| Literature DB >> 22919638 |
Yao-Hui Sun1, Maarten F de Jong, Andreas B den Hartigh, Christelle M Roux, Hortensia G Rolán, Renée M Tsolis.
Abstract
A large number of hypothetical genes potentially encoding small proteins of unknown function are annotated in the Brucella abortus genome. Individual deletion of 30 of these genes identified four mutants, in BAB1_0355, BAB2_0726, BAB2_0470, and BAB2_0450 that were highly attenuated for infection. BAB2_0726, an YbgT-family protein located at the 3' end of the cydAB genes encoding cytochrome bd ubiquinal oxidase, was designated cydX. A B. abortus cydX mutant lacked cytochrome bd oxidase activity, as shown by increased sensitivity to H(2)O(2), decreased acid tolerance and increased resistance to killing by respiratory inhibitors. The C terminus, but not the N terminus, of CydX was located in the periplasm, suggesting that CydX is an integral cytoplasmic membrane protein. Phenotypic analysis of the cydX mutant, therefore, suggested that CydX is required for full function of cytochrome bd oxidase, possibly via regulation of its assembly or activity.Entities:
Keywords: cytochrome oxidase; mutant screen; peptide; terminal electron acceptor
Mesh:
Substances:
Year: 2012 PMID: 22919638 PMCID: PMC3417669 DOI: 10.3389/fcimb.2012.00047
Source DB: PubMed Journal: Front Cell Infect Microbiol ISSN: 2235-2988 Impact factor: 5.293
Strains and plasmids used in this work.
| pCR2.1 | PCR TOPO cloning vector | Invitrogen |
| pUC4Kixx | 1.3 Kb Kan cassette as | Pharmarcia |
| pBBR1MCS4 | Broad-host range vector confers AmpR | Kovach et al., |
| pFlagTEM1 | Cloning vector to express flagged TEM1 (FT) fusion under control of trc promoter, CmR | Raffatellu et al., |
| pCydX/FT | Expresses CydX::FT from trc promoter, CmR | This study |
| pFT/CydX | Expresses FT::CydX from trc promoter, CmR | This study |
| pGST/FT | Expresses GST::FT from trc promoter, CmR | Raffatellu et al., |
| pFT/GST | Expresses FT::GST fromtrc promoter, CmR | de Jong et al., |
| pGroEL/dsRed | Expresses DsRed from | This study |
| pGroEL/CydX | Expresses CydX from | This study |
| pGroEL/CydB | Expresses CydB from | This study |
| pGroEL/CydBX | Expresses CydBX from | This study |
| pBBR1Flag | Cloning vector to express flagged fusion under | This study |
| pCydX/Flag | Expresses CydX::Flag from | This study |
| Wild type | ||
| ADH3 | Δ | den Hartigh et al., |
| BA41 | Δ | Hong et al., |
| BA582 | Δ | Endley et al., |
| ΔBAB1_0061::Kan in | This study | |
| ΔBAB1_0355::Kan in | This study | |
| ΔBAB1_0513::Kan in | This study | |
| ΔBAB1_0581::Kan in | This study | |
| ΔBAB1_0626::Kan in | This study | |
| ΔBAB1_0743::Kan in | This study | |
| ΔBAB1_0992::Kan in | This study | |
| ΔBAB1_1106::Kan in | This study | |
| ΔBAB1_1194::Kan in | This study | |
| ΔBAB1_1204::Kan in | This study | |
| ΔBAB1_1262::Kan in | This study | |
| ΔBAB1_1390::Kan in | This study | |
| ΔBAB1_1392::Kan in | This study | |
| ΔBAB1_1743::Kan in | This study | |
| ΔBAB1_1748::Kan in | This study | |
| ΔBAB1_1939::Kan in | This study | |
| ΔBAB1_2041::Kan in | This study | |
| ΔBAB2_0160::Kan in | This study | |
| ΔBAB2_0170::Kan in | This study | |
| ΔBAB2_0862::Kan in | This study | |
| ΔBAB2_0761::Kan in | This study | |
| ΔBAB2_0726::Kan in | This study | |
| ΔBAB2_0470::Kan in | This study | |
| ΔBAB2_0450::Kan in | This study | |
| ΔBAB2_0415::Kan in | This study | |
| ΔBAB2_0400::Kan in | This study | |
| ΔBAB2_0232::Kan in | This study | |
| ΔBAB2_1072::Kan in | This study | |
| ΔBAB2_1087::Kan in | This study | |
| ΔBAB2_1036::Kan in | This study | |
| This study | ||
| This study | ||
| de Jong et al., | ||
| This study | ||
| This study | ||
| This study | ||
| de Jong et al., | ||
| Δ | This study | |
| Δ | This study | |
| Δ | This study | |
| BA582 with pGroEL/CydX | This study | |
| BA582 with pGroEL/CydB | This study | |
| BA582 with pGroEL/CydBX | This study | |
Figure A1Strategy for Allelic Exchange Mutagenesis. See Materials and Methods for explanation.
