Literature DB >> 22916221

A novel nonsense mutation of the GPR143 gene identified in a Chinese pedigree with ocular albinism.

Naihong Yan1, Xuan Liao, Su-ping Cai, Changjun Lan, Yun Wang, Xiaomin Zhou, Yan Yin, Wenhan Yu, Xuyang Liu.   

Abstract

BACKGROUND: The purpose of this study was to elucidate the molecular basis of ocular albinism type I in a Chinese pedigree. METHODOLOGY/PRINCIPAL
FINDINGS: Complete ophthalmologic examinations were performed on 4 patients, 7 carriers and 17 unaffected individuals in this five-generation family. All coding exons of four-point-one (4.1), ezrin, radixin, moesin (FERM) domain-containing 7 (FRMD7) and G protein-coupled receptor 143 (GPR143) genes were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Ocular albinism and nystagmus were found in all patients of this family. Macular hypoplasia was present in the patients including the proband. A novel nonsense hemizygous mutation c.807T>A in the GPR143 gene was identified in four patients and the heterozygous mutation was found in seven asymptomatic individuals. This mutation is a substitution of tyrosine for adenine which leads to a premature stop codon at position 269 (p.Y269X) of GPR143.
CONCLUSIONS/SIGNIFICANCE: This is the first report that p.Y269X mutation of GPR143 gene is responsible for the pathogenesis of familial ocular albinism. These results expand the mutation spectrum of GPR143, and demonstrate the clinical characteristics of ocular albinism type I in Chinese population.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22916221      PMCID: PMC3423421          DOI: 10.1371/journal.pone.0043177

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

Nystagmus is a common symptom of a range of diseases including at least three X-linked disorders, with one of those being ocular albinism type 1 (OA1; MIM 300500) mapped to Xp22.3 [1]. It should be distinguished from the congenital motor nystagmus (CMN), a hereditary disorder characterized by bilateral ocular oscillations that occurs in the absence of any obvious ocular disorders [2]. Identification of the underlying disease of CMN often requires extensive clinical, electrophysiological, psychophysical, and eventually molecular genetic examinations, especially when clinical findings are unrevealing [3], [4]. The prevalence of X-linked OA1 is estimated to be 1 in 50,000 live births. Most male patients with OA1 showed normal skin and hair pigment, but will usually have signs and symptoms of ocular albinism, including nystagmus, poor visual acuity, iris translucency, foveal hypoplasia and albinotic fundus [5], [6]. However, the characteristics of OA1 have not been well defined in Asians. OA1 is caused by mutations in the G protein-coupled receptor 143 (GPR143) gene, originally also known as the OA1 gene [7]. Various types of mutations in GPR143 have been identified in different countries, but X-linked OA1 in the Chinese population was rarely reported [8]. In the present study, a five-generation Chinese family with OA1was recruited. All affected individuals exhibited nystagmus as the main symptom and failed to show photophobia, iris translucency and strabismus. This pedigree was initially considered as congenital nystagmus. Diagnosis of OA1was made by extensive clinical examinations. Four-point-one (4.1), ezrin, radixin, moesin (FERM) domain-containing 7 (FRMD7 candidate gene for CMN) and G protein-coupled receptor 143 (GPR143, candidate gene for OA 1) genes were analyzed.

Methods

Family Recruitment

A five-generation Chinese family with OA1 was recruited in Sichuan (Figure 1). Written informed consent was obtained in accordance with the Declaration of Helsinki before blood samples were taken for analysis (see attachment for details). Three minors were used in this study. Written informed consent was obtained from the guardians on behalf of the minors (see attachment for details). This study was approved by both West China Hospital, Sichuan University Institute Review Board and North Sichuan Medical College Institute Review Board.
Figure 1

The pedigree of X-linked OA1.

A filled square indicates an affected male and a dot in the middle of the circle indicates a carrier. The proband is marked by an arrow. The underline indicates family members enrolled in this study.

The pedigree of X-linked OA1.

A filled square indicates an affected male and a dot in the middle of the circle indicates a carrier. The proband is marked by an arrow. The underline indicates family members enrolled in this study.

