| Literature DB >> 22920654 |
Monidarin Chou1, Saorin Kim, Nimol Khim, Sophy Chy, Sarorn Sum, Dany Dourng, Lydie Canier, Chea Nguon, Didier Ménard.
Abstract
BACKGROUND: Recently, IMACCESS® developed a new malaria test (VIKIA Malaria Ag Pf/Pan™), based on the detection of falciparum malaria (HRP-2) and non-falciparum malaria (aldolase).Entities:
Mesh:
Substances:
Year: 2012 PMID: 22920654 PMCID: PMC3478208 DOI: 10.1186/1475-2875-11-295
Source DB: PubMed Journal: Malar J ISSN: 1475-2875 Impact factor: 2.979
Figure 1Design of the VIKIA Malaria Ag Pf/Pan™ test.
Figure 2Map of Cambodia with the locations of the four selected health centres indicated.
Primers sequences and real-time PCR conditions used to detect species, Cambodia, 2011
| RTPCRScreening2_F | TGGAGTGGATGGTGTTTTAGA | Hot FirePol EvaGreen qPCR Mix Solis Biodyne 1X (#08- 24-00020), Primers 250 nM, 5 μl DNA template, total volume 20 μl | 95°C-15 min. 45 cycles: 95°C-15 sec./60°C-20 sec./ 72°C-20 sec. 95°C-2 min. 68°C-2 min | From 68 to 90°C, increment 0.2°C for 0.05 sec. | 76.2 - 78.8°C | ||
| RTPCRScreening2_R | TTGCACCCCAATARCTCATTT | ||||||
| Primary PCR | RTPCRScreening2_F | TGGAGTGGATGGTGTTTTAGA | Hot FirePol DNA Pol. Solis BioDyne 1.25 U (#01-02-01000), dNTP 200 μM, MgCl2 2.5 mM, Primers 250 nM, 5 μl DNA template. Total volume 20 μl. | 94°C −15 min. 20 cycles: 94°C-30 sec/ 58°C -1 min/ 72°C-1 min3. 72°C-10 min. | N/A | N/A | |
| RTPCRSreening3_R | ACCCTAAAGGATTTGTGCTACC | ||||||
| Pf real-time PCR | Pf_RTPCR_F | ATGGATATCTGGATTGATTTTA TTTATGA | Hot FirePol EvaGreen HRM Mix Solis Biodyne 1X (#08- 33-00001), Primers 250 nM, 5 μl template Primary PCR products 1:1000, total volume 20 μl | 95°C-15 min. 40 cycles: 95°C-10 sec./62°C-20 sec./ 72°C-25 sec. 95°C-1 min. 40°C-1 min | From 65 to 90°C, increment 0.2°C for 0.05 sec. | 78.8-79.6°C | |
| Pf_RTCPR_R | TCCTCCACATATCCAAATTAC TGC | ||||||
| Pv real-time PCR | Pv_RTPCR_F | TGCTACAGGTGCATCTCTTG TATTC | 75.2-76°C | ||||
| Pv_RTPCR_R | ATTTGTCCCCAAGGTAAAACG | ||||||
| Pm real- time PCR | Pm_RTPCR_F | ACAGGTGCATCACTTGTATTTTTTC | 75.8-76.2°C | ||||
| Pm_RTPCR_R | TGCTGGAATTGAAGATAATAAATT AGTAATAACT | ||||||
| Po real- time PCR | Po_RTPCR_F | GTTATATGGTTATGTGGAGGATA TACTGTT | 73.4-74.2°C | ||||
| Po_RTPCR_R | CGAATGGAAGAATAAAATGTAG TACG | ||||||
Comparison of real-time PCR and microscopy results for 1,000 patients tested for malaria at health centres, Cambodia, 2011
| Negative | 578 | 0 | 0 | 0 | 578 |
| 6 | 110 | 3 | 2 | 121 | |
| 6 | 43 | 4 | 9 | 62 | |
| 21 | 0 | 0 | 216 | 237 | |
| 0 | 0 | 0 | 2 | 2 | |
| Total | 611 | 153 | 7 | 229 | 1000 |
Patients scoring positive for spp. by the reference method (microscopy/PCR), CareStart Malaria™ test and VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes), Cambodia, 2011.