Primers used in this work.
| GBRORF0459 DN-F | TCC | ΔBAB1_0061 |
| GBRORF0459 DN-R | AA | |
| GBRORF0459 UP-F | GTGCACCGCATTTATTGCGT | |
| GBRORF0459 UP-R | TCC | |
| GBRORF0206 DN-F | TCC | ΔBAB1_0355 |
| GBRORF0206 DN-R | AAA | |
| GBRORF0206 UP-F | GCAGGCGCTCAAAATAATGTG | |
| GBRORF0206 UP-R | TCC | |
| GBRORF0049 DN-F | TCC | ΔBAB1_0513 |
| GBRORF0049 DN-R | AA | |
| GBRORF0049 UP-F | CCGGCCTTCATGAGCCGGAT | |
| GBRORF0049 UP-R | TCC | |
| GBRORF2128 DN-F | TCC | ΔBAB1_0581 |
| GBRORF2128 DN-R | AAA | |
| GBRORF2128 UP-F | GGCTCATACCCGCCAAATGCA | |
| GBRORF2128 UP-R | TCC | |
| GBRORF2083 DN-F | TCC | ΔBAB1_0626 |
| GBRORF2083 DN-R | AAA | |
| GBRORF2083 UP-F | CTGCTCAGATCGCCGGATGGC | |
| GBRORF2083 UP-R | TCC | |
| GBRORF1960 DN-F | TCC | ΔBAB1_0743 |
| GBRORF1960 DN-R | AAA | |
| GBRORF1960 UP-F | CCTATGCAGCTTCCACCATTG | |
| GBRORF1960 UP-R | TCC | |
| GBRORF1747 DN-F | TCC | ΔBAB1_0960 |
| GBRORF1747 DN-R | AAA | |
| GBRORF1747 UP-F | GATAGTGCCAGGATAAGGAAA | |
| GBRORF1747 UP-R | TCC | |
| GBRORF1716 DN-F | TCC | ΔBAB1_0992 |
| GBRORF1716 DN-R | AA | |
| GBRORF1716 UP-F | TCCGATTGGGCGTAGCTTAC | |
| GBRORF1716 UP-R | TCC | |
| GBRORF1608 DN-F | TCC | ΔBAB1_1106 |
| GBRORF1608 DN-R | AAA | |
| GBRORF1608 UP-F | GGCGAGAGGGATGAAGATCGA | |
| GBRORF1608 UP-R | TCC | |
| GBRORF1520 DN-F | TCC | ΔBAB1_1194 |
| GBRORF1520 DN-R | AA | |
| GBRORF1520 UP-F | CCTTGGCATGGCGCTGCGTC | |
| GBRORF1520 UP-R | TCC | |
| GBRORF1512 DN-F | TCC | ΔBAB1_1204 |
| GBRORF1512 DN-R | AA | |
| GBRORF1512 UP-F | GTTGTGCTACTTCATTTACG | |
| GBRORF1512 UP-R | TCC | |
| GBRORF1452 DN-F | TCC | ΔBAB1_1262 |
| GBRORF1452 DN-R | AAA | |
| GBRORF1452 UP-F | CAGTGCAGGAACCTTATTGCG | |
| GBRORF1452 UP-R | TCC | |
| GBRORF1325 DN-F | TCC | ΔBAB1_1390 |
| GBRORF1325 DN-R | AAA | |
| GBRORF1325 UP-F | GGCCAGATAGCCCGGAACGA | |
| GBRORF1325 UP-R | TCC | |
| GBRORF1323 DN-F | TCC | ΔBAB1_1392 |
| GBRORF1323 DN-R | AAA | |
| GBRORF1323 UP-F | GCTTGTGACGCTGGAGGAAAA | |
| GBRORF1323 UP-R | TCC | |
| GBRORF0969 DN-F | AC | ΔBAB1_1743 |
| GBRORF0969 DN-R | AC | |
| GBRORF0969 UP-F | ACGCGCGATGGCTCAATGC | |
| GBRORF0969 UP-R | AC | |
| GBRORF0964 DN-F | TCC | ΔBAB1_1748 |
| GBRORF0964 DN-R | AAA | |
| GBRORF0964 UP-F | CCGACACCCAGATTCATGCGC | |
| GBRORF0964 UP-R | TCC | |
| GBRORF0765 DN-F | TCC | ΔBAB1_1939 |
| GBRORF0765 DN-R | AA | |