Clinical Examination

Complete physical examination and detailed ophthalmological examination were carried out on the subjects of this family, including 4 affected patients, 7 carriers and some asymptomatic individuals. Visual acuity (VA) was measured using the best-corrected Snellen visual acuity test. Fundus and OCT examinations were performed using fundus camera (nonmyd WX 3D, Kowa, Japan) and Spectralis OCT (Heidelberg Engineering, Germay).

Mutation Screening and Sequence Analysis

Genomic DNA was extracted from 200 µl of peripheral blood using the standard phenol/chloroform method. DNA integrity was evaluated by 1% agarose gel electrophoresis. Mutation analysis of FRMD7 and GPR143 was performed using PCR and direct sequencing. Primers were designed to cover the sequences of all coding exons of the genes, according to published primer sequences with some modification (Table 1) [9], [10]. The primers were synthesized by Invitrogen (Carlsbad, CA, USA). PCRs were carried out in a MyCycler thermocycler (Bio-Rad, Hercules, CA, USA) using the following program: initial denaturation at 95°C for 2 min followed by 35 cycles of 94°C for 10s, 54°C–56°C for 30s, and 72° for 1 min, and then a final extension at 72°C for 5 min.
Table 1

Primers used in PCR for amplification of FRMD7 and GPR143.

ExonPrimer directionSequence (5′→3′)Annealing temperature (°C)Product size (bp)
1FRMD7-1F GAGAAAGCACCCACAGCACT 56229
FRMD7-1R CAGTCCTCCTTCATTCAGTCC
2FRMD7-2F TGTGGCTTCTACCCTTTATTC 54403
FRMD7-2R AGTGTTGGGATTACAGGCAT
3FRMD7-3F TGGAGCAGTGATTCAAATGTC 54336
FRMD7-3R TCTAACTGTGAACTCTCTTCCT
4FRMD7-4F CCTATAACTGTTGTGATGGAC 54260
FRMD7-4R CATCTCCCAGACAGTGACTTA
5FRMD7-5F TGCCAAAGTGTTCAATCAGC 54368
FRMD7-5R CTCCTGTGCTTGGTTCTCTA
6+7FRMD7-6F TGGAGGACAAGGGTATGCT 55642
FRMD7-6R GTGATAATACTGAGGGGTGAG
8FRMD7-7F GACCACAGCTCCTACCCAGT 56374
FRMD7-7R AAAGACACACCATCACTCAGG
9FRMD7-8F GAGCAATAGTTTGGAAGGCAT 54293
FRMD7-8R AAGAAGCAGTGTGAGCAGTTT
10+11FRMD7-9F TGTTCTCTGCCTGGTCCTTG 55532
FRMD7-9R TTTACACACTGGGATTCTGG
12FRMD7-10F CTACCCTAGAATAGAACATGGA 54702
FRMD7-10R ATTCCTTGGGCTTCTTTCAG
12FRMD7-11F GGAAAGGACAAGTCCACATA 54660
FRMD7-11R TTCTGCCTAAGTCGGTAACA
1GPR-1F AACCTTCCCAACCTTTCTGC 55698
GPR-1R CCTCTCGTCCTCACTCCATC
2GPR-2F CAGTGAGCAGGGTTTTTACCA 55537
GPR-2R AACAGACTCCCAGGGTTTGC
3GPR-3F GTCTACCCTGCCGTCTCAAG 56334
GPR-3R TGAGCTGCTGTGGATGTTTC
4GPR-4F CTCAGCAGCACGAGGAAACT 56465
GPR-4R ACAAACGAGAAAGGCAGAGC
5GPR-5F CTTAGGGGTCCTCCCATTTC 55575
GPR-5R TGGCACTGAGCTAACAAACG
6GPR-6F TCAGTGACTTGCTTTGCTTCCT 54387
GPR-6R TCCTCAAAGGGCACCTAGCA
7GPR-7F GCACCTGGCCCTCTTAGTTT 55458
GPR-7R ACCTGTAGTCCCAGTTACTCA
8GPR-8F ATGGTCCCTTCCAAGCGAGT 56494
GPR-8R GTTCACATGAGAGGTGCTGCT
9GPR-9F ACTCCATGCACTGAATACTGA 54485
GPR-9R GGATGTGGACCTTACACTTACT
PCR products were directly sequenced using an ABI 377XL automated DNA sequencer (Applied Biosystems, Foster City, CA), and analyzed with the DNAStar (Madison, WI) software and compared with the published FRMD7 and GPR143 sequences. Mutation was named according to the nomenclature recommended by the Human Genomic Variation Society (HGVS).