| | | | |||||
|---|---|---|---|---|---|---|---|
| | | ||||||
| CareStart Malaria RDT | Negative | 570 | 8 | 8 | 33 | 0 | 619 |
| 3 | 113 | 46 | 6 | 0 | 168 | ||
| 5 | 0 | 8 | 198 | 2 | 213 | ||
| Non interpretable | 0 | 0 | 0 | 0 | 0 | 0 | |
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 10 min. | Negative | 574 | 12 | 16 | 89 | 1 | 692 |
| 1 | 104 | 41 | 3 | 0 | 149 | ||
| 3 | 3 | 5 | 143 | 1 | 155 | ||
| Non interpretable | 0 | 2 | 0 | 2 | 0 | 4 | |
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 15 min. | Negative | 573 | 9 | 9 | 54 | 0 | 645 |
| 2 | 111 | 46 | 4 | 0 | 163 | ||
| 3 | 1 | 7 | 179 | 2 | 192 | ||
| Non interpretable | 0 | 0 | 0 | 0 | 0 | 0 | |
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 20 min. | Negative | 570 | 8 | 8 | 44 | 0 | 630 |
| 2 | 113 | 46 | 6 | 0 | 167 | ||
| 6 | 0 | 8 | 187 | 2 | 203 | ||
| Non interpretable | 0 | 0 | 0 | 0 | 0 | 0 | |
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 30 min. | Negative | 570 | 8 | 8 | 40 | 0 | 626 |
| 2 | 113 | 46 | 6 | 0 | 167 | ||
| 6 | 0 | 8 | 191 | 2 | 207 | ||
| Non interpretable | 0 | 0 | 0 | 0 | 0 | 0 | |
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 60 min. | Negative | 567 | 7 | 8 | 40 | 0 | 622 |
| 5 | 114 | 46 | 7 | 0 | 172 | ||
| 6 | 0 | 8 | 190 | 2 | 206 | ||
| Non interpretable | 0 | 0 | 0 | 0 | 0 | 0 | |
Pf: P. falciparum; Pv: Plasmodium vivax; Pm: Plasmodium malariae; Non-Pf: Plasmodium non-falciparum.
Frequencies of false positive, false negative and misclassified results obtained from RDTs with reference to microscopy and PCR results (including non-interpretable data), Cambodia, 2011
| CareStart Malaria RDT | 0.8 | 4.9 | 1.4 | 0 | 7.1 | |
| VIKIA Malaria Ag Pf/Pan RDT | Reading time 10 min. | 0.4 | 11.8 | 1.1 | 0.4 | 13.7 |
| Reading time 15 min. | 0.5 | 7.2 | 1.2 | 0 | 8.9 | |
| Reading time 20 min. | 0.8 | 6.0 | 1.4 | 0 | 8.2 | |
| Reading time 30 min. | 0.8 | 5.6 | 1.4 | 0 | 7.8 | |
| Reading time 60 min. | 1.1 | 5.5 | 1.5 | 0 | 8.1 | |
Diagnostic performances of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 min) for detection of spp. in field study patients, Cambodia, 2011
| CareStart Malaria RDT | 93.4% (87.4-97.1%) | 98.6% (97.3-99.40%) | 93.4% (87.4-97.10%) | 98.6% (97.3-99.4%) | |
| 85.8% (80.7-90.0%) | 99.1% (98.0-99.7%) | 97.6% (94.4-99.2%) | 94.5% (92.4-96.2%) | ||
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 10 min. | 89.7% (82.6-94.6%) | 99.3% (98.3-99.8%) | 96.3% (90.8-99.0%) | 97.9% (96.4-98.9%) | |
| 61.5% (54.9-67.8%) | 99.5% (98.5-99.9%) | 97.9% (94.1-99.6%) | 86.4% (83.6-89.0%) | ||
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 15 min. | 92.5% (86.2-96.5%) | 99.1% (98.0-99.7%) | 95.7% (90.2-98.6%) | 98.4% (97.1-99.3%) | |
| 77.0% (71.1-82.2%) | 99.5% (98.5-99.9%) | 98.4% (95.3-99.7%) | 91.4% (88.9-93.5%) | ||
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 20 min. | 93.4% (87.4-97.1%) | 98.6% (97.3-99.40%) | 93.4% (87.4-97.10%) | 98.6% (97.3-99.4%) | |
| 81.1% (75.5-85.9%) | 98.9% (97.7-99.6%) | 96.9% (93.4-98.9%) | 92.8% (90.5-94.7%) | ||
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 30 min. | 93.4% (87.4-97.1%) | 98.6% (97.3-99.40%) | 93.4% (87.4-97.10%) | 98.6% (97.3-99.4%) | |
| 82.8% (77.4-87.4%) | 98.9% (97.7-99.6%) | 97.0% (93.6-98.9%) | 93.4% (91.2-95.3%) | ||
| VIKIA Malaria Ag Pf/Pan RDT - Reading time 60 min. | 94.2% (88.4-97.6%) | 98.1% (96.6-99.0%) | 91.2% (84.8-95.5%) | 98.8% (97.5-99.5%) | |
| 82.7% (77.3-87.4%) | 98.9% (97.7-99.6%) | 97.0% (93.5-98.9%) | 93.4% (91.1-95.2%) | ||
Pf: P. falciparum; Non-Pf: Plasmodium non-falciparum.
