herpesvirus UL17 protein; 96% identity to gb|AAU84521.1| UL17 [Fibropapilloma-associated turtle herpesvirus] |
| F-UL15B | 55718..56788 | Probable DNA packing protein, C-terminus; 99% identity to gb|AAU84519.1| UL15B [Fibropapilloma-associated turtle herpesvirus] |
| HP17 | 57297..57764 | Hypothetical protein |
| HP18 | 58434..59129 | Unknown Protein; Similarity to protein RL5A [Human herpesvirus 5] gb|AAO48775.1| |
| HP19 | 58933..59415 | Hypothetical protein; E value: 0.035: gb|AAR31234.1| protein RL6 [Human herpesvirus 5] |
| HP20 | 59950..60450 | Hypothetical protein; E value 0.017: U54 HHV6B; ref|NP_050235.1| Gene info linked to NP_050235.1 virion transactivator [Human herpesvirus 6] |
| F-UL18 | c(60772..61764) | 99% identity to UL18 [Fibropapilloma-associated turtle herpesvirus] gb|AAU84522.1|; VP23 “capsid triplex subunit 2” |
| F-UL19 | c(61835..65986) | Major capsid protein; 99% identity to gb|AAU84523.1| major capsid protein [Fibropapilloma-associated turtle herpesvirus] |
| F-UL20 | c(66072..66701) | 100% identical with gb|AAU84524.1| UL20 [Fibropapilloma-associated turtle herpesvirus]; Herpesvirus egress protein UL20; 5 TM helices predicted |
| F-UL21 | 66784..68187 | 85% identity with gb|AAU84525.1| UL21 tegument protein [Fibropapilloma-associated turtle herpesvirus] |
| F-UL22 | c(68248..70485) | Putative glycoprotein H (gH); 98% identity to gb|AAU84526.1| glycoprotein H [Fibropapilloma-associated turtle herpesvirus]; predicted features: signal sequence; 4 N-gly sites; transmembrane helix |
| F-UL23 | c(70555..71637) | 98% identity to gb|AAU84527.1| thymidine kinase [Fibropapilloma-associated turtle herpesvirus]; C-terminal extension relative to gb|AAU93321.1| thymidine kinase [Hawaiian green turtle herpesvirus] |
| F-UL24 | 71586..72527 | PFAM: cl03293 [Superfamily] cl03293, Herpes virus protein UL24; 100% identity with gb|AAU93322.1| membrane-associated protein [Hawaiian green turtle herpesvirus]; 98% identity with gb|AAU84528.1| UL24 [Fibropapilloma-associated turtle herpesvirus] |
| F-UL25 | 72184..73857 | 99% identity with gb|AAU93323.1| minor capsid protein [Hawaiian green turtle herpesvirus]; 98% identity with gb|AAU84529.1| UL25 [Fibropapilloma-associated turtle herpesvirus] |
| HP21 | c(72282..72755) | Hypothetical protein; predicted NLS |
| F-UL26 | 73935..75584 | Putative UL26 capsid maturation protease"; 100% identity with gb|AAU93324.1| capsid maturation protease [Hawaiian green turtle herpesvirus]; 99% identity with gb|AAU84530.1| UL26 [Fibropapilloma-associated turtle herpesvirus] |
| F-UL26.5 | 74703..75584 | Putative UL26.5 virion scaffolding protein; 100% identity with gb|AAU93325.1| virion scaffolding protein [Hawaiian green turtle herpesvirus] |
| F-UL27 | c(75736..78291) | Glycoprotein B (gB); 100% identity with gb|AAU93326.1| virion membrane glycoprotein B [Hawaiian green turtle herpesvirus]; 99% identity with gb|AAU84531.1| glycoprotein B [Fibropapilloma-associated turtle herpesvirus]; predicted features: signal peptide; 3 transmembrane helices |
| HP22 | 76522..77211 | Hypothetical protein |
| HP23 | 77350..78219 | Limited similarity to C3 Complement C3 precursor protein |
| F-UL28 | c(78288..80540) | ICP18.5; 99% identity with gb|AAU93327.1| DNA cleavage/packaging protein [Hawaiian green turtle herpesvirus] |