Results

Clinical Phenotype

In this five-generation Chinese family, the disease was transmitted from female carrier to affected son, indicating that the disease was inherited in an X-linked recessive pattern (Figure 1). The clinical characteristics of OA1 in this pedigree are described as in Table 2, Figure 2 and 3.
Table 2

Summary of clinical features of affected males and female carriers.

IDGenderAgeVisual acuity (left/right)Iris hypopigmentationFundus hypopigmentationFundus foveal hypoplasiaNystagmusMutation
patients
III:19Male470.05/0.1NoYesYesYeshemizygous
III:21Male470.01/0.01NoYesYesYeshemizygous
III:30Male420.2/0.2MildNoYesYeshemizygous
IV:19Male210.1/0.1NoYesYesYeshemizygous
Carriers
II6Female780.05/0.05NoCataract, Unclear fundusCataract, Unclear fundusNoheterozygous
II:10Female640.8/0.8NoNoNoNoheterozygous
II:12Female620.6/0.6NoNoNoNoheterozygous
III:18Female550.7/0.7NoNoNoNoheterozygous
III:24Female440.8/0.8NoNoNoNoheterozygous
IV:16Female201.0/1.0 (best corrected)NoYes (High myopia)NoNoheterozygous
IV:17Female240.8/0.8NoNoNoNoheterozygous
Figure 2

Fundus photographs of three patients, one carrier and one normal individual.

A–F: three patients; G–H: one carrier; I–J: one normal individual.

Figure 3

OCT test photographs of three patients, one carrier and one normal individual.

A–F: three patients; G–H: one carrier; I–J: one normal individual. It should be noted that detailed structural imaging of the fovea was not successfully obtained in two patients (III:19 and III:30) with more severe nystagmus due to their poor fixation. Foveal image of one patient (IV:19) with relatively mild nystagmus was obtained.

Reduced Visual Acuity and Nystagmus

All four patients presented with nystagmus and reduced visual acuity (corrected visual acuity of 0.01–0.2). The nystagmus was present during their first three months after birth. Eye movement recording revealed that the patients had conjugate horizontal nystagmus. The proband (patient III:30, Figure 1), a forty-two-year-old male, presented with nystagmus with best corrected visual acuity being 0.2 OD and 0.2 OS. He presented with nystagmus and congenital cataract on the fortieth day after birth and underwent cataract extraction and intraocular lens implantation at the age of 41. No pigmentation abnormality of skin and hair was observed in the participants. Ocular abnormalities were not found in other asymptomatic members examined in this family.

Presence of Hypopigmentation in the Fundus and Foveal Hypoplasia

Compared with normal individuals (Figure 2, I, J), the patients (III:19, IV:19) exhibited an albinotic fundus (Figure 2, A, B, C, D, E, F). All of the patients had foveal hypoplasia. The OCT showed extension of all neurosensory retinal layers through the area in which the fovea would normally be located (Figure 3). The clinical features of affected males and female carriers were shown in Table 2.

GPR143 Mutation Identification and Analysis

A novel nonsense mutation, c.807T>A, at codon 807 (TAT to TAA) of exon 7 in GPR143 gene was identified in all affected males. This mutation was presented as heterozygous in all obligate female carriers, and it was not found in normal members of the family. The c.807T>A mutation caused a substitution of tyrosine leading to a premature termination codon at position 269 (p.Y269X) of GPR143 protein.

