Literature DB >> 22926720

Achromobacter xylosoxidans: an emerging pathogen carrying different elements involved in horizontal genetic transfer.

German Matías Traglia1, Marisa Almuzara, Andrea Karina Merkier, Christina Adams, Laura Galanternik, Carlos Vay, Daniela Centrón, María Soledad Ramírez.   

Abstract

In the last few years, numerous cases of multidrug-resistant Achromobacter xylosoxidans infections have been documented in immunocompromised and cystic fibrosis patients. To gain insights into the molecular mechanisms and mobile elements related to multidrug resistance in this bacterium, we studied 24 non-epidemiological A. xylosoxidans clinical isolates from Argentina. Specific primers for plasmids, transposons, insertion sequences, bla(ampC), intI1, and intI2 genes were used in PCR reactions. The obtained results showed the presence of wide host range IncP plasmids in ten isolates and a high dispersion of class 1 integrons (n = 10) and class 2 integrons (n = 3). Four arrays in the variable region (vr) of class 1 integrons were identified carrying different gene cassettes as the aminoglycoside resistance aac(6')-Ib and aadA1, the trimethoprim resistance dfrA1 and dfrA16, and the β-lactamase bla(OXA-2). In only one of the class 2 integrons, a vr was amplified that includes sat2-aadA1. The bla(ampC) gene was found in all isolates, confirming its ubiquitous nature. Our results show that A. xylosoxidans clinical isolates contain a rich variety of genetic elements commonly associated with resistance genes and their dissemination. This supports the hypothesis that A. xylosoxidans is becoming a reservoir of horizontal genetic transfer elements commonly involved in spreading antibiotic resistance.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22926720      PMCID: PMC3477587          DOI: 10.1007/s00284-012-0213-5

Source DB:  PubMed          Journal:  Curr Microbiol        ISSN: 0343-8651            Impact factor:   2.188


Introduction

Achromobacter spp. is a rarely nosocomial and community pathogen, being Achromobacter xylosoxidans the most frequent species among Achromobacter spp. isolates [6, 8, 18]. Many reports of A. xylosoxidans infections are documented in immunocompromised and cystic fibrosis (CF) patients, where its pathogenic role has not yet been properly clarified [7, 8]. In Argentina, the relative frequency of A. xylosoxidans among the uncommon non-glucose-fermenting gram-negative bacilli infections has been increasing reaching 66 % of total non-glucose-fermenting gram-negative bacilli infection isolates [18]. Although clinical A. xylosoxidans isolates usually show multiple drug resistance, the relative low attention paid to this pathogen resulted in poor understanding of their resistance mechanisms. Little is known about molecular mechanisms and transferable elements contributing to the acquisition and dissemination of antibiotic resistance determinants in A. xylosoxidans clinical isolates. The aim of this study was to explore the occurrence of mobile elements related to antibiotic-resistance determinants among a collection of 24 non-epidemiological-related clinical isolates of A. xylosoxidans recovered in Argentina from six centers.

Materials and Methods

Bacterial Strains

Twenty-four non-epidemiological-related clinical isolates of A. xylosoxidans recovered in Argentina from six centers were used (Table 1). All isolates were identified using standard biochemical tests and API 20NE (Biomeriux), and the species level was confirmed by sequencing the 16S rRNA gene [19]. Clonal relationships analysis, using the macrorestriction technique, showed the presence of 15 different clones among the isolates included in the study (data not shown). The antibiotic susceptibility was performed by agar dilution method following the general recommendations of the Clinical and Laboratory Standards Institute (CLSI) [4].
Table 1

Characteristic and obtained results of the 24 A. xylosoxidans isolates used in the study

