Molecular phylogeny of the Trechus brucki group, with description of two new species from the Pyreneo-Cantabrian area (France, Spain) (Coleoptera, Carabidae, Trechinae).

A molecular phylogeny of the species from the Trechus brucki clade (previously Trechus uhagoni group)based on fragments of four mitochondrial genes and one nuclear gene is given. We describe Trechus (Trechus) bouillonisp. n. from the western pre-Pyrenees: Sierras de Urbasa-Andía, Navarra, Spain. The species was collected in mesovoid shallow substratum (mss), a subterranean environment. Molecular as well as morphological evidences demonstrate that the new species belongs to the Trechus brucki clade. A narrow endemic species of high altitude in western French Pyrenees merged with Trechus brucki Fairmaire, 1862a, Trechus bruckoidessp. n., is described. A lectotype is designated for Trechus brucki and Trechus planiusculus Fairmaire, 1862b (junior synonym of Trechus brucki). The species group is redefined based on molecular and morphological characters, and renamed as the brucki group, as Trechus brucki was the first described species of the clade. A unique synapomorphy of the male genitalia, a characteristic secondary sclerotization of the sperm duct, which is shared by all the species of the brucki group sensu novo, is described and illustrated. The Trechus brucki group sensu novo is composed of Trechus beusti (Schaufuss, 1863), Trechus bouillonisp. n., Trechus brucki, Trechus bruckoidessp. n., Trechus grenieri Pandellé, 1867, T. uhagoni uhagoni Crotch, 1869, T. uhagoni ruteri Colas, 1935 and Trechus pieltaini Jeannel, 1920. We discuss the taxonomy of the group and provide illustrations of structures showing the differences between the species, along with distribution data and biogeographical comments.

Introduction

The genus (Coleoptera, Carabidae, Trechinae) includes more than 800 species, most of them in the Palearctic area (Moravec et al.2003; Lorenz 2005). This genus is known to contain many wingless short range endemic species (Jeannel 1927, Casale and Laneyrie 1982, Schmidt 2009) and is currently understood as polyphyletic (Faille et al. 2010a, 2011a).

Jeannel (1927) gathered seven species from the uhagoni group distributed from the French slope of the Pyrenees to the Cantabrian area: Pandellé, 1867 (France: Hautes–Pyrénées), Peyerimhoff, 1909 (France: Pyrénées–Atlantiques), Fairmaire, 1862 (France: Hautes–Pyrénées, Pyrénées–Atlantiques), Pandellé, 1867 (France: Hautes–Pyrénées), Vuillefroy, 1867 (France: Pyrénées–Atlantiques), Jeannel, 1921 (Spain: Cantabria) and Crotch, 1869 (Spain: Navarra). This group of species was also considered close to the group of Kiesenwetter, 1850, a Pyreneo–Cantabrian group with nine species, all apterous, orophilous or troglobitic.

In this paper we describe a species collected by traps in a MSS (mesovoid shallow substratum, “Milieu Souterrain Superficiel” sensu Juberthie et al. 1980, Giachino and Vailati 2010) in the Sierras de Urbasa–Andía (Western pre–Pyrenees, Navarra, Spain) and a second orophilic species from the French Central Pyrenees. We study the phylogenetic relationships of the new species and provide a molecular phylogeny of the group, including all known species but four.

Historical background

was described by Crotch in 1869 and dedicated to S. de Uhagon with whom he visited caves in the Alsasua area in June 1869. was first described under the name by Fairmaire (1862b). He renamed it one year later to bruckii because politus was already in use for an American species. The two names were corrected to uhagoni and brucki by subsequent authors, and recently renamedPageBreak uhagonii and bruckii in catalogues (Lorenz 1998, 2005, Moravec et al. 2003, Queinnec and Ollivier 2011). As the names uhagonii and bruckii have not been used since their description, we choose to keep the prevailing usage of uhagoni and brucki in accordance with the article 33.3.1 of the International Code of Zoological Nomenclature on incorrect subsequent spellings (ICZN 1999).

In the Monographie des Trechinae, Jeannel (1927) erected the uhagoni group for the seven species of from the Pyreneo–Cantabrian area quoted above. Español (1970) described from a cave of Burgos province (Spain), and included it in the uhagoni group, close to .

The uhagoni group sensu Jeannel (1927), although poorly defined morphologically, was enriched with 5 species by Casale and Laneyrie (1982) in their catalogue of species of world Trechinae: Colas & Gaudin, 1935 (described first as a subspecies of ), , Abeille de Perrin, 1903 (considered by Jeannel (1927) to belong to the group), Coiffait, 1971 and Coiffait, 1953. was here considered as subspecies of . By describing from a cave of Navarra, Dupré (1991) suggested that the peculiar genital morphology of , , and the new species should lead to their removal from the uhagoni group, and he created the bonvouloiri group for these species, opinion followed by Queinnec and Ollivier (2011). Toribio and Rodríguez (1997) added one species from Cantabria to the uhagoni group, , a species collected in the MSS. Sciaky (1998) described from Cantabria, and included it in the uhagoni group, close to and . Hernando (2002) described from a cave of Navarra and suggested that it should be considered as sister species of . Molecular and morphological evidence suggest that this species should be removed from the uhagoni group (Faille et al. 2010a, 2011a, Ortuño and Arribas 2010). Ortuño and Toribio (2005) described a new species of belonging to another group of species, indicating that 11 species belong to the uhagoni group in the Iberian Peninsula. Reboleira et al. (2010) considered that 10 species belong to this group in the Peninsula, without providing the list of taxa included.

is an alpine species located at high altitude in the central and western Pyrenees, and it is until now not recorded from the Spanish slope of the chain (Serrano 2003). Colas and Gaudin described in 1935 from the western Pyrenees (Pic d´Orhy) as a subspecies of . Coiffait (1952) described 3 subspecies of ; , and . The subspecies vandeli and truilheti were later related to (Casale & Laneyrie, 1982) so that counts three subspecies in the Catalogue of Palearctic Coleoptera (Moravec et al. 2003). Queinnec and Ollivier (2011) considered as a subspecies of brucki restricted in the Anie and Orhy massifs, whereas the subspecies vandeli, described from Anie, was considered a synonym of together with the subspecies truilheti and microthorax.

Materials and methods

Taxon sampling, Morphological study, DNA extraction and sequencing

Specimens were collected by hand or by means of pitfall traps containing water saturated in salt or propylene glycol, known to preserve DNA (Rubink et al. 2003, López and Oromí 2010) (Table 1). The protocol is detailed in Faille et al. (2010b):

Table 1.

