Literature DB >> 22936866

Description of a new species of coral-inhabiting barnacle, Darwiniella angularis sp. n. (Cirripedia, Pyrgomatidae) from Taiwan.

Yi-Yang Chen1, Hsiu-Chin Lin, Benny K K Chan.   

Abstract

The present study has identified a new species from the previously monotypic genus Darwiniella Anderson, 1992. Darwiniella angularissp. n. is similar to Darwiniella conjugatum (Darwin, 1854) in external shell morphology and arthropodal characters. Darwiniella conjugatum, however, has a sharper tergal spur and a less obvious adductor plate angle when compared to Darwiniella angularissp. n. Molecular analyses on mitochondrial DNA 12S rDNA and COI regions also support the morphological differences. Sequence divergences in 12S rDNA and COI between Darwiniella conjugatum and Darwiniella angularissp. n. are 5% and 13% respectively, which are equivalent to the inter-specific sequence divergences in other barnacles. Both Darwiniella species are common on Cyphastrea Milne-Edwards and Haime, 1848 corals and Darwiniella angularissp. n. is also collected from Astreopora de Blainville, 1830 corals in Taiwan.

Entities:  

Keywords:  Barnacles; Corals; Pyrgomatidae; Symbiosis; cryptic diversity; host-specificity

Year:  2012        PMID: 22936866      PMCID: PMC3426880          DOI: 10.3897/zookeys.214.3291

Source DB:  PubMed          Journal:  Zookeys        ISSN: 1313-2970            Impact factor:   1.546


Introduction

The coral-inhabiting barnacles of the genus Anderson, 1992 is a member of the family Pyrgomatidae, which has a symbiotic relationship with host corals. was considered to be a monotypic genus, represented by (Darwin, 1854). was originally described by Darwin (1854) as . The species has a fused shell wall and a pair of fused opercular plates (scutum and tergum). Ross and Newman (1973) erected the genus to accommodate coral-inhabiting barnacles with fused shell plates and fused opercular valves, thus transferred to . However, has a deep adductor plate and a distinct tergal spur, which is different from all species. Subsequently, Anderson (1992) erected the new genus to accommodate and defined the genus as “ Wall flat, fused; sheath occupying about half inner wall; scutum and tergum calcified together, without visible line of juncture; deep adductor plate and conspicuous rostral tooth; elongate spur; basis oval, deep.” However, Anderson (1992) had not formally assigned the type species of and Ross (1999) designated the type species of as (Darwin, 1854). In the present study, we collected a large number of specimens from coral reefs in Taiwan. Based on molecular analysis of the mitochondrial 12S rDNA (12S) and DNA barcode gene fragment (COI), we revealed two species of , and an undescribed species. We used scanning electron microscopy (SEM) to examine the shell parts and light microscopy (LM) to examine the arthropodal characters of and the sp. n. and both species were described herein from Taiwan.

Materials and methods

Specimen sampling and morphological analysis

Sampling of specimens was conducted at the main island of Taiwan (Suao and Kenting) and outlying islands (Turtle Island, Green Island and Siaoliouciou Island; see Fig. 1 and on-line Appendix 1: Table 1 for site and location details). Small pieces of coral with barnacles embedded were collected with hammers and chisels at 5–20 m depth by SCUBA diving. All barnacles and host corals were preserved in 95% EtOH. Type and paratype specimens are stored in the National Museum of Natural Science, Taichung, Taiwan (NMNS) and the Biodiversity Museum of the Academia Sinica, Taipei, Taiwan (ASIZCR), and additional specimens in the barnacle collections in the Coastal Ecology Laboratory, Academia Sinica, Taiwan (CEL). Barnacles were isolated from the host corals using forceps and the morphological characters of shell parts (shells, scutum and tergum) and somaticPageBreak bodies (6 pairs of cirri, penis and oral cone) were examined. Organic debris and coral tissue on the surface of shells, scutum and tergum were removed with forceps and further cleaned ultrasonically (2–5 seconds). Cleaned shells and opercular PageBreakvalves (scutum and tergum) were immersed in 1.5% bleach for about five hours to completely digest organic tissue and the shells were rinsed by slow running purified water (30 minutes) and air-dried. The shells, scutum and tergum were gold coated and observed under SEM, following the methods of Achituv et al. (2009). Cirri, penis and oral cone were dissected from the somatic bodies and examined under LM (Zeiss Scope A1) with high definition lenses (Zeiss Plan APOChromat 40X/0.95 and ZEISS Plan APO Chromat 100x/1.4 oil), which allowed clear observation of setal types on cirri and mouth parts. Setal descriptions follow Chan et al. (2008).
Figure 1.

Collection sites of coral-inhabiting barnacle in Taiwan.

Collection sites of coral-inhabiting barnacle in Taiwan.