Isolatea HospitalYearSourceb IncPIS26IS440 intI1 vrc intI2
Ax79Center 22004NP+++ dfrA1-aadA1 +
Ax169Center 32004NP+++ dfrA1-aadA1 +
Ax126Center 12001NP+++ dfrA1-aadA1 +
Ax144Center 12001NP++NA
Ax69Center 22002CF+NA
Ax72Center 22007CF++ aac(6′)-Ib
Ax77Center 22007CF+NA
Ax210Center 32007CFNA
Ax81Center 22008CFNA
Ax82Center 22008CFNA
Ax90Center 22008CFNA
Ax91Center 22008CFNA
Ax92Center 22008CFNA
Ax93Center 22008CF+NA
Ax97Center 22007CFNA
Ax336Center 22010CF+NA
Ax11Center 22004NP+ aac(6′)-Ib
Ax22Center 11995NPNA
Ax44Center 12006NP++ dfrA16
Ax56Center 12003NP++ aac(6′)-Ib
Ax68Center 62010NP+NA
Ax114Center 12002NP++ dfrA1-aadA1
Ax247Center 12006NP+NA
Ax304Center 41996NP+ bla OXA-2
Ax2700Center 52006NP+NA

NA not applicable

aIsolates of the study: Ax for Achromobacter xylosoxidans

bNP for nosocomial patient’s samples and CF for cystic fibrosis patient’s samples

cvr: class 1 integron variable region

Characteristic and obtained results of the 24 A. xylosoxidans isolates used in the study NA not applicable aIsolates of the study: Ax for Achromobacter xylosoxidans bNP for nosocomial patient’s samples and CF for cystic fibrosis patient’s samples cvr: class 1 integron variable region

DNA Techniques

Total DNAs were prepared and used as template for PCR reactions. PCR reactions were carried out using the GoTaq enzyme according to manufacturer’s instructions (Promega, Madison, WI), and the products were detected by agarose gel electrophoresis. To reveal the presence of transferable determinants associated to horizontal gene transfer, specific primers for plasmids (IncP, IncW, IncA/C, IncN, IncFII, repAci1), transposons (Tn1331, Tn3, Tn7), insertion sequences (IS) (IS26, IS440), and the bla ampC, intI1, and intI2 genes were used (Table 2). The selection of the mobile elements was based on its association with antibiotic-resistance determinants and also its distribution in our hospitals [12, 13, 16].
Table 2

Oligonucleotides used in the study

TargetOligonucleotideSequence 5′–3′References
IncW TrwAB1AGCGTATGAAGCCCGTGAAGGG[3]
TrwAB2AAAGATAAGCGGCAGGACAATAACG[3]
IncP TrfA2 1CGAAATTCATATGGGAGAAGTA[3]
TrfA2 2CGTTTGCAATGCACCAGGTC[3]
IncN KikA1ACTTACCTTTATCAACATTCTGGCG[3]
KikA2CGACTGGTTACTTCCACCTTCGC[3]
IncF REPAGGAGCGATTTGCATTCCG[3]
REPCAAATGAGCCTGTTTGAG[3]
IncA/C CA1ATGTCGCAGACAGAAAATGC[3]
OR1CCTTGCAGTTTAATGTGAATAA[3]
IS26IS26FGCTGGCTGAACGCGGAG[9]
IS26RATACCTTTGATGGTGGC[9]
IS440IS440FCTCACTGTTCGCGACT[9]
IS440RGGCATGCGCAGTGAGCGG[9]
Tn1331Tn1331NFGAATTGCCTCGTGATACGCCTATTT[15]
Tn1331NRGCGGCCGCGATAGTTTGGCTGTGAGC AATT[15]
Tn3Tn3FAAGTTCATCGGGTTCGC[9]
201LACTACGATACGGGAGGGCT[9]
tnsA TnsAFCTCCATATTCACTACTTGGCT[5, 14]
TnsARGCTAACAGTACAAGAAGTTCC[5, 14]
tnsB TnsBFCATGTGGTCCAAGAACATAAG[5, 14]
TnsBRGAGCAAGCATTTACAAAAGC[5, 14]
tnsC TnsCFGTTTATCGTGATACGGGGG[5, 14]
TnsCRGCTATCCCAGTCGCTGGG[5, 14]
tnsD TnsDFGGGATTGTTAGTCCTAAGC[5, 14]
TnsDRCCGTCTAATTTGATAATCTTC[5, 14]
tnsE TnsEFTTGCTCTCTAACCACTCT[5, 14]
TnsERTCGATTTGCTGCTTTTGATG[5, 14]
aac(6′)-Ib aac(6)’ibFTGTGACGGAATCGTTGC[13]
aac(6)’IbRCAGTGACGGTTATTCCGC[13]
intI1 Inti1FCGAGGCATAGACTGTAC[12]
Inti1RTTCGAATGTCGTAACCGC[12]
intI2 Inti2FGCAAATGAAGTGCAACGC[12]
Inti2RACACGCTTGCTAACGATG[12]
5′CS SulproGCCTGACGATGCGTGGA[12]
3′CS 3′CSAAGCAGACTTGACCTGATAG [12]
sat SatFTGAGCAGGTGGCGGAAAC[12]
SatRTCATCCTGTGCTCCCGAG[12]
aadA1 aadA1rTCATTGCGCTGCCATTC[12]
aadA1TCGATGACGCCAACTAC[12]
dfrA1 Dhfr1rCCTGAAATCCCCAGCAA[12]
dhfrA1AGCTGTTCACCTTTGGC[12]
bla OXA-2 Oxa2FGAAGAAACGCTACTCGC[12]
Oxa2RTACCCACCAACCCATAC[12]
dfrA16 Dhfr16FCAAAGGCGAGCAACTTCThis study
Dhfr16RCACCCTCATCATTCGTAThis study
Oligonucleotides used in the study