| F-UL29 | c(80728..84312) | Putative UL29 single-stranded DNA binding protein [Green turtle herpesvirus]; [Superfamily] cl09516, ssDNA binding protein; 99% identity with gb|AAQ67362.1| single-stranded DNA binding protein [Green turtle herpesvirus] |
| HP24 | 83548..84489 | 6-phosphofructokinase-like hypothetical protein; NLS predicted |
| F-UL30 | 84473..87925 | Putative DNA polymerase catalytic subunit [Hawaiian green turtle herpesvirus]; 98% identity with gb|AAU84534.1| polymerase [Fibropapilloma-associated turtle herpesvirus] |
| F-UL31 | c(87852..88775) | [Superfamily] cl14325, nuclear egress lamina protein UL31; 99% identity with gb|AAU93329.1| nuclear phosphoprotein [Hawaiian green turtle herpesvirus] |
| F-UL32 | c(88768..90408) | 100% C-terminal identity with gb|AAU93330.1| DNA cleavage/packaging protein [Hawaiian green turtle herpesvirus |
| F-UL33 | 90371..90706 | DNA cleavage/packaging protein [Hawaiian green turtle herpesvirus] (Quackenbush et al., Virology 246 (2), 392-399 (1998); 100% identity with gb|AAU93331.1| DNA cleavage/packaging protein [Hawaiian green turtle herpesvirus] |
| F-UL34 | 90719..91513 | 100% identity with gb|AAU93332.1| UL34 membrane-associated phosphoprotein [Hawaiian green turtle herpesvirus] |
| F-UL35 | 91561..91926 | 100% identity with gb|AAU93333.1| VP26 basic phosphorylated capsid protein [Hawaiian green turtle herpesvirus] |
| F-UL36 | c(91944..98897) | PFAM: [Superfamily] cl04174, Herpesvirus UL36 VP1/2 tegument protein; This family only covers a small central part of this large protein. |
| F-UL37 | c(98897..102139) | PFAM: [Superfamily] cl04350, Herpesvirus UL37 tegument protein; closest similarity to gb|AAY59063.1| small tegument protein [Tortoise herpesvirus] |
| F-UL38 | 102138..103463 | PFAM: [Superfamily] cl04010, Herpesvirus capsid shell protein VP19C; closest similarity to gb|AAY59064.1| minor capsid protein [Tortoise herpesvirus] |
| HP25 | 102623..103132 | Hypothetical protein with predicted bipartite NLS |
| F-UL39 | 103441..103923 | Partial similarity to gb|AAQ73541.2| ribonucleotide reductase large subunit [Tortoise herpesvirus] |
| F-UL41 | c(104719..105897) | Closest similarity to gb|AER28066.1| tegument host shutoff protein [Gallid herpesvirus 1]; PFAM: cd09867, PIN domain of Flap Endonuclease-1, a structure-specific, divalent-metal-ion dependent, 5′ nuclease and homologs. |
| F-UL42 | 105949..107025 | DNA polymerase processivity factor; similarity to ref|NP_944415.1| DNA polymerase processivity subunit [Psittacid herpesvirus 1]; |
| F-UL43 | 107061..108287 | Similarity to gb|AEI00251.1| UL43 protein [Gallid herpesvirus 3] |
| HP26 | c(107196..107687) | Hypothetical protein |
| HP27 | 108437..109090 | Hypothetical protein of 217 aa with at least two Zink-binding domains identified; similarity to ref|YP_001285929.1| protein IG [Psittacid herpesvirus 1] |
| F-UL53 | c(109136..110197) | PFAM: [Superfamily] cl03284, UL53 cell fusion glycoprotein K; highest blast scores with envelope glycoprotein gK gK of psittacid herpesvirus 1, anatid-, felid1, gallid3, equid4 herpesviruses; 6 transmembrane helices predicted |
| F-UL52 | c(110214..113087) | PFAM: [PHA03180], UL52 helicase-primase primase subunit; similarity to gb|AAG30093.1|AF282130_56 DNA helicase/primase complex protein [Meleagrid herpesvirus 1] |
| HP28 (UL55) | 113179..113805 | Limited similarity to UL55 on aa level; E-value 93–04 similarity to ref|YP_443903.1| nuclear protein UL55 [Papiine herpesvirus 2] |
| HP29 | c(113896..114384) | Hypothetical protein |