Discussion

A Chinese family with “congenital” nystagmus as the main symptom was reported in this study. There is no difference in iris pigmentation between patients (except the proband) or carriers and normal individuals in this family. The patients presented with only mild hypopigmentation in fundus. The presence of foveal hypoplasia could be ignored since the macular morphology could not be easily obtained by OCT due to the poor fixation of the nystagmus eye of the patients. Therefore this Chinese family was considered originally as congenital nystagmus. Preising et al. reported that nystagmus, macular hypoplasia and hypopigmentation of the fundus were the characteristic signs of ocular albinism which are more reliable in identifying patients with albinism [6], [11]. For the molecular diagnosis of this pedigree, the FRMD7 gene (candidate gene for congenital nystagmus) and GPR143 gene (candidate gene for OA1) were analyzed. The sequence analysis of GPR143 demonstrated a novel nonsense mutation (p.Y269X) in exon 7. All affected males were hemizygous for the mutation and female carriers were heterozygous for the mutation whereas the other normal members of the family had no mutation. Another gene, FRMD7, involved in the development of congenital nystagmus, was screened and no mutation was found. Thus, the results of clinical and genetic findings provide solid evidence showing that this Chinese family has X-linked OA1, and the p.Y269X mutation of GPR143 is responsible for the pathogenesis.

Fundus photographs of three patients, one carrier and one normal individual.

A–F: three patients; G–H: one carrier; I–J: one normal individual. Bassi et al. (1995) cloned GPR143 gene for ocular albinism type 1 from the distal short arm of the X chromosome [1]. Also in 1995, Schiaffino et al. screened GPR143 gene and detected various mutations in one-third of X-linked ocular albinism (XLOA) patients [7]. To date, about one hundred mutations of GPR143 were deposited in Human Gene Mutation Database (HGMD), including deletion, frameshift, and nonsense mutations. Most of GPR143 mutations were reported in a large collection of patients mainly with ocular albinism [12], [13], [14], [15]. In 2001, Preising et al. reported an X-linked CN family with ocular albinism and found 14 bp deletion in GPR143 gene [6]. In 2007, Liu et al. identified a novel missense GPR143 mutation in a large Chinese family with CN as the most prominent and consistent manifestation [16]. In more recent years, GPR143 mutations have been identified in the other two Chinese families with X -linked CN without any classical phenotype of OA1. One family had a 37 bp deletion mutation in exon 1 of GPR143 [17]. The other family had a 19 bp duplication in exon 1 of GPR143 and all affected individuals exhibited nystagmus [10]. These two reports did not present sufficient clinical data to evaluate their hypothesis of isolated nystagmus from GPR143 variants. Preising et al. suggested male patients with congenital nystagmus were candidates for X-linked OA and a thorough clinical examination was needed [11]. Furthermore, analysis of the FRMD7 and GPR143 genes would be helpful to distinguish these two conditions from the molecular level.

OCT test photographs of three patients, one carrier and one normal individual.