DNA Sequencing

PCR products were sequenced after purifying the DNA by using the Wizard SV Gel and PCR clean-up System kit according to the manufacturer’s directions (Promega, USA). Sequencing was performed on both DNA strands, using an ABIPrism 3100 BioAnalyzer equipment. The nucleotide sequences were analyzed using the Blast V2.0 software (http://www.ncbi.nlm.nih.gov/BLAST/).

Results and Discussion

The 24 A. xylosoxidans isolates studied exhibited the typical multiresistance profile previously described for this species, being the third and fourth-generation cephalosporins, fluoroquinolones, and aminoglycosides not active against Achromobacter spp. [18]. All isolates were susceptible to tazobactam, imipenem, and meropenem (Table S1 in Supplementary material). Among the PCR reactions performed for the selected transferable elements, positive results were obtained in ten isolates (42 %) for the IncP plasmids, a wide host range and self-transmissible plasmid important in the dissemination of resistant genes around the world [11] (Table 1). Negative results were obtained for the other Inc groups searched (IncW, IncA/C, IncN, IncFII). Sequence analysis of the amplification products showed 99 % of identity in 200-bp length with the replication gene trfA (AN GU186864). The GC% of the trfA replication gene of IncP plasmid is 60.5 %, which is very similar to the GC% (67 %) of A. xylosoxidans. We also noticed in this study that most isolates containing IncP plasmids corresponded to nosocomial isolates (n = 9). In only one CF patient isolate (Ax72), an IncP plasmid was identified. Regarding IS and transposons, positive results were obtained for IS26 (n = 2) and IS440 (n = 7) (Table 1), two ISs frequently associated to antimicrobial resistance genes and to classes 1 and 2 integrons [1, 2, 10], obtaining negative results for the transposons Tn1331, Tn3, and Tn7. In addition, a high dispersion of class 1 integrons was found (42 %). Most of the positive isolates corresponded to nosocomial patient samples (n = 9), being only one positive isolate from a CF patient sample (Ax72). To characterize the vr of class 1 integrons, PCR cartography was carried out as previously described [12]. Four vr were identified, being all the arrays different to the previous arrays reported in this species (Table 1; Fig. 1). Among the gene cassettes identified in the class 1 integron context, aminoglycosides-resistance genes aac(6′)-Ib and aadA1, the trimethoprim-resistance genes dfrA1 and dfrA16, and the β-lactamase bla OXA-2 were found. The obtained MICs in the positive integron isolates to several antibiotics are exposed in Table 3. No clear contribution of gene cassettes could be established in the studied isolates. Only in the strain Ax44, harboring the gene cassette dfrA16, a contribution to the MIC to TMS (256 μg/ml) could be suggested, as it corresponded to the highest value among isolates under scrutiny (Table S1 in Supplementary material).
Fig. 1