Molecular analysis

Total genomic DNA was extracted from soft tissue of 110 specimens using Qiagen (Chatsworth, CA) QIAquick Tissue Kit following the manufacturer’s instructions. Partial sequences of mitochondrial genes 12S rDNA (12S) and cytochrome c oxidase subunit I (COI) were amplified by polymerase chain reaction (PCR) with primers 12S-FB and 12S-R2 (Tsang et al. 2009), and COI-F5 5’ AAACCTATAGCCTTCAAAGCT 3’ and COI-R4 5’ GTATCHACRTCYATWCCTACHG 3’, respectively. The PCR solution contained 40 ng of template DNA, 5 μl Taq DNA Polymerase Master Mix (1.5 mM MgCl2; Ampliqon, Denmark), 1 μM of each primer, and ddH2O with a final volume of 10 μl. The PCR reaction was conducted under the following conditions: 2 min at 95°C for initial denaturing, 35 cycles of 30 sec at 95°C, 1 min at 48°C, 1 min at 72°C with a final extension for 5 min at 72°C. The PCR products were then purified using the DNA Gel purification kit (Tri-I Biotech, Taipei, Taiwan). Direct sequencing of the purified PCR products was performed on an ABI 3730XL Genetic Analyzer with BigDye terminator cycle sequencing reagents (Applied Biosystems, Foster City, California, USA). Sequences were then aligned with CLUSTAL X (Thompson et al. 1997) using default settings and adjusted by eye in MacClade 4.07 (Maddison and Maddison 2005). The genealogical relationships of specimens based on 12S and COI were inferred using K2P model and 1000-replicate Neighbor-Joining (NJ) method implemented in MEGA v5.05 (Tamura et al. 2011). Two specimens of coral barnacle Ross & Newman, 1973 (GenBank accession numbers 12S: JQ946198, JQ946212; COI: JQ946237, JQ946244) were applied as the outgroup. The evolutionary distance (number of base differences per site) between sequence pairs were calculated with uncorrected p-distance and Kimura-2-parameter (K2P) models by MEGA.

Results

Systematics. Suborder Balanomorpha Pilsbry, 1916. Family Pyrgomatidae Gray, 1825. Subfamily Pyrgomatinae Gray, 1825. Genus Anderson, 1992

sp. n.

urn:lsid:zoobank.org:act:FF17801C-71BB-4B1C-BF4B-F20AB02733B7 http://species-id.net/wiki/Darwiniella_angularis Figures 2 –9
Figure 2.

Hard parts of sp. n. A Dorsal view of shell (NMNS-6878-001) B Ventral view of shell (NMNS-6878-001) C Dorsal view of fused scutum and tergum (NMNS-6878-001) D Ventral view of fused scutum and tergum (NMNS-6878-001) E Dorsal view of fused scutum and tergum (ASIZCR000203) F Ventral view of fused scutum and tergum (ASIZCR000203) G Dorsal view of fused scutum and tergum (additional individual, CEL-RYU-13-3) H Ventral view of fused scutum and tergum (additional individual, CEL-RYU-13-3). (AP: adductor plate, AA: adductor plate angle, SP: spur, scale bar: μm). Note the AA and SP of sp. n. distinguish it from (Darwin, 1854) (see Figure 10).

Figure 3.

Oral cone of sp. n. A Maxilla (NMNS-6878-001) B Serrulate setae on apex C Serrulate setae on inferior margin D Maxillule (NMNS-6878-001) E Simple setae on posterior margin F Large simple setae on cutting edge G Maxillule (additional specimen, ASIZCR000202) H Maxillule (additional specimen, CEL-TI-9-10). (scale bar: μm)

Figure 4.

Oral cone of sp. n. A Mandible (NMNS-6878-001) B Bidentate second tooth C Inferior angle with simple seta D Mandible (additional specimen, ASIZCR000202) E Inferior angle with simple seta F Mandible (additional specimen, CEL-TI-9-10) G Inferior angle with simple seta H Mandible (additional specimen, ASIZCR000204). (scale bar: μm)

Figure 5.

Oral cone of sp. n. A Mandibular palp (NMNS-6878-001) B Serrulate setae on inferior margin C Serrulate setae distally D Labrum (NMNS-6878-001) E Teeth on labrum F Teeth on labrum G Labrum (additional specimen, CEL-TI-9-10) H Labrum (additional specimen, ASIZCR000202). (scale bar: μm)

Figure 6.

Line drawing of sp. n. A Cirrus I B Cirrus II C Cirrus III D Cirrus IV E Cirrus V F Cirrus VI. (scale bar: μm)

Figure 7.