Sequenced specimens, with localities, collectors, codes and sequence accession numbers (unpublished sequences in bold).

sp	locality	collector	code	LSU	cox1	rrnL	trnL	NAD1
Aphaenops Bonvouloir, 1862
Aphaenops leschenaulti Bonvouloir, 1861	Grotte de Castelmouly – Bagnères–de–Bigorre (France–65)	C. Bourdeau, P. Déliot, A. Faille	MNHN–AF1	GQ293593	HE817919	GQ293739	GQ293757	GQ293822
Trechus Clairville, 1806
Trechus grenieri Pandellé, 1867	Résurgence de la Hèche, Fréchet–Aure (France–65)	J.P. Besson, C. Bourdeau, A. Faille	ZSM–L13	HE817904	HE817920	HE817887	HE817887	HE817887
Trechus brucki Fairmaire, 1862	Pic du Gabizos, Arrens (France–65)	C. Bourdeau	ZSM–L329	HE817906	HE817921	HE817888	HE817888	HE817888
Trechus brucki Fairmaire, 1862	Pic du Gabizos, Arrens (France–65)	C. Bourdeau	ZSM–L329b	HE817907		HE817889	HE817889	HE817889
Trechus brucki Fairmaire, 1862	Pic de Sesques, Laruns (France–64)	C. Bourdeau	ZSM–L446	HE817905	HE817922	HE817890	HE817890	HE817890
Trechus brucki Fairmaire, 1862	Pic de Gaziès, Laruns (France–64)	C. Bourdeau	ZSM–L190	HE817908	HE817923	HE817891	HE817891	HE817891
Trechus brucki Fairmaire, 1862	Caperan d´Anéou, Laruns (France–64)	C. Bourdeau	ZSM–L449	HE817909	HE817924	HE817892	HE817892	HE817892
Trechus uhagoni Crotch, 1869	Cueva de Orobe – Alsasúa (Spain–Navarra)	C. Bourdeau, J. Fresneda	ZSM–L161	HE817910	HE817925	HE817893	HE817893	HE817893
Trechus bouilloni Faille, Bourdeau & Fresneda, sp. n.	Puerto de Lizarraga, Lizarraga (Spain–Navarra)	C. Bourdeau, J. Fresneda	ZSM_L201b	HE817911	HE817926	HE817894	HE817894	HE817894
Trechus bouilloni Faille, Bourdeau & Fresneda, sp. n.	Puerto de Lizarraga, Lizarraga (Spain–Navarra)	C. Bourdeau, J. Fresneda	ZSM_L201t		HE817927	HE817895	HE817895	HE817895
Trechus beusti (Schaufuss 1863)	Cueva de San Adrián, Zegama (Spain–Guipúzcoa)	C. Bourdeau, J. Fresneda	ZSM–L199	HE817912	HE817928	HE817896	HE817896	HE817896
Trechus pieltaini Jeannel, 1920	Cueva de Mairuelegorreta, Gorbea (Spain–Álava)	C. Bourdeau	ZSM–L395	HE817913	HE817929	HE817897	HE817897	HE817897
Trechus navaricus (Vuillefroy, 1869)	Grotte de Sare – Sare (France–64)	C. Bourdeau	MNHN–AF103	GQ293603	GQ293687	FR729578	FR729578	FR729578
Trechus bordei Peyerimhoff, 1909	Grotte d´Ayssaguer – Larrau (France–64)	C. Bourdeau, P. Déliot, A. Faille	MNHN–TBA	HE817914	HE817930	HE817898	HE817898	HE817898
Trechus bonvouloiri Pandellé, 1867	Pic de Montaigu – Baudéan (France – 65)	C. Bourdeau	ZSM–L218	HE817915	HE817931	HE817899	HE817899	HE817899
Trechus abeillei Pandellé, 1872	Cirque d´Anglade Couflens (France–09)	C. Vanderbergh	ZSM–L15	HE817916	HE817932	HE817900	HE817900	HE817900
Trechus distinctus Fairmaire & Laboulbène, 1854	Col Sobe Ariel – Laruns (France–64)	C. Bourdeau	ZSM–L216	HE817917	HE817933	HE817901	HE817901	HE817901
Trechus aubryi Coiffait, 1953	Cirque d´Anglade Couflens (France–09)	B. Junger	ZSM–L370		HE817934	HE817902	HE817902	HE817902
Trechus jeannei Sciaky, 1998	Bosque de Saja, Saja (Spain–Cantabria)	C. Bourdeau	ZSM–L516	HE817918		HE817903	HE817903	HE817903
Trechus saxicola Putzeys, 1870	Braña Caballo – Piedrafita (Spain–León)	C. Bourdeau, P. Déliot, A. Faille	MNHN–AF100	GQ293614	HE817935	FR729577	FR729577	FR729577
Trechus escalerae Abeille de Perrin, 1903	Cueva de Porro Covañona – Covadonga (Spain–Asturias)	J.M. Salgado	MNHN–AF104	GQ293612	FR733912	GQ293731	GQ293793	GQ293839
Trechus ceballosi Mateu, 1953	Aven de Licie Etsaut – Lanne–en–Barétous (France–64)	C. Bourdeau, A. Faille	MNHN–AF128	GQ293610	FR733914	GQ293728	GQ293791	GQ293850
Trechus distigma Kiesenwetter, 1851	Aven de Nabails – Arthez d’Asson (France–64)	C. Bourdeau, P. Déliot, A. Faille	MNHN–AF94	GQ293611	HE817936	FR729575	FR729575	FR729575
Trechus barnevillei Pandellé, 1867	Cueva del Pis – Penilla, Santiurde de Toranzo (Spain–Cantabria)	C. Bourdeau, P. Déliot, A. Faille	MNHN–AF97	GQ293607	GQ293680	GQ293727	GQ293783	GQ293848
Trechus obtusus Erichson, 1837	Estrada de Nicho (Portugal–Madeira)	A. Arraiol	IBE–AF2	FR733997	HE817937	FR729579	FR729579	FR729579
Trechus quadristriatus (Schrank, 1781)	Collau de la Plana del Turbón – Egea (Spain– Huesca)	P. Déliot, A. Faille, J. Fresneda	MNHN–AF96	GQ293619	FR733908	GQ293743	GQ293745	GQ293841
Trechus fulvus Dejean, 1831	Cueva del Pis – Penilla, Santiurde de Toranzo (Spain–Cantabria)	C. Bourdeau, P. Déliot, A. Faille	MNHN–AF98	GQ293613	HE817938	GQ293729
Trechus martinezi Jeannel, 1927	Cova de les Meravelles – Cocentaina (Spain– Alicante)	C. Andújar, P. Arribas, A. Faille	IBE–AF1	FR733996	HE817939	FR729576	FR729576	FR729576
Trechus schaufussi ssp. comasi Hernando, 2002	Cueva Basaula – Barindano (Spain–Navarra)	J. Fresneda	MNHN–AF127	GQ293617	HE817940	FR729580	FR729580	FR729580
Apoduvalius Jeannel, 1953
Apoduvalius alberichae Español, 1971	Cova de Agudir – Cardano de abajo – Palencia (Spain–Asturias)	J.M. Salgado	MNHN–AF105	GQ293618	GQ293632	GQ293732	GQ293794	GQ293840
Apoduvalius anseriformis Salgado et Peláez, 2004	Cueva de Entrecuevas – Caravia Alta (Spain– Palencia)	A. Cieslak, A. Faille, J. Fresneda, I. Ribera, J.M. Salgado	MNCN–AF2	FR733999	FR733916	FR729582	FR729582	FR729582

Extractions of single specimens were non–destructive, using the DNeasy Tissue Kit (Qiagen GmbH, Hilden, Germany). After extraction, specimens were mounted on cards and genitalia stored in water–soluble dimethyl hydantoin formaldehyde resin (DMHF) on transparent cards, pinned beneath the specimen. Vouchers and DNA samples are kept in the collections of ZSM, IBE and MNHN.