Schematic representation of arrays of class 1 integrons found among the A. xylosoxidans (n = 24) isolates. Thin black vertical closed bar The attI1 site, thin gray vertical closed bar the attC sites of the gene cassettes. Arrows The primers used to identify the class 1 integron vr. Figure is not in scale

Table 3

Minimal inhibitory concentration (μg/ml) of integron positive strains

IsolateCAZFEPPIPIPMMEMAMKGENTMPCIPvra
Ax798320.2510.1251281280.258 dfrA1-aadA1
Ax169321280.250.50.5128128116 dfrA1-aadA1
Ax1264320.510.251281280.12516 dfrA1-aadA1
Ax724320.2510.2525625646 aac(6′)-Ib
Ax1132128840.241281286464 aac(6′)-Ib
Ax4416320.510.51281282564 dfrA16
Ax56832820.0664320.1252 aac(6′)-Ib
Ax11416320.12510.1251281280.12516 dfrA1-aadA1
Ax30432128840.125128128324 bla OXA-2

CAZ ceftazidime, FEP cefepime, PIP piperacillin, IPM imipenem, MEM meropenem, AMK amikacin, GEN gentamicin, TMP trimethoprim-sulfamethoxazole, CIP ciprofloxacin

avr: class 1 integron variable region found in the Ax isolates

Schematic representation of arrays of class 1 integrons found among the A. xylosoxidans (n = 24) isolates. Thin black vertical closed bar The attI1 site, thin gray vertical closed bar the attC sites of the gene cassettes. Arrows The primers used to identify the class 1 integron vr. Figure is not in scale Minimal inhibitory concentration (μg/ml) of integron positive strains CAZ ceftazidime, FEP cefepime, PIP piperacillin, IPM imipenem, MEM meropenem, AMK amikacin, GEN gentamicin, TMP trimethoprim-sulfamethoxazole, CIP ciprofloxacin avr: class 1 integron variable region found in the Ax isolates Furthermore, three nosocomial isolates apart from harboring class 1 integrons also have class 2 integrons (Ax79, Ax126, and Ax169) (Table 1). To identify the gene cassette content found in the variable region of class 2 integrons, PCR cartography was performed using different combinations of primers [5, 14, 16]. Only positive amplifications were obtained for the Ax126 showing the presence of the array intI2-sat2-aadA1. The occurrence of the Tn7 transposition gene was also searched, showing that the tnsE gene was present in all isolates, being the tnsB also present in the Ax126 isolate. The rest of the genes gave negative results. To the best of our knowledge, this is the first description of class 2 integrons in Achromobacter spp. [16]. No association of integrons with IS26 and IS440 was found in this study. In relation with the bla ampC gene previously described in this species [17], it was found in all isolates, confirming its ubiquitous nature. The exposed results showed that almost all isolates (17/24) included in this study have the capability of carrying ISs, R plasmids, and integrons, associated to horizontal gene transfer usually found in gram-negative clinical isolates. Moreover, the similar GC% between the trfA replicon of the IncP plasmid and the A. xylosoxidans genome reinforces the argument that A. xylosoxidans could be considered as a reservoir of transferable elements. It is likely that its intrinsic antibiotic multidrug resistant profile that ensures its selection under antibiotic pressure, along with its ability to survive in fluids and in the environment [18], makes A. xylosoxidans a reservoir of transferable elements that could contribute to the dissemination and acquisition of antimicrobial resistance mechanisms within the nosocomial environment. Below is the link to the electronic supplementary material. Supplementary material 1 (DOC 74 kb)
  17 in total

1.  Novel rearrangement of a class 2 integron in two non-epidemiologically related isolates of Acinetobacter baumannii.

Authors:  María Soledad Ramírez; Cecilia Quiroga; Daniela Centrón
Journal:  Antimicrob Agents Chemother       Date:  2005-12       Impact factor: 5.191

2.  Complex class 1 integrons with diverse variable regions, including aac(6')-Ib-cr, and a novel allele, qnrB10, associated with ISCR1 in clinical enterobacterial isolates from Argentina.