Cirri of sp. n. A Cirrus I (NMNS-6878-001) B Serrulate setae on anterior ramus C Serrulate setae on anterior ramus apex D Serrulate setae on posterior ramus apex E  Cirrus II (CEL-TI-1-7) F Serrulate setae on posterior ramus G Serrulate setae on anterior ramus apex H Serrulate setae on posterior ramus base. (scale bar: μm)

Figure 8.

Cirri of sp. n. A Cirrus III (NMNS-6878-001) B Serrulate setae on anterior ramus C Serrulate setae distally D Serrulate setae on posterior ramus E Cirrus IV (NMNS-6878-001) F Intermediate segment with 4 pairs of serrulate setae G Intermediate segment with serrulate setae H Serrulate setae distally. (scale bar: μm)

Figure 9.

Cirri and penis of sp. n. A Cirrus V (NMNS-6878-001) B Serrulate setae on apex C Intermediate segment with 4 pairs of serrulate setae D Cirrus VI (NMNS-6878-001) E  Serrulate setae distally F Intermediate segment with 4 pairs of serrulate setae G Penis (CEL-TI-9-10) H Basi-dorsal point of penis I Apex of penis. (scale bar: μm)

Material examined.

HOLOTYPE. NMNS-6878-001, Lobster Cave, Siaoliouciou Island, Taiwan (22°20'N, 120°23'E), August 2010, coll. B.K.K. Chan, on host coral sp. PARATYPES. ASIZCR000202, Turtle Tail, Turtle Island, Taiwan (24°50'N, 121°56'E), October 2010, coll. B.K.K. Chan, on coral host (Forskål, 1775). ASIZCR000204, data same as ASIZCR000202. CEL-RYU-13-2 and CEL-RYU-13-3 data same as holotype. CEL-TI-1-7, CEL-TI-5-6, and CEL-TI-9-10 data same as paratype ASIZCR000202.

Diagnosis.

Scutum triangular, rostral tooth and obvious adductor plate present, basal margin of adductor plate forming obvious angle. Tergum trapezoid, spur triangular, medial furrow curved.

Description.