We included examples of most species of the group, with the exception of sp. n., and and some examples of of the angusticollis group sensu Jeannel (1927) and Casale and Laneyrie (1982) (Table 1). The tree was rooted with Bonvouloir, 1862, which is known to belong to a different group of Pyrenean Trechini (Jeannel 1927, Faille et al. 2010a).

We amplified fragments of four mitochondrial genes: 3’ end of cytochrome c oxidase subunit (cox1); a single fragment including the 3’ end of the large ribosomal unit (rrnL), the whole tRNA–Leu gene (trnL) and the 5’ end of the NADH dehydrogenase 1 (nad1);and one nuclear gene (internal fragment of the large ribosomal unit 28S rRNA, LSU) (see Table 2 for primers used). Sequences were assembled and edited using Sequencher TM 4.8 (Gene Codes, Inc., Ann Arbor, MI). Parts of the sequences for 14 of the species were taken from Faille et al. (2010a) and Faille et al. 2011a (Table 1).

Table 2.

Primers used in the study. F, forward; R, reverse.

Gene	Name	Sense	Sequence	Reference
cox1	Jerry (M202)	F	CAACATTTATTTTGATTTTTTGG	Simon et al. 1994
	Pat (M70)	R	TCCA(A)TGCACTAATCTGCCATATTA	Simon et al. 1994
	Chy	F	T(A/T)GTAGCCCA(T/C)TTTCATTA(T/C)GT	Ribera et al. 2010
	Tom	R	AC(A/G)TAATGAAA(A/G)TGGGCTAC(T/A)A	Ribera et al. 2010
rrnL–nad1	16saR (M14)	F	CGCCTGTTTA(A/T)CAAAAACAT	Simon et al. 1994
	16Sa	R	ATGTTTTTGTTAAACAGGCG	Simon et al. 1994
	16Sb	R	CCGGTCTGAACTCAGATCATGT	Simon et al. 1994
	ND1A (M223)	R	GGTCCCTTACGAATTTGAATATATCCT	Simon et al. 1994
LSU	D1	F	GGGAGGAAAAGAAACTAAC	Ober 2002
	D3	R	GCATAGTTCACCATCTTTC	Ober 2002

New sequences have been deposited in the EMBL database with Accession Numbers HE817887–HE817940 (Table 1).

Phylogenetic analyses

We aligned the sequences using the MAFFT online v.6 and the Q–INS–i algorithm (Katoh and Toh 2008), a progressive pair–wise method with secondary refinement. We used Maximum Likelihood as implemented in the on–line version of RAxML (which includes an estimation of bootstrap node support, Stamatakis et al. 2008), using GTR+G as the evolutionary model and three partitions corresponding to the cox1, rrnL+trnL+nad1 and LSU fragments.

The aedeagus and genital duct were extracted and included in a drop of Canada balsam or dimethyl hydantoin formaldehyde resin (DMHF) on a transparent slide. Preparations were mounted below the specimen, on the same pin. Pictures were taken with microscopes Olympus ch and Olympus szx16, coupled with a camera Olympus c5060wz. Serial pictures were combined using the CombineZP software, and finally processed using Adobe Photoshop CS.PageBreakPageBreakPageBreak

Institutional codes and abbreviations used in the taxonomic treatment and private collectors

IBE

Institute of Evolutionary Biology (CSIC-UPF), Barcelona (Spain).

MNCN

Museo Nacional de Ciencias Naturales (CSIC), Madrid (Spain).

MNHN

Muséum National d´Histoire Naturelle, Paris (France).

MZB

Museu de Ciències Naturals (Zoologia), Barcelona (Spain).

ZSM

Zoologische Staatssammlung, München (Germany).

MFN

Museum für Naturkunde, Berlin (Germany).

CAF

coll. A. Faille (Paris, France).

CCB

coll. C. Bourdeau (Rebigue, France).

CJF

coll. J. Fresneda (Llesp, Spain).

CMT

coll. M. Toribio (Madrid, Spain).

LE

Length of elytra.

LP

Length of pronotum.

WE

Width of elytra.

WH

Width of head.

WP

Width of pronotum.

WPB

Width of pronotal base.

Results

Faille, Bourdeau & Fresneda sp. n.

urn:lsid:zoobank.org:act:C967CB33-C16A-468F-B786-E6F376B2D978

http://species-id.net/wiki/Trechus_bouilloni

Figs 1 8 15, 16 29

Figure 1.

Habitus of sp. n. (Lizarraga pass).

Figure 8–10.

Aedeagus in dorsal view of 8 sp. n. (Lizarraga pass) 9 (Lapiaz de Lazur) and 10 (Orobe doline). CP2, secondary copulatory piece.

Figures 15–20.

Aedeagus in lateral view and detail of internal sac of 15, 16 sp. n. (Lizarraga pass) 17, 18 (Eglise cave) and 19, 20 (Orobe doline). CP2, secondary copulatory piece.

Figures 29–32.

29 Genital armature of the female of sp. n. (Lizarraga pass) 30 Aedeagus in lateral view of (Cueva la Cuevona) 31, 32 Aedeagus in dorsal and lateral view of (Bosque de Saja).

Type locality.

Spain, Navarra,Sierra de Urbasa–Andía, Lizarraga, Puerto de Lizarraga, UTM (WGS 84): 30 T, X: 580, Y: 4746, Z: 900 m.

Type series.

Holotype (MNHN): 1 ♂, Spain, Navarra,Sierra de Urbasa–Andía, Lizarraga, Puerto de Lizarraga, MSS, trap: 1–5–1980/15–8–1980, Bourdeau and Fresneda leg., voucher number ZSM–L201, MNHN]. DNA aliquotes preserved in the DNA and tissue collections of the ZSM, MNHN and IBE; Genitalia dissected and mounted in a separate label pinned with the specimen. Paratypes: 52 ♂♂, 62 ♀♀, same label data as holotype (MNCN, MNHN, MZB, ZSM, CCB, CJF, CAF, CMT).

Diagnosis.