Authors:  María Paula Quiroga; Patricia Andres; Alejandro Petroni; Alfonso J C Soler Bistué; Leonor Guerriero; Liliana Jordá Vargas; Angeles Zorreguieta; Marta Tokumoto; Cecilia Quiroga; Marcelo E Tolmasky; Marcelo Galas; Daniela Centrón
Journal:  Antimicrob Agents Chemother       Date:  2007-10-15       Impact factor: 5.191

3.  Dissemination of sul3-containing elements linked to class 1 integrons with an unusual 3' conserved sequence region among Salmonella isolates.

Authors:  Patrícia Antunes; Jorge Machado; Luísa Peixe
Journal:  Antimicrob Agents Chemother       Date:  2007-02-05       Impact factor: 5.191

4.  Dissemination and persistence of blaCTX-M-9 are linked to class 1 integrons containing CR1 associated with defective transposon derivatives from Tn402 located in early antibiotic resistance plasmids of IncHI2, IncP1-alpha, and IncFI groups.

Authors:  Angela Novais; Rafael Cantón; Aránzazu Valverde; Elisabete Machado; Juan-Carlos Galán; Luísa Peixe; Alessandra Carattoli; Fernando Baquero; Teresa M Coque
Journal:  Antimicrob Agents Chemother       Date:  2006-08       Impact factor: 5.191

5.  Molecular characterization of In50, a class 1 integron encoding the gene for the extended-spectrum beta-lactamase VEB-1 in Pseudomonas aeruginosa.

Authors:  T Naas; L Poirel; A Karim; P Nordmann
Journal:  FEMS Microbiol Lett       Date:  1999-07-15       Impact factor: 2.742

6.  Evolution of multiresistance in nontyphoid salmonella serovars from 1984 to 1998 in Argentina.

Authors:  Betina E Orman; Silvia A Piñeiro; Sonia Arduino; Marcelo Galas; Roberto Melano; Maria I Caffer; Daniel O Sordelli; Daniela Centrón
Journal:  Antimicrob Agents Chemother       Date:  2002-12       Impact factor: 5.191

7.  Identification of plasmids by PCR-based replicon typing.

Authors:  Alessandra Carattoli; Alessia Bertini; Laura Villa; Vincenzo Falbo; Katie L Hopkins; E John Threlfall
Journal:  J Microbiol Methods       Date:  2005-06-02       Impact factor: 2.363

8.  Imipenem-resistant Achromobacter xylosoxidans carrying blaVIM-2-containing class 1 integron.

Authors:  Kyeong Seob Shin; Kyudong Han; Jungnam Lee; Seung Bok Hong; Bo Ra Son; Sei Jin Youn; Jungmin Kim; Hyung Sik Shin
Journal:  Diagn Microbiol Infect Dis       Date:  2005-11-02       Impact factor: 2.803

9.  Functional characterization of Tn1331 gene cassettes.

Authors:  Maria S Ramirez; T Richard Parenteau; Daniela Centron; Marcelo E Tolmasky
Journal:  J Antimicrob Chemother       Date:  2008-07-16       Impact factor: 5.790

10.  Novel insights about class 2 integrons from experimental and genomic epidemiology.

Authors:  María Soledad Ramírez; Silvia Piñeiro; Daniela Centrón
Journal:  Antimicrob Agents Chemother       Date:  2009-11-16       Impact factor: 5.191

View more
  15 in total

1.  Presence of OXA-type enzymes in Achromobacter insuavis and A. dolens.

Authors:  German Traglia; Mariana Papalia; Marisa Almuzara; Gabriel Gutkind; Daniela Centrón; Carlos Vay; Marcela Radice; María Soledad Ramírez
Journal:  Curr Microbiol       Date:  2014-06-04       Impact factor: 2.188

Review 2.  Achromobacter Infections and Treatment Options.