(Type specimen: 6 mm in basal diameter, rostro-carinal diameter to 5.2 mm). Shell plates fully fused, purple, oval, externally surface with about 24 strip-like projections radiating from subcentral orifice to shell plate margin (Fig. 2A). Bases of shell with about 27 internal ribs radiating from rim of inner operculum (Fig. 2B). Orifice oval, long, narrow, about 1/3 length of rostro-carinal diameter. Hard parts of sp. n. A Dorsal view of shell (NMNS-6878-001) B Ventral view of shell (NMNS-6878-001) C Dorsal view of fused scutum and tergum (NMNS-6878-001) D Ventral view of fused scutum and tergum (NMNS-6878-001) E Dorsal view of fused scutum and tergum (ASIZCR000203) F Ventral view of fused scutum and tergum (ASIZCR000203) G Dorsal view of fused scutum and tergum (additional individual, CEL-RYU-13-3) H Ventral view of fused scutum and tergum (additional individual, CEL-RYU-13-3). (AP: adductor plate, AA: adductor plate angle, SP: spur, scale bar: μm). Note the AA and SP of sp. n. distinguish it from (Darwin, 1854) (see Figure 10). Scutum and tergum white, fused without junctions (consistent through 3 specimens, Fig. 2C–H). Scutum triangular, width equal to height, occludent margin slightly curved, rostral tooth basally, 15 teeth along ventral surface of occludent margin, tooth size increasing gradually from apex to base. Ventral view with oval-shaped adductor muscle scar (Fig. 2D, F, H). Dorsal view with obvious adductor plate, convex, extending below basal margin of scutum, plate about 3/5 height of scutum, basal margin with obvious angle (Fig. 2C, E, G). Dorsal surface with horizontal striations, striations with row of small pores. Tergum trapezoid, lateral depressor muscle crests present. Spur triangular, blunt, curved, height reaching more than 1/2 height of tergum, basal margin not obvious due to curved spur. Dorsal surface with medial furrow, curving from basal margin towards the carinal margin (Fig. 2C, E, G). Dorsal surface with horizontal striations, striations with row of small pores. Maxilla bilobed (Fig. 3A), serrulate setae distally (Fig. 3C) and along inferior margin (Fig. 3B). Maxillule cutting edge straight, without notch, bearing row of 7 large PageBreakPageBreakPageBreakPageBreakPageBreakand 3 smaller setae (Fig. 3D). Region close to cutting edge with dense fine simple setae (Fig. 3F), anterior and posterior margins with long simple setae (Fig. 3E). Mandible with 4 or 5 teeth, excluding inferior angle (inconsistent in 4 specimens, Fig. 4A, D, F, H). Second, third and fourth teeth bidentate (Fig. 4B), the first 3 teeth occupying PageBreakPageBreakPageBreakPageBreakmost of length of cutting edge. Lateral surface, lower margin and cutting edge of mandible bearing simple setae. Lower margin short, about 1/16 length of mandible, inferior angle ending in blunt angle with dense, fine setae (Fig. 4C, E, G). Mandibular palp rectangular, elongated (Fig. 5A), bearing serrulate setae distally (Fig. 5C) and inferior margin (Fig. 5B). Labrum bilobed, V-shaped notch between lobes, no or 2 sharp teeth on each side of notch (inconsistent in three specimens, Fig. 5D, G, H). Oral cone of sp. n. A Maxilla (NMNS-6878-001) B Serrulate setae on apex C Serrulate setae on inferior margin D Maxillule (NMNS-6878-001) E Simple setae on posterior margin F Large simple setae on cutting edge G Maxillule (additional specimen, ASIZCR000202) H Maxillule (additional specimen, CEL-TI-9-10). (scale bar: μm) Oral cone of sp. n. A Mandible (NMNS-6878-001) B Bidentate second tooth C Inferior angle with simple seta D Mandible (additional specimen, ASIZCR000202) E Inferior angle with simple seta F Mandible (additional specimen, CEL-TI-9-10) G Inferior angle with simple seta H Mandible (additional specimen, ASIZCR000204). (scale bar: μm) Oral cone of sp. n. A Mandibular palp (NMNS-6878-001) B Serrulate setae on inferior margin C Serrulate setae distally D Labrum (NMNS-6878-001) E Teeth on labrum F Teeth on labrum G Labrum (additional specimen, CEL-TI-9-10) H Labrum (additional specimen, ASIZCR000202). (scale bar: μm) Cirrus I with rami unequal, anterior ramus long, slender, 14-segmented, posterior ramus 6-segmented (Figs 6A, 7A), bearing serrulate setae (Fig. 7B, C, D). Cirrus II with rami subequal, both 7-segmented (Figs 6B, 7E), bearing serrulate setae (Fig. 7F, G, H). Cirrus III with rami subequal, anterior ramus 8-segmented, posterior ramus 7-segmented (Figs 6C, 8A), bearing serrulate setae (Fig. 8B, C, D). Cirri IV–VI long, slender, rami equal. Cirrus IV with anterior ramus16-segmented, posterior 15-segmented, Cirrus V (anterior 21-segmented, posterior 19-segmented), Cirrus VI (anterior 22-segmented, posterior 21-segmented) (Figs 6D, E, F, 8E, 9A, D). Intermediate segments of Cirri IV–VI with 4 pairs of serrulate setae (Figs 8F, 9C, F), distal pair longest, proximal pair shortest. Line drawing of sp. n. A Cirrus I B Cirrus II C Cirrus III D Cirrus IV E Cirrus V F Cirrus VI. (scale bar: μm) Cirri of sp. n. A Cirrus I (NMNS-6878-001) B Serrulate setae on anterior ramus C Serrulate setae on anterior ramus apex D Serrulate setae on posterior ramus apex E  Cirrus II (CEL-TI-1-7) F Serrulate setae on posterior ramus G Serrulate setae on anterior ramus apex H Serrulate setae on posterior ramus base. (scale bar: μm) Cirri of sp. n. A Cirrus III (NMNS-6878-001) B Serrulate setae on anterior ramus C Serrulate setae distally D Serrulate setae on posterior ramus E Cirrus IV (NMNS-6878-001) F Intermediate segment with 4 pairs of serrulate setae G Intermediate segment with serrulate setae H Serrulate setae distally. (scale bar: μm) Cirri and penis of sp. n. A Cirrus V (NMNS-6878-001) B Serrulate setae on apex C Intermediate segment with 4 pairs of serrulate setae D Cirrus VI (NMNS-6878-001) E  Serrulate setae distally F Intermediate segment with 4 pairs of serrulate setae G Penis (CEL-TI-9-10) H Basi-dorsal point of penis I Apex of penis. (scale bar: μm) Penis long (1.9 times length of Cirrus VI), annulated, some dark spots present, scattered short simple setae (Fig. 9G). Pedicel with basidorsal point (Fig. 9G, H), apex bearing short simple setae (Fig. 9I).

Distribution.

At present only recorded from Taiwan.

Etymology.

The name angularis denotes the presences of the obvious adductor plate angle, which is a diagnostic character of this species.

Remarks.

External shell morphology and arthropodal characters of sp. n. are similar to . However, has an obvious adductor plate angle, whereas that of is less obvious (see description below). also has a sharper spur angle than - mean ± 1 SD of the spur angle (from 10 specimens) reaching 23.6 ± 4.8o in and 32 ± 4.6o in , which is significantly different between the two species using the t-test (t value: -4.3, df = 18, p <0.05).

(Darwin, 1854) http://species-id.net/wiki/Darwiniella_conjugatum Figs 10 –17
Figure 10.