| GBRORF0765 UP-F | ACGGCGCATGCTTCTTGTCG | |
| GBRORF0765 UP-R | TCC | |
| GBRORF0663 DN-F | TCC | ΔBAB1_2041 |
| GBRORF0663 DN-R | AA | |
| GBRORF0663 UP-F | CCTGCATCTGCAAAGGCC | |
| GBRORF0663 UP-R | TCC | |
| GBRORFA0247 DN-F | TCC | ΔBAB2_0160 |
| GBRORFA0247 DN-R | AAA | |
| GBRORFA0247 UP-F | CCATGGGTATGATGATGCTGC | |
| GBRORFA0247 UP-R | TCC | |
| GBRORFA0258 DN-F | TCC | ΔBAB2_0170 |
| GBRORFA0258 DN-R | AAA | |
| GBRORFA0258 UP-F | CCGCTTCGTCGAACAGGCAAC | |
| GBRORFA0258 UP-R | TCC | |
| GBRORFA1086 DN-F | TCC | ΔBAB2_0232 |
| GBRORFA1086 DN-R | AAA | |
| GBRORFA1086 UP-F | GAAGAAGGCCTTATCTGATCA | |
| GBRORFA1086 UP-R | TCC | |
| GBRORFA0924 DN-F | TCC | ΔBAB2_0400 |
| GBRORFA0924 DN-R | AA | |
| GBRORFA0924 UP-F | GCGTATCAGCCATGCAGGCG | |
| GBRORFA0924 UP-R | TCC | |
| GBRORFA0907 DN-F | TCC | ΔBAB2_0415 |
| GBRORFA0907 DN-R | AAA | |
| GBRORFA0907 UP-F | GCGGATCGGCGAGACTTTTCC | |
| GBRORFA0907 UP-R | TCC | |
| GBRORFA0873 DN-F | TCC | ΔBAB2_0450 |
| GBRORFA0873 DN-R | AAA | |
| GBRORFA0873 UP-F | GGTTTTGCAGTGGCTTCCAG | |
| GBRORFA0873 UP-R | TCC | |
| GBRORFA0854 DN-F | TCC | ΔBAB2_0470 |
| GBRORFA0854 DN-R | AAA | |
| GBRORFA0854 UP-F | CATGTTCAAGCGCACGATCCG | |
| GBRORFA0854 UP-R | TCC | |
| GBRORFA0598 DN-F | TCC | ΔBAB2_0726 |
| GBRORFA0598 DN-R | AAA | |
| GBRORFA0598 UP-F | CGGCGGCTTCGTGCCGGCGC | |
| GBRORFA0598 UP-R | TCC | |
| GBRORFA0563 DN-F | TCC | ΔBAB2_0761 |
| GBRORFA0563 DN-R | AA | |
| GBRORFA0563 UP-F | CGCTTTTTCCCGGCAGCATG | |
| GBRORFA0563 UP-R | TCC | |
| GBRORFA0429 DN-F | TCC | ΔBAB2_0862 |
| GBRORFA0429 DN-R | AAA | |
| GBRORFA0429 UP-F | CAATGCAGGCGCAATTGCAAC | |
| GBRORFA0429 UP-R | TCC | |
| GBRORFA1199 DN-F | TCC | ΔBAB2_1072 |
| GBRORFA1199 DN-R | AAA | |
| GBRORFA1199 UP-F | GGGCACTTCTTCTGCCACGT | |
| GBRORFA1199 UP-R | TCC | |
| GBRORFA0014 DN-F | TCC | ΔBAB2_1087 |
| GBRORFA0014 DN-R | AAA | |
| GBRORFA0014 UP-F | GGCCGCCGTGCTGGCGTTTTG | |
| GBRORFA0014 UP-R | TCC | |
| GBRORFA0062 DN-F | TCC | ΔBAB2_1136 |
| GBRORFA0062 DN-R | AAA | |
| GBRORFA0062 UP-F | CCGCTTCTCACATCCATTTTC | |
| GBRORFA0062 UP-R | TCC | |
| GroEL-P-F | A | Promoter PGroEL |
| GroEL-P-R | A | |
| dTomato-F | A | pGroEL/dsRed |
| dTomato-R | A | |
| A0598-Flag-F | A | pGroEL/CydX |
| A0598 -PstI | A | |
| CydB-F-NdeI | A | pGroEL/CydB |
| CydB-R-PstI | A | |
| CydB-F-NdeI | A | pGroEL/CydBX |