Large size (ca 5 mm) and round shape (Fig. 1). Median lobe of aedeagus slender, in lateral view (Fig. 15) the basal third curved, the central part straight and the apex with a curved hook assymetrical in dorsal view (Fig. 8). Inner sac of aedeagus (=endophallus) with an elongate and well-sclerotized piece, forming a gut and armed with internal scales. Characteristic secondary sclerotization of the sperm duct (Fig. 15: CP2) forming a kind of second copulatory piece outside base of the median lobe.

Description of the holotype.

Habitus as in Fig. 1.Elongated, round–sided. Body surface with a very thin, hardly visible, dense microreticulation, with more distinguishable meshes on the head.

Colour. Dorsal surface dark brown, moderately shiny. Antennae, palpi and legs light brown.

Chetotaxy. Surface of elytra glabrous with the exception of a periscutellar seta, two discal setae on the third stria, four humeral setae, four setae along lateral margin and two preapical setae. Marginal setae of pronotum present, the anterior ones located before the first third of the length. Ventral pubescence limited to one seta on each half sternite.

Head. Eyes reduced, flat; ommatidia well defined; maximum diameter of about eight ommatidia, temples approximately twice the length of eyes, strongly wrinkled to the neck. Frontal furrows deeply impressed. Antennae moderately long, five antennomeres extend beyond the pronotal base. Antennomere III distinctly longer than antennomeres II and IV, which are similar in length.

Pronotum. Proportions (M–F): WP/LP = 1.3–1.28, WP/WPB = 1.3–1.3, WP/WH = 1.38–1.3, WE/WP = 1.57–1.53. Transverse, with lateral margins finely bordered; wider in anterior part, narrower than elytra; posterior part much narrower than base of elytra. One seta in the marginal gutter at about a third of pronotum length, another one close to hind angle. Sides evenly rounded and straight just between hind angles and insertions of posterior setae. Hind angles well developed, salient.

Elytra. Proportions (M–F): WE/LE = 0.65–0.69. Oval, broadest almost at mid–length; surface moderately convex, flattened on disc. Shoulders distinct but rounded. Striae very finely punctuated, sixth inner striae deeply impressed on disc, but reduced at apex and base; seventh striae shallower, but distinct, the eighth reduced to the posterior quarter of elytra. Apical striola strongly impressed continuing the fifth stria.

Hind wings. Very reduced, not functional.

Male genitalia. Median lobe of aedeagus slender, in lateral view (Fig. 15) the basal third curved, the central part straight and the apex showing a curved hook; assymetrical in dorsal view (Fig. 8). Parameres slender, each with 4 to 6 setae at apex. Internal sac of aedeagus with an elongate well-sclerotized piece, forming a symmetrical gut and armed withPageBreak internal scales (Fig. 16). Characteristic secondary sclerotization of the sperm duct forming a kind of second copulatory piece out of the base of the median lobe (Fig. 15: CP2).

Female genitalia.

Internal genitalia membranous. Gonocoxites unguiform, with 4 to 5 large setae, and 2 small near apex. Gonosubcoxites with 2 to 3 large setae near the internal edge. Laterotergite IX with 12 setae at the basal margin, and 4 to 6 scattered (Fig. 29).

Size.

Mean length (5 exemplars): 5.25 mm (male), 4.56 mm (female).

Etymology.

The new species is dedicated to Michel Bouillon, Pyrenean speleologist, who was the first to discover the existence of cave beetles in MSS.

Affinities.

sp. n. is a representative of the group sensu novo as defined in the present paper. It shares with , , , and the same kind of aedeagus morphology, especially the apex with a curved hook in lateral view, and an internal sac showing two sclerotized parts, the internal copulatory piece and another triangular piece forming a kind of second copulatory piece (CP2, Figs 17–24), also existing in and sp. n. (Figs 25–28). Similar secondary sclerotized structures of endophallus are known in some groups of insects including Coleoptera, and described as a “sperm pump” (Beutel and Leschen 2005, Hünefeld and Beutel 2005, Jäch and Delgado 2010). In the group, however, the structure is too rudimentary to play the same role in sperm transfer, and its function –if any– remains obscure. Although never observed before, this structure is also present in the others species of the group and is the main synapomorphy of the clade. The lack of this internal sclerotized structure in and (Figs 30–32) casts doubt on their affinities.

Figures 21–28.

Aedeagus in lateral view and detail of internal sac of 21, 22 (Cueva de San Adrián), 23, 24. (Cueva de Mairuelegorreta), 25, 26 sp. n. (Montagnon) and 27, 28 (Lac d’Anglas). CP2, secondary copulatory piece.

Distribution and ecology.

sp. n. is only known from the type locality, the MSS of Lizarraga pass (Navarra, Spain) (Fig. 36). The type locality is a MSS located on a northern slope at the eastern extremity of the Sierra de Andía–Urbasa, close to the Lizarraga pass.

Figure 36.

The MSS of Lizarraga pass (Navarra, Spain).

were collected by means of traps in a zone of scree (altitude: 900 m) extending from east to west at the feet of cliffs of Albian limestone lining the northern slope of the plateau of the Sierra de Andía–Urbasa. This scree slope consists of a mass of fallen rocks resulting from the erosion of calcareous cliffs and constitutes a steeply sloped (45°) MSS, filling one of the numerous gullies of a beech forest covering the entire northern side of the plateau lining the southward depression of the Río Arakil (Sakana valley).

On this unstable ground, beeches are replaced by grassy and mossy vegetation dotted with shrubs. The layer of humus is irregular and very thin and only partly covers the blocks of white, angular, medium–sized limestone, rarely exceeding the size of 1 dm³.

The traps were placed 50 centimeters deep in a “C–type” horizon (sensu Juberthie et al. 1981), constituted mainly by stones of 5 cm³, not sealed by the ground and not welded, leaving numerous spaces between them and forming a layer several meters thick above the compact rock.

The other Coleoptera collected with sp. n. were Leiodidae, Cholevinae: Kellner, 1846, (Spence, 1813) (Catopini) and sp. (Leptodirini).

Some specimens of sp. n. were parasitized by an undetermined Ascomycete.

PageBreak sp. n. was not found in caves of the area north of Larraona (cueva de los Cristinos, cuevas de Erbeltz, Txintxoleze, Noriturri, Akuandi, del Queso, Iniriturri, Arleze, Laminatitur), suggesting that it is strictly located in MSS (CB personal observation).

Fairmaire, 1862

http://species-id.net/wiki/Trechus_brucki

Figs 7 14 27, 28 33

Figures 6–7.

Habitus of 6 sp. n. (Montagnon) and 7 (Jaout).

Figures 11–14.

Aedeagus in dorsal view of 11 (Cueva de San Adrián) 12 (Cueva de Mairuelegorreta) 13 sp. n. (Montagnon) and 14 (Lac d’Anglas). CP2, secondary copulatory piece.