Hard parts of (Darwin, 1854) (CEL-RYU-28-1, CEL-RYU-47-4, CEL-RYU-170-1) A Dorsal view of shell B Ventral view of shell C Dorsal view of fused scutum and tergum D Ventral view of fused scutum and tergum E Horizontal striations on dorsal surface of scutum F Occludent margin base and rostral tooth. (AP: adductor plate, AA: adductor plate angle, SP: spur, scale bar: μm)

Figure 11.

Oral cone of (Darwin, 1854) A Maxilla (CEL-RYU-28-2) B Serrulate setae on apex C Serrulate setae on inferior margin D Maxillule (CEL-RYU-28-2) E Large simple type setae on cutting edge F Maxillule (additional specimen, CEL-RYU-28-1) G Maxillule (additional specimen, CEL-RYU-38-4) H Maxillule (additional specimen, CEL-RYU-66-1). (scale bar: μm)

Figure 12.

Oral cone of (Darwin, 1854) A Mandible (CEL-RYU-28-1) B Bidentate second tooth C Bidentate third and fourth tooth D Inferior angle with simple type seta E  Mandible (additional specimen, CEL-RYU-170-1) F Mandible (additional specimen, CEL-RYU-66-1) G Mandible (additional specimen, CEL-RYU-38-4) H Mandible (additional specimen, CEL-RYU-28-2). (scale bar: μm)

Figure 13.

Oral cone of (Darwin, 1854) A Mandibular palp (CEL-RYU-66-1) B Serrulate setae distally C Serrulate setae on inferior margin D Labrum (CEL-RYU-38-4) E Teeth on labrum F Teeth on labrum G Labrum (additional specimen, CEL-RYU-66-1) H Labrum (additional specimen, CEL-RYU-28-1). (scale bar: μm)

Figure 14.

Line drawing of (Darwin, 1854) A Cirrus I B Cirrus II C Cirrus III D Cirrus IV E Cirrus V F Cirrus VI. (scale bar: μm).

Figure 15.

Cirri of (Darwin, 1854) A Cirrus I (CEL-RYU-28-2) B Serrulate setae on anterior ramus apex C Serrulate setae on anterior ramus D Serrulate setae on posterior ramus apex E Cirrus II (CEL-RYU-28-2) F Serrulate setae on anterior ramus apex G Serrulate setae on anterior ramus H Serrulate setae on posterior ramus apex. (scale bar: μm)

Figure 16.

Cirri of (Darwin, 1854) A Cirrus III (CEL-RYU-28-2) B Serrulate setae on posterior ramus C Serrulate setae on posterior ramus D Serrulate setae distally E Cirrus IV (CEL-RYU-28-2) F Serrulate setae on apex G Intermediate segment with 4 pairs of serrulate setae H Intermediate segment with serrulate setae. (scale bar: μm)

Figure 17.

Cirri and penis of (Darwin, 1854) A Cirrus V (CEL-RYU-28-2) B Serrulate setae on apex C Cirrus VI (CEL-RYU-28-2) D Intermediate segment with 4 pairs of serrulate setae E Intermediate segment with 4 pairs of serrulate setae F Serrulate setae on apex G Penis (CEL-RYU-170-1) H apex of penis I Basidorsal point of penis. (scale bar: μm)

Pyrgoma conjugatum Pyrgoma (Nobia) conjugatum Nobia conjugatum Nobia conjugata Ogawa and Matsuzaki 1992: app. tab. Darwiniella conjugatum Darwiniella conjugata

Materials examined.