| A0598 -PstI | A | |
| A0598-Flag-F | A | pCydX/FT |
| A0598-Flag-R | A | |
| A0598 -XbaI | A | pFT/CydX |
| A0598 -PstI | A | |
| Promoter-F | TTAG | Promoter PBMEII0192 |
| Promoter-R | A | |
| Flag-F | A | pBBR1Flag |
| Flag-R | A | |
| A0598-Flag-F | A | pCydX/Flag |
| A0598 -PstI | A |
Engineered restriction sites underlined.
Small ORFs (<15 kDa) with no assigned function, which are highly conserved in .
| BAB2_0068 | BRA0069 | BMEII0025 | Type IV secretion system protein virB1 | 0.0023 | 0.0001 |
| BAB1_0061 | BR0064 | BMEI1881 | hypothetical protein | 0.7493 | 1.2039 |
| BAB1_0355 | BR0325 | BMEI1597 | COG1380 LrgA family protein [general function prediction only] | 1.3655 | 0.0153 |
| BAB1_0513 | BR0488 | BMEI1447 | hypothetical protein | 5.6537 | 1.0448 |
| BAB1_0581 | BR0557 | BMEI1376 | COG3654; prophage maintenance system killer protein [general function prediction only] | 1.8387 | 0.5577 |
| BAB1_0626 | BR0602 | BMEI1339 | hypothetical protein | 3.6877 | N |
| BAB1_0743 | BR0725 | BMEI1227 | hypothetical protein [possible relationship to acetyltransferases] | 0.6340 | 0.6160 |
| BAB1_0992 | BR0973 | BMEI1005 | hypothetical protein | 1.1191 | 0.4853 |
| BAB1_1106 | BR1083 | BMEI0899 | COG3617; prophage antirepressor [possible function in transcription] | 1.2815 | 0.6963 |
| BAB1_1194 | BR1173 | BMEI0813 | hypothetical protein | 1.2322 | 0.3799 |
| BAB1_1204 | BR1181 | BMEI0806 | hypothetical protein | 1.3258 | 0.4248 |
| BAB1_1262 | BR1241 | BMEI0751 | hypothetical protein | N | 1.5608 |
| BAB1_1390 | BR1370 | BMEI0633 | COG0239; possible integral membrane protein | N | 1.8630 |
| BAB1_1392 | BR1372 | BMEI0631 | COG3467; predicted flavin nucleotide binding protein [general function prediction only] | N | 1.4038 |
| BAB1_1743 | BR1730 | BMEI0308 | hypothetical protein | 0.6744 | N |
| BAB1_1748 | BR1736 | BMEI0304 | COG1607, Acyl-CoA hydrolase [Lipid metabolism] | N | 1.3140 |
| BAB1_1939 | BR1938 | BMEI0127 | hypothetical protein | 0.4634 | 0.4569 |
| BAB1_2041 | BR2041 | BMEI0030 | DUF188 superfamily | 2.6421 | 0.5280 |
| BAB2_0160 | BRA0162 | BMEII1078 | COG4893; uncharacterized protein conserved in bacteria | 0.6152 | 1.1670 |
| BAB2_0170 | BRA0175 | BMEII1067 | DUF465 superfamily; putative cytosolic protein | 0.2584 | N |
| BAB2_0761 | BRA0476 | BMEII0789 | hypothetical protein | 0.5177 | N |