Figure 33.

Lectotype and paralectotype of .

«Eaux–Bonnes, M. vom Bruck» (Fairmaire, 1862b). France, Pyrénées–Atlantiques.

Lectotype (MNHN), present designation: 1 ♂, labelled: «oblongulus Bonnes» [white rectangular label (ms, Fairmaire)], «Bruckii» [white rectangular label (ms, Fairmaire)], «MUSEUM PARIS Collection Léon Fairmaire 1906» [white rectangular label (printed)], «TYPE» [red rectangular label (printed)], «Lectotypus / Fairmaire / Faille, Bourdeau & / Fresneda des. 2012” [red rectangular label (printed)], genitalia dissected and mounted in a separate label pinned with the specimen. Paralectotype (MNHN): 1 ♀, same label data and pin as lectotype except “Paralectotypus / Fairmaire / Faille, Bourdeau & / Fresneda des. 2012” [red rectangular label (printed)].

Type series of Fairmaire, 1862.

Lectotype (MNHN), present designation: 1 ♀ (red dot), labelled: “oblongus” [white rectangular label (ms, Fairmaire)], “planiusculus” [white rectangular label (ms, Fairmaire)], “Bruckii” [white rectangular label (ms, Fairmaire)], “2203” [white rectangular label (ms, Fairmaire)], “MUSEUM PARIS Collection Léon Fairmaire 1906” [white rectangular label (printed)], “TYPE” [red rectangular label (printed)], “Lectotypus / Fairmaire / Faille, Bourdeau & / Fresneda des. 2012” [red rectangular label (printed)]. Paralectotypes (MNHN): 1 ♀, same label data and pin as lectotype except «Paralectotypus / Frm / Faille, Bourdeau & / Fresneda des. 2012” [red rectangular label (printed)]; 1 ♂, “H Pyrenees 1856 M. Pandellé” [white rectangular label (printed)], “Bruckii” [white rectangular label (ms, Fairmaire)], “COTYPE” [white and red rectangular label (printed)], “R. Jeannel Brucki Fr” [white rectangular label (ms, Jeannel)], “MUSEUM PARIS coll. R. JEANNEL 1931” [white rectangular label (printed)], “Paralectotypus / Frm / Faille, Bourdeau & / Fresneda des. 2012” [red rectangular label (printed)], genitalia dissected and mounted in a separate label pinned with the specimen.

Non Type material.

1 ♀ (MNHN) labelled: “planiusculus” [white rectangular label (ms, Fairmaire ?)], “Bruckii” [white rectangular label (ms, Fairmaire)], “MUSEUM PARIS Collection Léon Fairmaire 1906” [white rectangular label (printed)], “R. Jeannel Brucki Fr” [white rectangular label (ms, Jeannel)]. We do not consider this specimen as a syntype of as it is not labeled « oblongus » as the specimen of the type series, suggesting that the specimen arrived in the Fairmaire collection after the description of planiusculus. A second female specimen (MNHN) labelled: “oblongus Arrens” [white rectangular label (ms, Fairmaire)],PageBreak “TYPE” [white and red rectangular label (printed)], “MUSEUM PARIS Collection Léon Fairmaire 1906” [white rectangular label (printed)]. This specimen could be the reference specimen of Schaum, 1862. Reference of the name comes from Schaum (1862: addenda, p. 119): “P. 14 col. 2 Schaum;” only the name is mentioned, without any description, number of exemplars studied or locality. It should then be considered as nomen nudum. Jeannel (1927) indicates that is a synonym of with type locality: “Pyrén. occ.” We were unable to find the specimen or reference where Jeannel found the type locality.

Taxonomic comments

The study of specimens of from Orhy and of numerous exemplars of ,including types of the previously described subspecies of ,demonstrated that none of the characters quoted either by Colas and Gaudin (1935) or by Queinnec and Ollivier (2011) are constant. We consider then the subspecies pecoudi as synonymous of : Fairmaire, 1862 = Colas & Gaudin, 1935, syn. n.

and were described by Fairmaire in the volume of the Annales de la Société Entomologique de France of 1861 published in 1862 (Fairmaire, 1862b). As the name was already used for an American species (today Brullé, 1842), Fairmaire (1862a) changed the name of this species to . was considered synonymous with by Jeannel (1927), and, moreover, the name planiusculus was preoccupied as it was used by Costa (1858) in a work on Italian fauna. In his works on Trechini, Jeannel (1927, 1941) illustrated the genitalia of a male from the Ossau Valley. Recently, in a revision of the french fauna of Carabidae, Queinnec and Ollivier (2011) suggested that the drawing of Jeannel (1927, 1941) was incorrect, and that the male genitalia of has a homogeneous shape throughout the distribution area. By examining the types of Fairmaire, we noticed that the drawing of Jeannel (1927, 1941) does not actually match with . However, by studying specimens from Ossau Valley we found that the drawing of Jeannel actually corresponds to another undescribed species, very narrowly located in the area of Pic de Montagnon (Bielle–Pyrénées Atlantiques). Here we describe this new species as sp. n.

Faille, Bourdeau & Fresneda sp. n.

urn:lsid:zoobank.org:act:030DC2D3-4509-4877-8C21-9D83AA8563B5

http://species-id.net/wiki/Trechus_bruckoides

Figs 6 13 25, 26

France, Pyrénées Atlantiques, Ossau, Sède de Pan UTM (WGS 84): 30 T, X:704, Y:4768.

Holotype (MNHN): 1 ♂, France, Pyrénées Atlantiques, Ossau, Sède de Pan, labelled: «Ossau, Sède–Pan» [white rectangular label (printed)], «MUSEUM PARIS coll. R. JEANNEL 1931» [white rectangular label (printed)], «R. Jeannel Brucki Fr.» [white rectangular label (ms, Jeannel)], «Holotypus / sp. n. / Faille, Bourdeau & / Fresneda det. 2012” [red rectangular label (printed)], genitalia dissected and mounted in a separate label pinned with the specimen. Paratypes: 1 ♂, “Pic Montagnoü (v. d´Ossau) Mascaraux” [white rectangular label (ms)], “MUSEUM PARIS 1932 coll. Sainte–Claire Deville” [white rectangular label (printed)], “angusticollis Kiesw.” [white rectangular label (ms)] (MNHN); 1 ♂, “Pic Massibe B. PYR. 1938” [white rectangular label (ms)], “Trechus Brucki” [white rectangular label (ms)], “Collection H. Coiffait” [white rectangular label (printed)] (MNHN); 1 ♂, “Bielle/ B. Pyr.” “Trechus brucki/det. Tedeschi” “coll. Tedeschi/ZSM 2009” (ZSM); Pic Montagnon, 15–VII–1979, Bourdeau leg., 6 ♂♂ and 1 ♀ (CAF, CCB, CJF); Sède de Pan, Bielle, VII–1995, Bourdeau leg., 1 ♂ (CCB); Sède de Pan, Bielle, 2–VIII–1980, Bourdeau leg., 3 ♂♂ (CCB); Sède de Pan, Bielle, 10–VII–1981, Bourdeau leg., 1 ♂ and 2 ♀♀ (CCB). All the paratypes with the label “Paratypus / sp. n. / Faille, Bourdeau & / Fresneda det. 2012” [red rectangular label (printed)].