A–F: three patients; G–H: one carrier; I–J: one normal individual. It should be noted that detailed structural imaging of the fovea was not successfully obtained in two patients (III:19 and III:30) with more severe nystagmus due to their poor fixation. Foveal image of one patient (IV:19) with relatively mild nystagmus was obtained. GPR143 on chromosome Xp22.3 contains 9 exons and encodes a protein of 404 amino acids containing seven putative transmembrane domains and one potential N-glycosylation site using an asparagine at codon 106 [18]. GPR143 protein is a conserved integral membrane protein that has weak similarities to G protein-coupled receptors (GPCRs), which participate in the most common signal transduction system at the plasma membrane. It binds heterotrimeric G proteins, which suggests that GPR143 GPCR-mediated signal transduction systems also operate at the internal membranes in mammalian cells [19]. The p.Y269X mutation identified in our study was predicted to result in a truncated protein with 269 amino acids shorter than the normal full-length protein, suggesting that this is a loss-of-function mutation. Furthermore, the mutated transcript is likely to be degraded by the nonsense-mediated mRNA decay (NMD) pathway. This hypothesis assumed that the truncated protein may not even be produced. It is unclear how the mutated GPR143 causes the ocular abnormalities, such as macular hypoplasia in people with ocular albinism. Lopez et al. proposed that L-3, 4-dihydroxyphenylalanine (L-DOPA) might be a ligand for the protein encoded by GPR143 [20]. L-DOPA is a precursor in melanin synthesis that has been considered as an antimitogenic factor in cell cycle regulation, playing a crucial role in the maturation of the retina and the optic nerve [21], [22]. GPR143 is not involved in the production of melanin itself, but rather the pigment distribution or production of a precursor like L-DOPA as a cause of developmental anomalies of macular development. The impaired macular development might then cause the vision loss and nystagmus [11], as reported in this study. The ocular disorders should be eliminated before the diagnosis of congenital motor nystagmus can be made. However, some diseases such as OA1 can be ignored or misdiagnosed. In general, OA1 is characterized by presence of photophobia, congenital nystagmus, strabismus, iris translucency, hypopigmentation of the ocular fundus, foveal hypoplasia, and impaired vision [23]. In African-American males, iris color is usually brown with little iris translucency (compared to Caucasians where iris translucency is more common) and individuals with darker skin may have scattered hypopigmented macules, but this is rarely seen in the skin of Caucasian individuals [24], [25]. The characteristics of OA1 have not been well defined in Asians. There were Chinese pedigrees of congenital nystagmus reported showing that the patients in these families had very similar symptoms as those in our pedigree. It is interesting to reevaluate these pedigree to make sure the diagnosis of “congenital nystagmus”, not “ocular albinism”, is correct, and the impression that OA1 has rarely seen in China is correct. In summary, this study adds a novel nonsense mutation to the existing spectrum of GPR143 mutations in Chinese families with X-linked OA1. The specific molecular mechanism by which these GPR143 mutations result in OA1 is still unknown, further functional studies are needed to provide new insights to this inherited ocular disease.
  25 in total

1.  Retinal cell addition and rod production depend on early stages of ocular melanin synthesis.

Authors:  M Ilia; G Jeffery
Journal:  J Comp Neurol       Date:  2000-05-15       Impact factor: 3.215

2.  Clinical features of affected males with X linked ocular albinism.

Authors:  S J Charles; J S Green; J W Grant; J R Yates; A T Moore
Journal:  Br J Ophthalmol       Date:  1993-04       Impact factor: 4.638

3.  Visual system anomalies in human ocular albinos.

Authors:  D Creel; F E O'Donnell; C J Witkop
Journal:  Science       Date:  1978-09-08       Impact factor: 47.728

4.  X-linked ocular albinism in Blacks. Ocular albinism cum pigmento.

Authors:  F E O'Donnell; W R Green; J A Fleischman; G W Hambrick
Journal:  Arch Ophthalmol       Date:  1978-07

Review 5.  New insights into ocular albinism type 1 (OA1): Mutations and polymorphisms of the OA1 gene.

Authors:  William S Oetting
Journal:  Hum Mutat       Date:  2002-02       Impact factor: 4.878

6.  Deletion in the OA1 gene in a family with congenital X linked nystagmus.

Authors:  M Preising; J P Op de Laak; B Lorenz
Journal:  Br J Ophthalmol       Date:  2001-09       Impact factor: 4.638

7.  Mutational analysis of the OA1 gene in ocular albinism.

Authors:  Olivier Camand; Sandrine Boutboul; Laurence Arbogast; Olivier Roche; Claude Sternberg; Joanne Sutherland; Alex Levin; Elise Héon; Maurice Menasche; Jean Dufier; Marc Abitbol
Journal:  Ophthalmic Genet       Date:  2003-09       Impact factor: 1.803

8.  X-linked ocular albinism. An oculocutaneous macromelanosomal disorder.

Authors:  F E O'Donnell; G W Hambrick; W R Green; W J Iliff; D L Stone
Journal:  Arch Ophthalmol       Date:  1976-11

9.  Screening of TYR, OCA2, GPR143, and MC1R in patients with congenital nystagmus, macular hypoplasia, and fundus hypopigmentation indicating albinism.