| BAB2_0726 | BRA0512 | BMEII0758 | Pfam01873; YbgT-like protein | 0.0079 | 0.0001 |
| BAB2_0470 | BRA0769 | BMEII0522 | Pfam05635; family of hypothetical proteins | 0.0002 | 0.0025 |
| BAB2_0450 | BRA0787 | BMEII0503 | hypothetical protein | 0.0435 | 0.0180 |
| BAB2_0415 | BRA0819 | BMEII0468 | hypothetical protein | 1.0595 | 1.2254 |
| BAB2_0400 | BRA0836 | BMEII0454 | hypothetical protein | 1.0501 | 1.8400 |
| BAB2_0232 | BRA1000 | BMEII0296 | hypothetical protein | N | 0.9205 |
| BAB2_1072 | BRA1113 | BMEII0186 | pemK family protein [possible regulator] | 5.1792 | 0.5605 |
| BAB2_1087 | BRA1130 | BMEII0169 | Hypothetical protein [flagellar locus] | N | 1.0841 |
| BAB2_1136 | BRA1177 | BMEII0118 | DUF1634 superfamily | 0.2300 | 0.4828 |
ORF number from NCBI.
Followed B. suis 1330 assignment.
Competitive index (CI): Calculated as Mean Mutants/WT from at least three experiments. N: Not tested.
Competitive index (CI): Calculated as Mean Mutants/WT in spleen of 2–5 mice. N: Not tested.
A previously characterized virB1 mutant (BA41) serves as attenuation phenotype control.
Figure 1Genetic map of the cyd locus in B. abortus 2308 chromosome II. cydA and cydB encode two proteins with similarity to subunit I and II of cytochrome bd-1 terminal oxidase in E. coli. Upstream of cydA and cydB are two predicted ABC transporter genes with similarity to E. colicydD and cydC. Overlapping 23 bp with cydB, cydX encodes a 64 aa protein with one predicted transmembrane domain (shaded), spanning residues 17–35. While no promoter is predicted in front of cydD there is a promoter (PcydAB), possibly driving transcription of cydA, cydB, and cydX. A transcriptional terminator (circled T) is located between cydX and its adjacent open reading frame BAB2_0725. In BA582 (cydB::Tn5) a transposon is inserted in cydB (triangle) while in cydX::Kan part of cydX (hatched) is replaced by a kanamycin resistance determinant without disrupting cydB. (B) Analysis of the cyd gene cluster by RT-PCR. PCR products for the indicated primers with wild type (WT) or cydB::Tn5 mutant (BA582) as a template are shown. The sizes of the predicted amplicons for cydA, cydB, and cydX are 247 bp, 243 bp, and 204 bp, respectively. Control reactions in which reverse transcriptase were omitted had no amplification product (not shown).