Authors:  Burcu Isler; Timothy J Kidd; Adam G Stewart; Patrick Harris; David L Paterson
Journal:  Antimicrob Agents Chemother       Date:  2020-10-20       Impact factor: 5.191

Review 3.  Achromobacter xylosoxidans and Stenotrophomonas maltophilia: Emerging Pathogens Well-Armed for Life in the Cystic Fibrosis Patients' Lung.

Authors:  Quentin Menetrey; Pauline Sorlin; Estelle Jumas-Bilak; Raphaël Chiron; Chloé Dupont; Hélène Marchandin
Journal:  Genes (Basel)       Date:  2021-04-21       Impact factor: 4.096

4.  Genome implosion elicits host-confinement in Alcaligenaceae: evidence from the comparative genomics of Tetrathiobacter kashmirensis, a pathogen in the making.

Authors:  Wriddhiman Ghosh; Masrure Alam; Chayan Roy; Prosenjit Pyne; Ashish George; Ranadhir Chakraborty; Saikat Majumder; Atima Agarwal; Sheolee Chakraborty; Subrata Majumdar; Sujoy Kumar Das Gupta
Journal:  PLoS One       Date:  2013-05-31       Impact factor: 3.240

5.  Patterns of virulence factor expression and antimicrobial resistance in Achromobacter xylosoxidans and Achromobacter ruhlandii isolates from patients with cystic fibrosis.

Authors:  R H V Pereira; R S Leão; A P Carvalho-Assef; R M Albano; E R A Rodrigues; M C Firmida; T W Folescu; M C Plotkowski; V G Bernardo; E A Marques
Journal:  Epidemiol Infect       Date:  2016-11-22       Impact factor: 4.434

6.  Poorly processed reusable surface disinfection tissue dispensers may be a source of infection.

Authors:  Günter Kampf; Stina Degenhardt; Sibylle Lackner; Katrin Jesse; Heike von Baum; Christiane Ostermeyer
Journal:  BMC Infect Dis       Date:  2014-01-21       Impact factor: 3.090

7.  Hospital Acquired Pneumonia Due to Achromobacter spp. in a Geriatric Ward in China: Clinical Characteristic, Genome Variability, Biofilm Production, Antibiotic Resistance and Integron in Isolated Strains.

Authors:  Chao Liu; Fei Pan; Jun Guo; Weifeng Yan; Yi Jin; Changting Liu; Long Qin; Xiangqun Fang
Journal:  Front Microbiol       Date:  2016-05-09       Impact factor: 5.640

8.  Outbreak of Achromobacter xylosoxidans in an Italian Cystic fibrosis center: genome variability, biofilm production, antibiotic resistance, and motility in isolated strains.

Authors:  Maria Trancassini; Valerio Iebba; Nicoletta Citerà; Vanessa Tuccio; Annarita Magni; Paola Varesi; Riccardo V De Biase; Valentina Totino; Floriana Santangelo; Antonella Gagliardi; Serena Schippa
Journal:  Front Microbiol       Date:  2014-04-03       Impact factor: 5.640

9.  Isolation and characterization of numerous novel phages targeting diverse strains of the ubiquitous and opportunistic pathogen Achromobacter xylosoxidans.

Authors:  Johannes Wittmann; Brigitte Dreiseikelmann; Christine Rohde; Manfred Rohde; Johannes Sikorski
Journal:  PLoS One       Date:  2014-01-22       Impact factor: 3.240

10.  Isolation and molecular characterisation of Achromobacter phage phiAxp-3, an N4-like bacteriophage.

Authors:  Yanyan Ma; Erna Li; Zhizhen Qi; Huan Li; Xiao Wei; Weishi Lin; Ruixiang Zhao; Aimin Jiang; Huiying Yang; Zhe Yin; Jing Yuan; Xiangna Zhao
Journal:  Sci Rep       Date:  2016-04-20       Impact factor: 4.379

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.