Literature DB >> 22883984

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia.

Afnan Saeid Zuiter1, Jammal Sawwan, Ayed Al Abdallat.   

Abstract

BACKGROUND: Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required.
FINDINGS: Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants.
CONCLUSION: To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Entities:  

Mesh:

Substances:

Year:  2012        PMID: 22883984      PMCID: PMC3492024          DOI: 10.1186/1756-0500-5-427

Source DB:  PubMed          Journal:  BMC Res Notes        ISSN: 1756-0500


Background

Hawthorn (Crataegus spp.) is a member of the Rosaceae family, belonging to the Spiraeoideae subfamily in the Pyroidae supertribe in the Pyreae subtribe [1]. There are approximately 280 species in the genus Crataegus, which are widely distributed across the Mediterranean, North Africa, Europe, Central and Eastern Asia and North America [2]. In the eastern Mediterranean region, the predominant Crataegus species is C. aronia L., which is found on dry hillsides, mountains and in areas receiving more than 300 mm annual rainfall [3]. In folk medicine, a decoction of Crataegus leaves and unripe fruits has been used to treat disorders such as cardiovascular diseases, cancer, diabetes, and impotence [2,4]. The medicinal properties of Crataegus are primarily related to its antioxidant activities and the reduction of free radical-induced oxidative stress [5,6], mediated by secondary metabolites, such as flavonoids, oligomeric Proanthocyanidins (PAs), ethanobotanical and ethanopharmacological compounds [7]. PAs, also known as condensed tannins, are polyphenolic compounds formed as a branch of the flavonoid biosynthetic pathway [8]. PAs are found in the fruits, bark, leaves and seeds of many plants including Crataegus[2,9] and their function include defense against herbivores and resistance to abiotic stresses [9]. They are also important quality components of many fruits, providing the flavor and color to beverages [10]. The PAs biosynthesis pathway and its regulatory genes have been dissected genetically and biochemically in a number of plants [11] including Arabidopsis[12,13]Vitis vinifera[10,14,15], bilberry (Vaccinium myrtillus) [16], soybean (Glycine max) [17] and persimmon (Diospyros kaki) [18], but not in Crataegus. Therefore, there is a need to identify DNA sequences encoding phenylpropanoid biosynthesis enzymes in Crataegus. In this study, bioinformatics tools were used to design specific primers to amplify DNA sequences of key genes encoding enzymes involved in the PAs biosynthetic pathway in C. aronia.

Findings

Designing of Primers for the Isolation of PAs Biosynthetic genes

First, DNA sequences encoding PAs biosynthetic enzymes from four different Pyreae subtribe genera were retrieved from the NCBI databases, which resulted in several DNA sequences representing ten selected PAs biosynthesis enzymes (Additional file 1: Table S1). All the DNA sequences were complete coding regions, except for the 4-Cl gene. BLAST searching with the selected DNA sequences retrieved related DNA sequences from different plant, including DNA sequences encoding PAs biosynthetic enzymes from the Spiraeoideae, Rosaceae, Rosales and Fabids taxa (data not shown). All retrieved sequences were analyzed for their nucleic acid type (genomic DNA or mRNA or EST), the presence or absence of introns, their length (partial or full length) and for their redundancy in different nucleotide databases. Overlapping partial DNA sequences were gathered and assembled into contigs using the VectorNTI software. Finally, the DNA sequences of each PAs biosynthetic gene were grouped according to their taxon and then used to design universal primers using alignment PCR analysis in the VectorNTI software. To design of PAs biosynthesis genes specific primers, multiple sequence alignment (MSA) analysis was performed initially among all retrieved DNA sequences from selected taxa using ClustalW in the Vector NTI suite. The MSA results were inspected and filtered to exclude DNA sequences with low levels of similarity and wide gaps. Secondary and tertiary MSAs were performed on the most similar DNA sequences until the aligned sequences showed large areas of sequence similarity. Additional file 2 shows the ANS genes’ alignment as an example. In general, conserved regions in the DNA sequences of PAs biosynthetic enzymes were identified in groups of closely related genera in the Rosaceae family, with some exceptions (data not shown). Alignment PCR analysis was then performed and the most suitable primers for PCR amplification of targeted genes in Rosaceae plants were selected and subjected to further analysis (Table 1).
Table 1

Characteristics of the designed primers specific for PAs biosynthesis genes used in this study