PPV: Positive predictive value; NPV: Negative predictive value.
Figure 3Comparative representation of the diagnostic performances of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes) for detection of. in field study patients, Cambodia, 2011.
Diagnostic performance of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes) for different levels of spp. parasitaemia, Cambodia, 2011
| Sub-microscopic | Sensitivity | 16.7% | 0.0% | 16.7% | 0.0% | 16.7% | 0.0% |
| < 100 | Sensitivity | 75.0% | 68.7% | 75.0% | 46.7% | 75.0% | 50.0% |
| 101-500 | Sensitivity | 71.4% | 80.9% | 57.1% | 36.4% | 57.1% | 45.5% |
| 501-1,000 | Sensitivity | 100.0% | 72.7% | 90.0% | 36.4% | 100.0% | 72.7% |
| 1,001-5,000 | Sensitivity | 100.0% | 100.0% | 100.0% | 72.0% | 100.0% | 88.2% |
| 5,001-10,000 | Sensitivity | 100.0% | 100.0% | 90.5% | 74.3% | 100.0% | 92.1% |
| 10,001-50,000 | Sensitivity | 100.0% | 100.0% | 100.0% | 77.9% | 100.0% | 98.5% |
| 50,001-100,000 | Sensitivity | 100.0% | 100.0% | 100.0% | 100.0% | 100.0% | 100.0% |
| > 100,000 | Sensitivity | 100.0% | - | 95.5% | - | 100.0% | - |
| Parasitaemia/μl of blood | VIKIA Malaria Ag Pf/Pan RDT - Reading time 20 min. | VIKIA Malaria Ag Pf/Pan RDT - Reading time 30 min. | VIKIA Malaria Ag Pf/Pan RDT - Reading time 60 min. | ||||
| Sub-microscopic | Sensitivity | 16.7% | 0.0% | 16.7% | 0.0% | 16.7% | 0.0% |
| < 100 | Sensitivity | 75.0% | 53.3% | 75.0% | 53.3% | 75.0% | 56.2% |
| 101-500 | Sensitivity | 71.4% | 57.1% | 71.4% | 61.9% | 85.7% | 61.9% |
| 501-1,000 | Sensitivity | 100.0% | 72.7% | 100.0% | 81.8% | 100.0% | 81.8% |
| 1,001-5,000 | Sensitivity | 100.0% | 94.0% | 100.0% | 98.0% | 100.0% | 98.0% |
| 5,001-10,000 | Sensitivity | 100.0% | 97.4% | 100.0% | 97.4% | 100.0% | 97.4% |
| 10,001-50,000 | Sensitivity | 100.0% | 100.0% | 100.0% | 100.0% | 100.0% | 100.0% |
| 50,001-100,000 | Sensitivity | 100.0% | 100.0% | 100.0% | 100.0% | 100.0% | 100.0% |
| > 100,000 | Sensitivity | 100.0% | - | 100.0% | - | 100.0% | - |
Pf: P. falciparum; Non-Pf: Plasmodium non-falciparum.
Figure 4Comparative representation of the sensitivities of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes) for different levels of spp. parasitaemia. Results for Plasmodium falciparum infections, Cambodia, 2011.
Figure 5Comparative representation of the sensitivities of the CareStart Malaria™ test and the VIKIA Malaria Ag Pf/Pan™ test at several reading times (10, 15, 20, 30 and 60 minutes) for different levels of spp. parasitaemia. Results for non-P. falciparum infections, Cambodia, 2011.