Authors:  Markus N Preising; Hedwig Forster; Miriam Gonser; Birgit Lorenz
Journal:  Mol Vis       Date:  2011-04-15       Impact factor: 2.367

10.  Identification of three novel OA1 gene mutations identified in three families misdiagnosed with congenital nystagmus and carrier status determination by real-time quantitative PCR assay.

Authors:  Valérie Faugère; Sylvie Tuffery-Giraud; Christian Hamel; Mireille Claustres
Journal:  BMC Genet       Date:  2003-01-07       Impact factor: 2.797

View more
  9 in total

1.  A novel nonsense mutation of GPR143 gene in a Korean kindred with X-linked congenital nystagmus.

Authors:  Ungsoo Samuel Kim; Eunhae Cho; Hyon J Kim
Journal:  Int J Ophthalmol       Date:  2016-09-18       Impact factor: 1.779

2.  Identification of a novel GPR143 mutation in X-linked ocular albinism with marked intrafamilial phenotypic variability.

Authors:  Jae-Ho Jung; Eun Hye Oh; Jin-Hong Shin; Hyang-Sook Kim; Seo Young Choi; Kwang-Dong Choi; Changwook Lee; Jae-Hwan Choi
Journal:  J Genet       Date:  2018-12       Impact factor: 1.166

3.  A FRMD7 variant in a Japanese family causes congenital nystagmus.

Authors:  Tomohiro Kohmoto; Nana Okamoto; Shigeko Satomura; Takuya Naruto; Takahide Komori; Toshiaki Hashimoto; Issei Imoto
Journal:  Hum Genome Var       Date:  2015-02-12

4.  Molecular genetic and clinical evaluation of three Chinese families with X-linked ocular albinism.

Authors:  Xuan Zou; Hui Li; Lizhu Yang; Zixi Sun; Zhisheng Yuan; Huajin Li; Ruifang Sui
Journal:  Sci Rep       Date:  2017-02-17       Impact factor: 4.379

5.  A novel GPR143 mutation in a Chinese family with X‑linked ocular albinism type 1.

Authors:  Xuhui Gao; Tiecheng Liu; Xuan Cheng; Aiai Dai; Wei Liu; Runpu Li; Maonian Zhang
Journal:  Mol Med Rep       Date:  2019-11-12       Impact factor: 2.952

6.  Genotype-Phenotype Analysis and Mutation Spectrum in a Cohort of Chinese Patients With Congenital Nystagmus.

Authors:  Xiao-Fang Wang; Hui Chen; Peng-Juan Huang; Zhuo-Kun Feng; Zi-Qi Hua; Xiang Feng; Fang Han; Xiao-Tao Xu; Ren-Juan Shen; Yang Li; Zi-Bing Jin; Huan-Yun Yu
Journal:  Front Cell Dev Biol       Date:  2021-02-19

Review 7.  Putative role of HIF transcriptional activity in melanocytes and melanoma biology.

Authors:  Blazej Zbytek; Danielle L Peacock; Tiffany N Seagroves; Andrzej Slominski
Journal:  Dermatoendocrinol       Date:  2013-04-01

8.  A novel missense mutation in the FERM domain containing 7 (FRMD7) gene causing X-linked idiopathic congenital nystagmus in a Chinese family.

Authors:  Zhirong Liu; Shanying Mao; Jiali Pu; Yao Ding; Baorong Zhang; Meiping Ding
Journal:  Mol Vis       Date:  2013-08-06       Impact factor: 2.367

9.  Identification of three novel mutations in the FRMD7 gene for X-linked idiopathic congenital nystagmus.

Authors:  Xiao Zhang; Xianglian Ge; Ying Yu; Yilan Zhang; Yaming Wu; Yin Luan; Ji Sun; Jia Qu; Zi-Bing Jin; Feng Gu
Journal:  Sci Rep       Date:  2014-01-17       Impact factor: 4.379

  9 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.