Figure 2Characterization of the Loss of viability in stationary phase. Growth kinetics of B. abortus in modified E medium pH 7.0 was monitored by CFU counting at each indicated time point. Each data point represents results of a single assay that was repeated twice. (B) Intracellular survival of the cydX mutant in J774 macrophages. Strain ADH3 (virB2) served as an attenuated control. Data are represented as the mean ± standard deviation (SD) of triplicate samples from one assay that was repeated twice with the same result. Significance of differences was analyzed by One-Way analysis of variance (ANOVA), with a P value of less than 0.05 considered as significant. The dotted line indicates the limit of detection. (C and D) Sensitivity to hydrogen peroxide. Log-phase bacteria were plated on TSA and oxidative killing was determined by measuring the diameter of clear zone surrounding a paper disk soaked with 5 μl of 30% hydrogen peroxide. Large zones of bacterial growth inhibition were observed in both cydX and cydB mutants (Typical photographs were shown). Data in (D) are represented as means of a single assay with five samples ± SD, that was repeated once with the same result. Significance of differences was analyzed by One-Way ANOVA, with P values for pairwise comparisons with P < 0.05 indicated. (E) Sensitivity to sodium azide plus nickel sulfate. Log-phase bacteria growing TSA or TSA supplemented with 0.15 mM NiSO4 and 0.15 mM NaN3 were serially diluted and were plated on TSA for enumeration of surviving bacteria. Survival of treatment with sodium azide plus nickel sulfate was calculated as the ratio of CFU on TSA + NiSO4 /NaN3 to CFU on TSA. While these ratios were approximately 1 for wild type B. abortus, neither cydX mutant nor the cydB mutant survived in the presence of these chemicals. A dotted line indicates the limit of detection of this assay.
Figure 3Complementation of Plasmid-encoded copies of cydB or cydBX, cydXor cydX-FLAG were introduced into cydX and cydB mutants. A plasmid expressing DsRed served as a negative control. (A) Restoration of stationary phase viability was determined as decribed in Figure 2. (B) Sensitivity to 3% Hydrogen peroxide was assayed as described in Figure 2. Significance of differences was analyzed by One-Way ANOVA, with P values for pairwise comparisons with P < 0.05 indicated. (C) Sensitivity to sodium azide plus nickel sulfate was assayed as described in Figure 2. (D) Sensitivity to acid pH. Viability of cultures incubated for 5 h in E-medium adjusted to pH 7.0 or pH 3.5 was assayed as described in the Materials and Methods. Each data point represents results of a single assay that was repeated twice. (E) Survival in J774 mouse macrophages. J774 cells were infected with cydX or cydB mutants containing indicated plasmids. Cells were lysed at 24 and 48 h post-infection. Bacterial CFU were determined by serial dilution and plating on TSA. Data represent the mean of triplicate samples ±SD from a single experiment of three replicates with similar results. Significance of differences was analyzed by One-Way ANOVA, with P values for pairwise comparisons with P < 0.05 indicated. Dotted lines indicate the limit of detection.
Figure 4The C-terminus of CydX is located in the periplasm of Western Blot showing expression levels of β-lactamase fusions to CydX and Glutathione-S-transferase (GST; a cytoplasmic control). Blots were probed with a monoclonal antibody against TEM-1 β-lactamase (right blot). As a loading control, the B. abortus protein Bcsp31 detected using a polyclonal antibody (shown on the left) [Sun et al. (2005)]. (B) Maximum concentration of carbenicillin allowing growth of B. abortus expressing each β-lactamase fusion protein. Plasmid pBBR1mcs4 is a positive control that expresses β-lactamase resistance. pFlagTEM1 is the plasmid carrying TEM-1 β-lactamase lacking its N-terminal sequence and was used for generating N- and C-terminal fusions to CydX and GST. (C) Proposed topological model for CydX in Brucella based on current understanding of cytochrome bd quinol oxidase in E. coli and predicted single transmembrane domain (shaded area) in CydX protein sequence.