Supplementary specimen studied.

1 ♀, «Pied du pic Lauriolle près Bielle Bas. Pyr. 29.6.37», coll. Bonnaire (MNHN). Sède de Pan, Mascaraux, 2 exx. (coll. Nègre, MNHN). Pic Montagnon: 4 exx. Sède de Pan: 3 exx (MNHN). Sède de Pan, 23–6–1943, 1 ♂, 2 ♀♀ (MNHN, coll. Coiffait). Pic Massibe: VII–1941, 1 ♀ (MNHN, coll.Coiffait).

Large size (ca 4 mm) and round shape (Fig. 6). Median lobe of aedeagus slender, subparallel and decreasing in width from the apical tenth to the apex, which is softly curved in lateral view (Fig. 25), nearly symmetrical and with apex regularly rounded in dorsal view (Fig. 13). Endophallus with an elongate and well-sclerotized piece, forming a twisted gut. Characteristic secondary sclerotization of the sperm duct (Fig 25: CP2) present. External appearance very close to .

Habitus as in Fig. 6.Elongated, round–sided. Body surface with a very thin, hardly visible, dense microreticulation, no more distinguishable meshes on the head.

Colour. Dorsal surface dark brown, moderately shiny. Antennae, palpi and legs light brown.

Chetotaxy. Surface of elytra glabrous with the exception of a periscutellar seta, two discal setae on the third stria, four humeral setae, four setae along lateral margin and two preapical setae. Marginal setae of pronotum present, the anterior ones located at the first anterior third of the length.

Head. Eyes flat, well–developed, temples smaller than the length of eyes, strongly wrinkled to the neck. Frontal furrows moderately deep. Antennae short (2–2.3mm) and thick.

Pronotum. Proportions (M): WP/LP = 1.3, WP/WPB = 1.35, WP/WH = 1.34, WE/WP = 1.63. Transverse, with lateral margins bordered, wider in anterior part, much less wide than elytra. Posterior part much narrower than base of elytra. One seta in the marginal gutter at about a third of pronotum length, another one just beforePageBreak hind angle. Sides evenly rounded and straight just between hind angles and insertions of posterior setae. Hind angles well developed, right.

Elytra. Proportions (M): WE/LE = 0.64. Subrectangular, broadest after the mid–length; surface moderately convex, flattened on disc. Shoulders distinct but rounded. Striae almost impunctuate, sixth inner discal striae distinct, but reduced at apex and base, especially in callus area; seventh striae shallower, nearly indistinct, the eighth only distinct close to apex of elytra. Apical striola well impressed continuing the fifth stria.

Hind wings. Very reduced, not functional.

Male genitalia. Median lobe of aedeagus slender, in lateral view (Fig 25) basal third curved, central part straight, parallel and elongated towards apex. Nearly symmetrical in dorsal view (Fig 13). Parameres slender, each with 4 setae at tip. Inner sac of aedeagus armed with scales with an elongate well sclerotized piece, forming a twisted gut (Fig 26). Characteristic secondary sclerotization of the sperm duct forming a kind of second copulatory piece out of the base of the median lobe (Fig 25: CP2).

Not examined.

Mean length (4 exemplars): 4.78 mm (male).

The specific epithet refers to , species with which the new species was merged.

and sp. n. are externally very similar but strong differences isolate the two taxa especially in shape of male genitalia (Figs 25, 27). The aedeagus shape of sp. n. is exactly as indicated in Jeannel (1927, 1941) for .

sp. n. is only known from the calcareous plateau of Esturou located at 1860 m, north of Montagnon peak (1973 m) and Mailh Massibé (1973 m), at the northern extremity of the massifs separating Aspe and Ossau valleys (Fig. 37). South of this area (Sesques and Gaziès peaks (2600 m)), it is replaced by which occurs together with . During Pleistocene glacial cycles, this plateau was covered by a névé which shaped an area of sinks of nivo–karstic origin (Auly 2008). After winter, snow remains in these sinkholes (July–August) and allows the preservation of a nivicolous fauna, which is unusual at these medium altitudes. sp. n. lives exclusively in the masses of fallen rocks of sinkholes and follows the withdrawal of the snow. When the snow thaws it likely seeks refuge underground.

Figure 37.

Sinkhole area of the Plateau of Esturou (Hautes–Pyrénées, France).

This mid altitude nivicolous environment could have led to isolation of populations of the species from southern glaciated areas and glacial tongues of the northern slope of Ossau glacier and led to the differentiation of this population of cryophilic and highly hygrophilic . Such a hypothesis could also explain the presence of the hypogean Trechini Cabidoche, 1962, endemic to this karstic plateau (pits of Col d’Aran), and closely related to Jeannel, 1953, an endemic species of the Pierre Saint Martin massif, western to the Aspe Valley. Some other endemic nivicolous Carabidae with morphologically distinct populations occur in the area, like ( Audinet–Serville, 1821 (the population of Sède de Pan was first described as a distinct subspecies, Csiki, PageBreak1927), Audinet–Serville, 1821, Pupier, 2008, Jeannel, 1928 and (Dejean 1828). The peculiarities of this fauna suggest that this restricted area is an important center of diversification.

Discussion

The molecular phylogeny (Fig. 34) suggests a well–supported clade gathering the following species:

Figure 34.

Phylogram of of the brucki group obtained in RAxML, using the combined data matrix. Number in nodes: ML bootstrap (>50%) (see Material and Methods for details). In blue, the group sensu novo. In purple, group. In red: sp. n.

(Fig. 4), sp. n.(Fig. 1), (Fig. 2), (Fig. 7), (Fig. 5) and (Fig. 3). This result is in accordance with morphology: all the species of the clade share the aedeagal median lobe long and strongly curved just behind basal bulb, with terminal lamella well–developed. Moreover, the clade is supported by a strong synapomorphy: all the species share a strongly sclerotized part of the sperm duct, forming a second copulatory piece (Figs 15, 17, 19, 21, 23, 27: CP2). This synapomorphy is also present in sp. n.(Fig. 25). Consequently, molecular and morphological results allow us to define the group sensu novo: , sp. n., , sp. n., , and .

Figures 4–5.

Habitus of 4 (Cueva de San Adrián) and 5 (Cueva de Mairuelegorreta).

Figures 2–3.

Habitus of 2 (grotte de l´Eglise) and 3 (Orobe doline).