CEL-RYU-28-1, Dafu Fishing Harbor, Siaoliouciou Island, Taiwan (22°20'N, 120°22'E), August 2010, coll. B.K.K. Chan, on coral host (Forskål, 1775). CEL-RYU-28-2 data same as CEL-RYU-28-1. CEL-RYU-38-4, Shanfu Fishing Harbor, Siaoliouciou Island, Taiwan (22°21'N, 120°21'E), August 2010, coll. B.K.K. Chan, on coral host . CEL-RYU-47-4 data same as CEL-RYU-38-4. CEL-RYU-66-1, Lobster Cave, Siaoliouciou Island, Taiwan (22°20'N, 120°23'E), August 2010, coll. B.K.K. Chan, on host coral sp.. CEL-RYU-170-1, Shanfu Fishing Harbor, Siaoliouciou Island, Taiwan (22°21'N, 120°21'E), August 2010, coll. B.K.K. Chan, on coral host . Scutum subtriangular, rostral tooth and obvious adductor plate present. Adductor plate angle not obvious. Tergum subtriangular, lateral depressor muscle crests, medial furrow and spur present. Spur triangular, long, curved and sharp. Shell (8 mm in maximum basal diameter, rostro-carinal diameter to 6 mm) plates fully fused, purple, oval, externally surface with about 25 strip-like projections differing in length and radiating from nearly subcentral orifice to plate margin (Fig. 10A). Bases of shell with about 27 internal ribs radiating from the rim of the inner operculum to the basal margin of the shells (Fig. 10B). Orifice oval, long and narrow, about 3/8 length of rostro-carinal diameter. Hard parts of (Darwin, 1854) (CEL-RYU-28-1, CEL-RYU-47-4, CEL-RYU-170-1) A Dorsal view of shell B Ventral view of shell C Dorsal view of fused scutum and tergum D Ventral view of fused scutum and tergum E Horizontal striations on dorsal surface of scutum F Occludent margin base and rostral tooth. (AP: adductor plate, AA: adductor plate angle, SP: spur, scale bar: μm) Scutum and tergum white, fused without any junctions (Fig. 10C, D). Scutum subtriangular, width 1.5 times length of height, occludent margin slightly curved, with a rostral tooth on bottom (Fig. 10F) and continuous teeth along the ventral surface of occludent margin, tooth size increasing gradually from apex to base. Ventral view with an apparent oval-shaped adductor muscle scar (Fig. 10D). Dorsal view with obvious adductor plate, extending below basal margin, plate more than 1/2 height of scutum. Basal margin of adductor plate without obvious adductor plate angle (Fig. 10C). Dorsal surface of scutum with horizontal striations, striations with row of small pores (Fig. 10E). Tergum subtriangular, lateral depressor muscle crests present. Spur triangular, long, curved and sharp, height reaching more than 1/2 height of tergum, basal margin not obvious due to the curved spur. Dorsal surface with medial furrow, curving from basal margin towards the carinal margin of tergum, width of furrow increased gradually from apex to base (Fig. 10C). Dorsal surface with horizontal striations, striations with row of small pores. Maxilla oval (Fig. 11A), serrulate setae distally (Fig. 11B) and along inferior margin (Fig. 11C). Maxillule cutting edge straight, without notch, bearing row of 13 large, similar sized setae (consistent through 2 specimens, Fig. 11D, F, and incoPageBreakPageBreakPageBreakPageBreakPageBreaknsistent through 2 specimens with 11 and 9 large setae, Fig. 11G, H, respectively). Region close to cutting edge with dense fine simple type setae (Fig. 11E), anterior and posterior margin with long simple type setae. Mandible with five teeth (excluding inferior angle) (teeth number consistent in five specimens but differed in morphologies, Fig. 12A, E, F, G, H). Second, third, fourth and fifth teeth bidentated (Fig. 12B, C), the first 4 teeth occupying most of length of cutting edge. Lateral surface, lower margin and cutting edge of mandible bearing simple type setae. Lower margin short, about 1/20 length of total length of mandible, inferior angle ending in a blunt angle PageBreakPageBreakPageBreakPageBreakwith dense, fine setae (Fig. 12D). Mandibular palp rectangular, elongated (Fig. 13A), bearing serrulate setae distally (Fig. 13B) and on inferior margin (Fig. 13C). Labrum bilobed, with V-shaped notch between 2 lobes, 2 sharp teeth on each side of notch (inconsistent in three specimens, Fig. 13D, G, H). Oral cone of (Darwin, 1854) A Maxilla (CEL-RYU-28-2) B Serrulate setae on apex C Serrulate setae on inferior margin D Maxillule (CEL-RYU-28-2) E Large simple type setae on cutting edge F Maxillule (additional specimen, CEL-RYU-28-1) G Maxillule (additional specimen, CEL-RYU-38-4) H Maxillule (additional specimen, CEL-RYU-66-1). (scale bar: μm) Oral cone of (Darwin, 1854) A Mandible (CEL-RYU-28-1) B Bidentate second tooth C Bidentate third and fourth tooth D Inferior angle with simple type seta E  Mandible (additional specimen, CEL-RYU-170-1) F Mandible (additional specimen, CEL-RYU-66-1) G Mandible (additional specimen, CEL-RYU-38-4) H Mandible (additional specimen, CEL-RYU-28-2). (scale bar: μm) Oral cone of (Darwin, 1854) A Mandibular palp (CEL-RYU-66-1) B Serrulate setae distally C Serrulate setae on inferior margin D Labrum (CEL-RYU-38-4) E Teeth on labrum F Teeth on labrum G Labrum (additional specimen, CEL-RYU-66-1) H Labrum (additional specimen, CEL-RYU-28-1). (scale bar: μm) Cirrus I with rami unequal, anterior ramus long and slender, with 17-segmented, posterior ramus 7-segmented (Figs 14A, 15A), bearing serrulate setae (Fig. 15B, C, D), dark spots exist on each segment of the ramus (Fig. 15A). Cirrus II with rami almost equal, anterior ramus 8-segmented and posterior ramus 6-segmented (Figs 14B, 15E), bearing serrulate setae (Fig. 15F, G, H), dark spots exist on each segment of the ramus (Fig. 15E). Cirrus III rami equal, anterior ramus 10-segmented, posterior ramus 8-segmented (Figs 14C, 16A), bearing serrulate setae (Fig. 16B, C, D), dark spots exist on each segment of the ramus (Fig. 16A). Cirrus IV–VI long, slender, with equal rami size. Number of segments on Cirrus IV (anterior 16, posterior 16), Cirrus V (21, 20), Cirrus VI (21, 18) (Figs 14D, E, F, 16E, 17A, C). Intermediate segments of Cirrus IV–VI with four pairs of serrulate setae (Figs 16G, 17D, E), distal pair longest, proximal pair shortest. Dark spots exist on each segment of the ramus (Figs 16E, 17A, C). Line drawing of (Darwin, 1854) A Cirrus I B Cirrus II C Cirrus III D Cirrus IV E Cirrus V F Cirrus VI. (scale bar: μm). Cirri of (Darwin, 1854) A Cirrus I (CEL-RYU-28-2) B Serrulate setae on anterior ramus apex C Serrulate setae on anterior ramus D Serrulate setae on posterior ramus apex E Cirrus II (CEL-RYU-28-2) F Serrulate setae on anterior ramus apex G Serrulate setae on anterior ramus H Serrulate setae on posterior ramus apex. (scale bar: μm) Cirri of (Darwin, 1854) A Cirrus III (CEL-RYU-28-2) B Serrulate setae on posterior ramus C Serrulate setae on posterior ramus D Serrulate setae distally E Cirrus IV (CEL-RYU-28-2) F Serrulate setae on apex G Intermediate segment with 4 pairs of serrulate setae H Intermediate segment with serrulate setae. (scale bar: μm) Cirri and penis of (Darwin, 1854) A Cirrus V (CEL-RYU-28-2) B Serrulate setae on apex C Cirrus VI (CEL-RYU-28-2) D Intermediate segment with 4 pairs of serrulate setae E Intermediate segment with 4 pairs of serrulate setae F Serrulate setae on apex G Penis (CEL-RYU-170-1) H apex of penis I Basidorsal point of penis. (scale bar: μm) Penis long (1.2 times length of Cirrus VI), annulated, some dark spots present, scattered short simple type setae (Fig. 17G). Pedicel with basidorsal point (Fig. 17G, I), apex bearing short simple type setae (Fig. 17H). South China Sea: Singapore, Mainland China (Hong Kong), Vietnam (Nhatrang Bay).Pacific Ocean: Taiwan (Green Island, Turtle Island, Siaoliouciou Island, Kenting, Suao), Japan, Australia (Western Australia & Great Barrier Reef),Philippine.Indian Ocean: Mauritius (Albion), Bay of Bengal, Thailand (Gulf of Siam), Sri Lanka,Red Sea. is widely reported in the Indo-Pacific Ocean. Note Ogawa and Matsuzaki (1992) and Asami and Yamaguchi (1997) misspelled the species name as ‘conjugata’.