| F-M04 | c(114874..115683) | Similarity to emb|CAJ84726.1| m04 protein [Murid herpesvirus 1]; m04 proteins are known to mediate immune evasion by interference with the major histocompatibility complex class I (MHC-I) pathway of antigen presentation to cytolytic T lymphocytes. Instead, the m04 early gene product binds to folded MHC-I molecules in the ER and directs the complex to the cell surface; two transmembrane helices predicted |
| HP30 | c(116252..116788) | Hypothetical protein; ORF may N-terminally extend for up to 46 aa; similarity to emb|CAC85009.1| hypothetical protein [Saimiriine herpesvirus 2]; predicted features: signal sequence, transmembrane helix; N-glycosylation site at pos. 40 NFTL |
| F-lec1 | 117032..117658 | Probable start codon GGC; PFAM: cl02432 [Superfamily] cl02432, C-type lectin (CTL)/C-type lectin-like (CTLD) domain; CLECT: C-type lectin (CTL)/C-type lectin-like (CTLD) domain; PFAM: cd03593, C-type lectin-like domain (CTLD) of the type found in natural killer cell receptors (NKRs); CLECT_NK_receptors_like: C-type lectin-like domain (CTLD) of the type found in natural killer cell receptors (NKRs); transmembrane helix predicted |
| F-lec2 | 117767..118297 | Alternative AAA-start codon at position −57; similar to type II membrane protein CD69 [Equus caballus]; E-value: 5e-09: “C-type lectin domain family (poxviruses)”; PFAM: cd03593, C-type lectin-like domain (CTLD) of the type found in natural killer cell receptors (NKRs); CLECT_NK_receptors_like: C-type lectin-like domain (CTLD) of the type found in natural killer cell receptors (NKRs); E value 1e-10: dbj|BAG69470.1| c-type lectin-like receptor [Gallus gallus]; transmembrane helix predicted |
| F-sial | 118474..119433 | Similarity to CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase (mus musculus); PFAM: cl02965 [Superfamily] cl02965, Glycosyltransferase family 29 (sialyltransferase) ; E value 6e-70: emb|CAB53395.1| Gal(beta)1,3/4-GlcNAc (alpha)2,3-sialyltransferase [Mesocricetus auratus]; transmembrane helix predicted |
| F-Nec2 | c(120491..122230) | Similarity to CD155 (poliovirus receptor) and CD112 (Nectin-2); E-value: 0.016 with glycoside hydrolase family 5 [Eubacterium cellulosolvens 6]; signal sequence predicted |
| HP31 | 120755..121279 | Hypothetical protein with similarity to Tau-tubulin kinase 1; E-value: 0.034 |
| HP32 | c(122359..124044) | Hypothetical V-set protein; pfam07686, Immunoglobulin V-set domain; Signal sequence predicted |
| HP33 | 124921..125382 | Hypothetical protein |
| HP34 | 126003..126476 | Hypothetical protein |
| HP35 | c(127044..128483) | PFAM: cl02885 [Superfamily] cl02885, heptad repeat 1-heptad repeat 2 region (ectodomain) of the transmembrane subunit of various endogenous retroviruses (ERVs) and infectious retroviruses; signal sequence and transmembrane helix predicted |
| HP36 | c(128486..128938) | Hypothetical protein; PFAM: [Superfamily] cl11403, Cellular and retroviral pepsin-like aspartate proteases. |
| HP37 (ICP4c) | c(128969..131062) | Hypothetical protein with limited similarity to ICP4 stretching over several domains; predicted features: several NLS, DNA- and RNA-binding domains |
| HP38 (ICP4b) | c(130312..131055) | Hypothetical protein with similarity to ICP4s over several regions; predicted features: C-terminal RNA-binding domain; mitochondrial targeting peptide |
Figure 2Map of atypical ChHV5 sequences and strategy for overlapping PCR.