Two species, and , were included by Jeannel (1927) in the angusticollis group. and are provisionally not included in the group because of the absence of sclerotization of the sperm duct (CP2). Moreover, concerning , the apical hook is not a synapomorphy, as several other groups have this kind of hook (i.e. or the Tibetan species Schmidt, 2009 and Deuve, 1997). As expected by Dupré (1991) for some of the species that he included in a “bonvouloiri group”, the following regional species previously considered part of the brucki group are clearly excluded here: , , , , . Although not included in our analyses, we also exclude of the group , and , as those species were put into the uhagoni group because of close morphological affinities with and (Español 1970, Coiffait 1971, Dupré 1991). , which was said to be close to (Sciaky 1998), does not belong to the clade and is not clearly related with the clade. A study including more Iberian species should clarify its phylogenetic affinities. is excluded from the clade and shares strong affinities with .

Our molecular results as well as genital morphology, in dorsal and lateral view and shape of copulatory piece (Figs 10, 19, 20), suggest that could be considered a distinct species from . Morphological differences between the two species are the following:

– : aedeagus in dorsal view (Fig. 9) with subparallel sides, round apex with a short triangular tip; in lateral view (Fig. 17) basal third strongly rounded, medPageBreakian lobe slightly angular in the middle; apical hook with a thin tip. The copulatory piece is an asymmetrical gut slightly tapering and filled with a densely scaly area (Fig. 18).

– : aedeagus in dorsal view (Fig. 10) with the left side narrowed or sinuate from the middle to apex, the left side of apical quarter deeply narrowed, forming a long triangular tip; in lateral view (Fig. 19) only the basal quarter rounded, median lobe without dorsal angle in the middle, short with apical hook with massive tip. The copulatory piece is similar to the one of grenieri but the gut is parallel and shortened in its apical part (Fig. 20).

With 7 subspecies recognized in the last catalogues (Moravec et al 2003, Queinnec and Ollivier 2011), currently lives in humid forests (1000 m) from Espinal to Iraty (ssp. ruteri), then from Gave de Pau river (north side of Pic de Montaigu) to the Neste d’Aure valley (ssp. grenieri). From Aure valley to the Salat, it is replaced by the subspecies despaxi, which crosses the Garonne river near Saint Béat (Haute Garonne). An isolated subspecies (prepyrenaeus) was described by Coiffait in the high Arize valley (Andronne and Bosc forests around 1000 m) (Coiffait 1974). Along the axial ridge, lives above 1500 m from high Garonne valley (ssp. bepmalei) to Mont Valier (ssp. aulaensis Aubry, 1981). Study of numerous specimens suggests that and all the specimens of the subspecies ruteri are morphologically close, especially in the shape of the male genitalia, and should be considered as a distinct species. Moreover, we studied specimens from various localities of the Pyrenean range (see Distribution) and established that they share some morphological characters (color pale, brown, pronotum transverse with lateral margin regularly rounded, elytral striae superficial, weakly impressed) that justify keeping the status of ruteri as a subspecies of . The subspecies ruteri should then be considered as belonging to uhagoni, so that grenieri is restricted to the area between Gave de Pau and Ariège valley, northern slope of Pyrenees. n. comb. could be distinguished from by its color, usually paler brown, the pronotum transverse with lateral margin regularly rounded and the elytral striae superficial, weakly impressed. It is restricted to the western Pyrenees.

The study of specimens from the whole range of including all the subspecies, most of the types and material from intermediate localities (see distribution) leads us to conclude that the characters used to discriminate the subspecies (size, eyes size, shape of elytra and pronotum) are inconstant and overlapping between populations. The shape of the male genitalia is similar for all the populations between Gave de Pau and Ariège valley, including the one (ssp aulaensis) which was said to be different (Queinnec and Ollivier 2011). We consider then as a single species without any valid subspecies: Pandellé, 1867 = Jeannel, 1921 = Jeannel, 1922 = Aubry, 1981 = Coiffait, 1974,syn.n.

was described by Schaufuss (1863). The type series is located in the Schaufuss collection in the Museum für Naturkunde, Berlin (M. Jaeger pers. com.). was described by Jeannel (1920) from a cave of the Basque country, Cueva de Mairruelegorreta. Bolívar y Pieltain and Jeannel (1921) suggested that the peculiar morphology of the aedeagus of these two species indicates clear affinities with and PageBreak. Surprisingly, Jeannel (1927) in his Monographie des Trechinae considered that these two species belong to another group of species, the group. This opinion was followed by subsequent authors (Español 1965, Casale and Laneyrie 1982, Ortuño and Marcos 2003). However, and in accordance with the morphology of the median lobe of the aedeagus, molecular results support Bolívar y Pieltain and Jeannel’s (1921) point of view and confirm the close affinities between , and thespecies of the clade. Differences between the two species are weak: the apical part of the aedeagus is longer in (Fig. 12, 23) than in (Fig. 11, 21). The copulatory pieces are almost identical (Fig. 22, 24). is larger, with elytra more oval and elytral striae less impressed (Fig. 4); is smaller, narrower, and elongate with subparallel elytra and striae more impressed (Fig. 5).

and sp. n.do not have the peculiar hooked apex of the median lobe observed in the other species of the clade, but the apex is nevertheless strongly curved (Figs 25, 27).

The case of two further species remains doubtful: was included by its descriptor in the uhagoni group especially because of the structure of the aedeagus, with an apex with an apical hook (Fig. 31). However, the secondary sclerotization of the ejaculatory duct is lacking in this species and it is characterized by a homogenous elytral pubescence which is present in other species of the area (Ortuño and Jimenez–Valverde 2011), but lacking in all the species of the clade sensu novo. The presence of a hook at the apex of the aedeagus is also known in other Pyreneo–Cantabrian species like Jeanne, 1988, currently included in the group (Toribio 2001, Reboleira et al. 2010) or from Ariège. This character led its descriptor to include in the group. Queinnec and Ollivier (2011) included the species in the group. The species appears to be the sister species of (Fig. 34).

Finally, was included in the group by Jeannel (1927), but the shape of the median lobe of the aedeagus and the copulatory piece, that shares some similarities with the group, together with the lack of the sclerotization of spermiduct present in all the species of the group sensu novo, cast doubts on its real phylogenetic affinities.

The species of the clade are humicolous (grenieri, uhagoni), orophilous (grenieri, brucki, bruckoidessp. n.), or troglobitic/subterranean (bouilloni sp. n., pieltaini, beusti). We can notice a coincidence in the ecology of Trechini and Leptodirini with Basque–Pyrenean distribution: whereas the species are humicolous (or nivicolous for some Trechini) in the Pyrenees, the species occurring in the Basque country are mainly hypogean (Salgado et al. 2008, Ribera et al. 2010).