Molecular analysis

After trimming and aligning the sequences, 472bp of 12S rDNA and 642bp of COI were obtained from 107 and 92 specimens without indels, respectively (see on-line Appendix 2: Table 2 for GenBank accession numbers, on-line Appendix 3: alignment Figure). The NJ inferred genealogical relationships based on 12S and COI were congruent to each other (Fig. 18). Both datasets showed the presence of two well-supported distinct lineages, corresponding to and sp. n.. In 12S, 37 out of the 69 variable nucleotide sites were parsimony informative. Evolutionary distances based on p-distance/K2P-distance were 0.004/0.004 and 0.006/0.006 within and sp. n., respectively, and 0.056/0.058 between the two species. In COI, 100 out of the 127 variable nucleotide sites were parsimony informative. Evolutionary distances based on p-distance/K2P-distance wPageBreakPageBreakere 0.010/0.010 and 0.006/0.006 within and sp. n., respectively, and 0.120/0.132 between species.
Figure 18.

Neighbor-Joining method inferred genealogical relationships of specimens based on 472bp 12S and 642bp COI with as the outgroup. Numbers above the major nodes are bootstrap values of 1000 replicates.

Neighbor-Joining method inferred genealogical relationships of specimens based on 472bp 12S and 642bp COI with as the outgroup. Numbers above the major nodes are bootstrap values of 1000 replicates.