(A) A double stranded map of the atypical ChHV5 sequences is shown, anchoring in F-UL52. The arrows indicate relative length and orientation of each ORF; yellow ORFs were object of further analysis in this study; numbers refer to the nucleotide count in the forward orientation. EcoRI sites as well as predicted TATA- and GATA-boxes are indicated. The pTARBAC vector in BAC CH-651-60O9 (not shown) was integrated at the EcoRI site within F-UL52. (B) PCR amplification using the primer pairs (see Table 5) listed on the left was expected to yield the products listed on the right. Double-arrows indicate the putative map location of the PCR product; the numbers refer to the expected sizes of the amplicons.
PCR primers used for overlapping PCR.
| Designation | oligonucleotide sequence (5′ to 3′) |
| P1F |
|
| P2R |
|
| P3F |
|
| P4R |
|
| P5R |
|
| P6F |
|
| P7F |
|
| P8R |
|
| P12R |
|
| P13F |
|
| P16R | GGGGACCACTTTGTACAAGAAAGCTGGGTT |
| P17F |
|
| P18R |
|
| P19F |
|
= PCR primers (F = forward; R = reverse)
= this primer consists of a binding part (bold) and is fused to a 5′-att-recombination sequence. The latter part of the primer was not required for the present experiment but was, nevertheless, part of the primer.
Figure 3Overlapping PCR.
Ethidium bromide stained agarose gels with the PCR products are shown. (A) PCR products generated with DNA from FP-related tumors as template. The primer pairs used for amplification of each product are indicated below the corresponding lane; M: size marker with specific band sizes provided at the left. For expected sizes of the amplification products in lanes 1 through 7, see Figure 2B. (B) amplification products obtained with primer pairs P1–P2 (201 bp) and P3–P4 (198 bp), when BAC CH-651-60O9 DNA was used as template.
PCR primers used for detection of F-M04- and F-sial RNAa.
| Designation | oligonucleotide sequence (5′ to 3′) |
| Att-SiaF |
|
| P16R |
|
| Att-M04F |
|
| M04R-att |
|
= these primers were also used to amplify and clone (for sequence determination) the Australian isotypes of F-M04 and F-sial
= PCR primers (F = forward; R = reverse)
= each primer consists of a binding part (bold) and is fused to a 5′-att-recombination sequence. The latter part of the primer was used for consecutive cloning and sequencing of the amplification product into a Gateway donor vector.
Figure 4RT-PCR for detection of F-sial- and F-M04 RNA.
RNA extracted from fresh tumors as well as from corresponding normal tissue was subjected to RT-PCR as described in materials and methods and the amplification products were separated on a 1%agarose gel. (A) F-sial: Lane 1, skin tumor (ST); lane 2, lung tumor (LT); lane 3, normal skin (NS); lane 4, normal lung (NL). M, HyperLadder II was used as a molecular weight standard. The red arrow points to the expected 960 bp RT-PRC product. (B) Control reactions were performed to demonstrate that RNA was a true template. Lane C, to confirm the DNA polymerase activity of the enzyme used in reactions 1 through 4, DNA template was used and the RT step was omitted. Lane 1, RNA extracted from a skin tumor was reverse transcribed and subjected to PCR; lane 2, same as lane 1 but the RT step was omitted; lanes 3 and 4, same as lanes 1 and 2 but the template stemmed from normal skin. M, HyperLadder II. Note: a faint unspecific product may be detected in Lane 4, which is not of the expected size. The red arrow points to the expected 960 bp RT-PRC product. (C) F-M04: M, HyperLadder II. Lane 1, RNA extracted from a skin tumor; RT-step omitted; PCR using F-M04 primers. Lane 2, same as lane 1 but RT step was executed. Lane C, DNA template was used and the RT step was omitted. The red arrow points to the expected 869 bp RT-PCR product.