Biogeography of the clade

If we use the standard mitochondrial mutation rate for insects of 2.3% divergence per Myr (0.0115 substitutions ⁄ site ⁄ Myr) (Brower 1994, Papadopoulou et al. 2010, Pons et al. 2010, Ribera et al. 2010), the isolation between the and group seems to have occurred at the end of the Pliocene (Faille et al. 2011a). Pliocene climate was much warmer than the Present (Uriarte 2003): the interval between 3.3 Myr to 3 Myr was called , with an average temperature of about 3°C higher than at present and an annual average precipitation between 400 to 1000 mm higher than present. The transition to the Pleistocene (ca 2.7 Myr) is marked by the onset of marked climatic variability; the radiation of the clade occured during the Pleistocene, following the rhythm of alternations of cold, warm/humid and dry periods that led to changes in biome composition (Salzmann et al. 2008).

Strong erosion leading to a deep excavation of Pyrenean valleys associated with climate variations led to the dispersal and diversification of the brucki clade. The main events are (Barrère 1963, Campos 1979, Serrat and Ventura 1993, Calvet 2004):

1. Persistence of the Ebro depression between the Basque–Pyrenean area and the Iberian central plateau. The persistence of the Ebro salty basin from the late Oligocene (25 Ma) until the late Miocene (6 Ma) isolated groups with an Iberian distribution from those with a Pyrenean or Basque–Pyrenean distribution. This flat and shallow lagoon area received the tributaries of the Ebro river, from Reinosa to the Mediterranean Sea.

2. Impact of Quaternary erosion on karst fragmentation. On the northern slope, the folds which have an east–west orientation are narrow and divided by north–south valleys. On the southern slope, orogenesis caused the formation of two folds with an east–west orientation (internal and external “sierras”) parallel to the axial chain. Similarly, Quaternary erosion separated these sierras by narrow north–south valleys. Near the Atlantic, these “sierras” meet with Basque folds which have a complex north–west/south–east orientation, divided by narrow north–south valleys, from Bilbao to Alsasua. Between Vitoria and Pamplona, these Basque “sierras” are separated by the Pre–pyrenean middle depression, a broad valley excavated by the Zadorra (westward) and Arakil (eastward) rivers (Fig 35). These rivers flow into the Ebro Basin, separating the northern massifs of Aralar, Urquilla and Gorbea from the southern Sierra of Urbasa–Andía. The hydrographic system was set mainly by significant erosion due to numerous glaciation cycles during the Pleistocene (2.5 Ma).

Our molecular study suggests that the brucki lineage could have originated in the area delimited by the northern sierras of Gorbea and Urquilla and the edge of the sierra de Andía. The sierras de Andía, Urbasa and Entzia form the exact border between the hypogean fauna of the Pyrenees and Iberia. North of this limit occur sp. n., Jeannel, 1919 (Carabidae, Pterostichini) –Urbasa–Andía–Entzia, Aralar, Ernio and Pagoeta massifs, between the Deba and Urola rivers (Ortuño et al. 2010)–, (Español, 1948), Bathysciola rugosa (Sharp, 1873), –Leiodidae, Cholevinae, Leptodirini which also belong to a clade of Basque–Pyrenean distribution (Ribera et al. 2010)– whereas south of this area (Sierras de la Demanda and Lóquiz, surrounding the Ebro basin) is characterized by a lack of Leptodirini and . The only cave Coleoptera is (Basaula cave in Baríndano, south of Urbasa). Putzeys, 1870 is a model of Iberian extensive distribution: it is widespread in the Iberian Peninsula, from Algarve in Portugal PageBreakto Cantabria, Iberian Central System and the pre–pyrenean massif of Guara in Spain (Jeanne and Zaballos 1986, Zaballos and Jeanne 1994, Serrano 2003). This species is known to have separated early from sensu stricto (Faille et al. 2010a, 2011a).

sp. n. has a subterranean lifestyle among the scree–covered northern slope (900 m) of Sierra de Andía, whereas the type locality of is the Orobe doline (700 m), located at the eastern limit of Sierra de Urquilla. Early Pleistocene climate variations could have led to drastic changes in biome composition, limiting dispersal possibilities and leading to the isolation of the population of sp. n. (potentially forestal), south of the Arakil River. One hypothesis could be that the hygrophilous species were colonizing high altitude or hypogean habitats during interglaciar warming as observed in other species of Coleoptera (Hernando et al. 1999, Faille et al. 2011b). These climate fluctuations might also have led to the western subterranean colonization of the two hypogean species, (Sierra de Urquilla) and (Sierra de Gorbea) while the group colonized the Pyrenean chain and diversified in numerous forms living in humid forests and alpine zones, from the Iraty Valley to the Ariège Basin. Migration toward East could have been possible along the small sierras of Tajonar and Labia, which link the Basque Mountains to the Pyrenees.

lives in the alpine zone (above 1700 m) of the axial ridge from Pic d´Orhy to Col du Pourtalet, in the high Ossau Valley. On the north ridge, can be encountered in the same biotopes, near snow tongues melting on scree-covered slopes, from Aspe to Gave de Pau Valleys. As for and , both are mainly forestal and occur at lower altitude except for in the eastern part of the range (Mount Valier area). The Ariège Valley is the eastern limit of the group.

The distribution area of the group coincides with the one of the Basque–Pyrenean Leptodirini clade (Fig 35). In the Pyrenees, both groups are made up of forestal, endogean, humicolous, lapidicolous or orophilous, but not hypogean, species. It is only in Basque relief, the western part of their distribution, that both groups include subterranean species. Regarding Leptodirini, the basal group of the Basque–Pyrenean clade is the group (endogean/humicolous elements); its distribution area is extended from Ariège, Fresneda & Fery, 2009 (France: Haute–Garonne and Ariège; Spain: Val d’Aran) to the Basque relief, Bolívar, 1921 in Peña Gorbea or (Sharp, 1873) in Sierra de Urbasa and Urquilla. A high degree of troglobiomorphy is only found in some hypogean species of the Basque area: Español, 1972 (basin of Deba River), Jeannel, 1919 (Aralar, Urbasa/Andía and Baztan Valley), Bellés & Déliot, 1983 (Ernio and Aralar massifs), Fresneda & Dupré, 2010 (Kintoa Massif) and Jeannel, 1919 (between the Urola and Orio Rivers). In the Pyrenees, the species of the clade are epigean, forestal (, ) or orophilous(, sp. n.). Pyrenean speciation events in the group are more recent and are probably closely related to late Pleistocene climatic changes, as already observed in alpine (Lohse et al. 2011). Troglobiomorphic features (depigmentation, microphthalmy) only occur in the hypogean and , both of them located in the Basque area. The two other species of this geographical area are located in wetPageBreak and cold dolines () or subterranean environments ( sp. n.). Their general appearance (pigmented, well–developed eyes), similar to other epigean species, could be an indication of the recent colonization of this reduced habitat.

Distribution map of group and related species. Material studied: symbols with cross.