Discussion

In the present study, a new species is identified from the previously monotypic genus that exhibit diagnostic morphological and molecular differences from . These two species are difficult to distinguish from external shell morphology. The diagnostic characters are of the adductor plate angle of the scutum and the spur angle of the tergum. Based on molecular analyses, the sequence distance of mitochondrial DNA markers 12S and COI within the two species (12S: 0. 4–0.6%, COI: 0.6–1.0%) is much smaller than between species (12S: 5.6–5.8%, COI: 12.0–13.2%). The sequence divergence of these two species has reached the level of congeneric species in another coral barnacle genus, Ross & Newman, 1973 (12S: 5–7%, COI: 10–11 %) (Achituv et al. 2009), therefore further supporting sp. n. as a separate species from . Although the application of mitochondrial DNA in delimitating species can be limited by its natural history, e.g. reduced effective population size and introgression, and maternal inheritance (Rubinoff et al. 2006), the species boundary is evident based on the differentiation of 12S, COI and morphology of abundant samples from various localities. Both species show significant host preference for the massive-form coral . In the present study, 21 of 23 coral pieces with embedded are and only one is (Appendix 2: Table 2). A similar pattern is observed in where six of eight coral pieces are , and only two are . In previous studies, has been recorded in corals by Soong and Chang 1983 (Taiwan), Ren 1986 (Mainland China), Ogawa et al. 1998 (Mauritius) and Jones et al. 2000 (South China Sea), agreeing with the current study. However, Ogawa and Matsuzaki (1992) also recorded from , de Blainville, 1830 and Link, 1807 species in Japan.
  5 in total

Review 1.  A genomic perspective on the shortcomings of mitochondrial DNA for "barcoding" identification.

Authors:  Daniel Rubinoff; Stephen Cameron; Kipling Will
Journal:  J Hered       Date:  2006-11-29       Impact factor: 2.645

2.  Phylogeny of coral-inhabiting barnacles (Cirripedia; Thoracica; Pyrgomatidae) based on 12S, 16S and 18S rDNA analysis.

Authors:  N Simon-Blecher; D Huchon; Y Achituv
Journal:  Mol Phylogenet Evol       Date:  2007-05-06       Impact factor: 4.286

3.  MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods.

Authors:  Koichiro Tamura; Daniel Peterson; Nicholas Peterson; Glen Stecher; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2011-05-04       Impact factor: 16.240

4.  The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Authors:  J D Thompson; T J Gibson; F Plewniak; F Jeanmougin; D G Higgins
Journal:  Nucleic Acids Res       Date:  1997-12-15       Impact factor: 16.971

5.  Host-associated speciation in the coral barnacle Wanella milleporae (Cirripedia: Pyrgomatidae) inhabiting the Millepora coral.

Authors:  Ling Ming Tsang; Benny Kwok Kan Chan; Fu-Long Shih; Ka Hou Chu; Chaolun Allen Chen
Journal:  Mol Ecol       Date:  2009-04       Impact factor: 6.185

  5 in total
  6 in total

1.  A suspension-feeding anomalocarid from the Early Cambrian.

Authors:  Jakob Vinther; Martin Stein; Nicholas R Longrich; David A T Harper
Journal:  Nature       Date:  2014-03-27       Impact factor: 49.962

2.  How do coral barnacles start their life in their hosts?

Authors:  Jennie Chien Wen Liu; Jens Thorvald Høeg; Benny K K Chan
Journal:  Biol Lett       Date:  2016-06       Impact factor: 3.703

3.  The Application of DNA Barcodes for the Identification of Marine Crustaceans from the North Sea and Adjacent Regions.

Authors:  Michael J Raupach; Andrea Barco; Dirk Steinke; Jan Beermann; Silke Laakmann; Inga Mohrbeck; Hermann Neumann; Terue C Kihara; Karin Pointner; Adriana Radulovici; Alexandra Segelken-Voigt; Christina Wesse; Thomas Knebelsberger
Journal:  PLoS One       Date:  2015-09-29       Impact factor: 3.240

4.  Biodiversity and Biogeography of Chthamalid Barnacles from the North-Eastern Pacific (Crustacea Cirripedia).

Authors:  Benny K K Chan; H-N Chen; P R Dando; A J Southward; E C Southward
Journal:  PLoS One       Date:  2016-03-09       Impact factor: 3.240

5.  Galkinius Perreault, 2014 or Darwiniella (Anderson, 1992)? A new coral-associated barnacle sharing characteristics of these two genera in Pacific waters (Crustacea, Cirripedia, Thoracica, Pyrgomatidae).

Authors:  Benny Kwok Kan Chan; Jennie Chien Wen Liu
Journal:  Zookeys       Date:  2017-12-07       Impact factor: 1.546

6.  Influence of environmental factors on macrofoulant assemblages on moored buoys in the eastern Arabian Sea.

Authors:  M V Martin; Ramasamy Venkatesan; M Beyline; V P Limna Mol; L Divya
Journal:  PLoS One       Date:  2020-01-30       Impact factor: 3.240

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.