Gene namePrimerPrimer sequence (5' → 3')Tm°Ca
ANR
ANRFwd1
CCCACCTMACAGCACTACAA b
53.8
ANRRev1
TACCGACCAGAAGCAGATTC
51.8
ANRFwd2
GGAGTGATTTGGAGTTCTTG
49.7
ANRRev2
GGAAAATCTCCAAACTCAGT
47.7
ANS
ANSFwd1
TTTGAYCTTCCCATTGAGCA
49.7
ANSRev1
GCATTTTGGGTAGTAGTTGA
47.7
ANSFwd2
CAGCTTGAGTGGGAGGAYTA
53.8
ANSRev2
GCAGGCCRGGAACCATGTTG
57.9
4-CL
4-CLFwd1
CCTGGAGAGATTTGCATCAG
51.8
4-CLRev1
AATACTCGATTTATTCTTTTATA
42.8
4-CLFwd2
ATCATGAAAGGTTAYCTTAATG
45.5
4-CLRev2
GGAATGGCTTCGATGAAAAA
47.7
CHI
CHIFwd1
AGGGGGTYGGAGATTCAGGG
55.9
CHIRev1
GGGAAGKTTTGATCYTTGAA
45.6
CHIFwd2
TTCGTGAAGTTCACGGCGAT
51.8
CHIRev2
TGGGAAGGTCTGATCTTTGA
49.7
C4H
C4HFwd1
CTCCGYATGGGRCAGCGCAA
60
C4HRev1
TTGTTGTACATCATMAGCTG
47.7
C4HFwd2
CAGCTBATGATGTACAACAA
47.7
C4HRev2
TGGATTTCRGGGTGGTTCAC
53.8
CHS
CHSFwd1
AAGGCCATYAAGGAATGGGG
53.8
CHSRev1
AATGTRAGCCCDACTTCACG
53.8
CHSFwd2
AAGGAATGGGGHCAGCCCAA
55.9
CHSRev2
CTCACYTCRTCCAAAATAAA
47.7
DFR
DFRFwd1
CCTGACGCTGTGGAAGGCGG
60
DFRRev1
TAATGGTRATGAAATCAATG
43.6
DFRFwd2
TGCASCGGAGTGTTYCATGT
53.8
DFRRev2
TGAGGCTTGGTGGCATRGATGG
58.6
LAR
LARFwd1
GTTCGTMGCYGAAGCCAGCC
60
LARRev1
TGGAACYGATCCAACGGTGG
55.9
LARFwd2
AGGGCYRATCCGGTKGAACC
60
LARRev2
AGGGTSCGRCCAATTTTCTT
51.8
F3H
F3HFwd1
GACATGTCCGGYGGCAAAAAGGG
60.6
F3HRev1
CTCATCTTCTTCTTGTACAT
45.6
F3HFwd2
ACGTGGATCACCGTTCAACC
53.8
F3HRev2
GGTTGAACGGTGATCCACGT
53.8
PALPALFwd1
ATCGATGTTTCRAGGAACAA
47.7
PALRev1
AAAGAGTTAACATCTTGGTT
43.6
PALRev2AAAAATGTRGAAGACATGAG45.6

a Melting temperature.

b Degenerate nucleotides codes where B (C/G/T), D (A/G/T), H (A/C/T), K (G/T), M (A/C), N (A/C/G/T), R (A/G), S (G/C), V (A/C/G), W (A/T), Y (C/T).

Characteristics of the designed primers specific for PAs biosynthesis genes used in this study a Melting temperature. b Degenerate nucleotides codes where B (C/G/T), D (A/G/T), H (A/C/T), K (G/T), M (A/C), N (A/C/G/T), R (A/G), S (G/C), V (A/C/G), W (A/T), Y (C/T). To validate the alignment PCR results, the primers were BLAST searched against the nucleotide databases of the Genome Database for Rosaceae ( http://www.rosaceae.org) and against the NCBI GenBank nucleotide databases of flowering plants. As expected, the percentage of similarity between the designed primers and the DNA sequences of the targeted PAs genes in the Rosaceae family was very high, with minor exceptions for Malus, Prunus and Fragaria spp. (see Additional file 3). In addition, many of the primers were conserved in different flowering plants, including grape, soybean, arabidopsis and poplar (data not shown). However, some low similarity (one or two mismatches) between the designed primers and the DNA sequences of the targeted PAs genes in some Rosaceae family members were observed (data not shown). To resolve this, degenerate nucleotides were included in the primer sequences to ensure their functionality with different plants from the Rosaceae family (Table 1).

Testing the designed primers using RT-PCR in different Rosaceae plants

The efficiency of the designed primers in amplifying DNA fragments of the corresponding PAs biosynthesis genes from C. aronia was tested using RT-PCR. In general, DNA fragments of C. aronia PAs biosynthesis genes were successfully amplified using cDNA prepared from C. aronia callus cells and different combinations of designed primers (Additional file 4; Figure 1). Successful primer combinations produced PCR amplicons from C. aronia cDNA of the expected size of the corresponding DNA fragments in the target gene.
Figure 1

Semi-quantitative RT-PCR expression patterns of the PAs biosynthesis genes: , , , and in callus (C), apple (A), strawberry (S) and peach (P). Amplification products were separated on a 1% agarose gel. The primers combinations for each gene are indicated in additional file 4.

Semi-quantitative RT-PCR expression patterns of the PAs biosynthesis genes: , , , and in callus (C), apple (A), strawberry (S) and peach (P). Amplification products were separated on a 1% agarose gel. The primers combinations for each gene are indicated in additional file 4. DNA sequencing of the positive amplicons confirmed the results of the RT-PCR analysis (data not shown). The sequencing data were further analyzed using bioinformatics tools, such as BLAST searching against the Genome Database for Rosaceae ( http://www.rosaceae.org) and the NCBI GenBank nucleotide databases of flowering plants. DNA sequencing results and bioinformatics analysis of the amplicons confirmed that the PCR products were DNA fragments of PAs biosynthesis genes from C. aronia. To test designed primers’ ability to amplify PCR products in different Rosaceae plants, the most successful primer combinations in C. aronia (Additional file 4) were tested using cDNA prepared from leaf samples from apple, strawberry and peach. The designed primers successfully amplified PCR products from cDNA prepared from C. aronia callus tissue, apple, strawberry and peach (Figure 1).

Discussion

To gain better understanding of the PAs biosynthesis pathway and the mechanism governing their synthesis in plants, several genes encoding PAs biosynthetic enzymes have been isolated [10-19]. Metabolic and genetic engineering systems have used this genetic information to boost the production of PAs in different plants [20,21]. In the present study, alignment PCR was used to design functional primers for genes encoding PAs biosynthetic enzymes in Rosaceae plants. Partial DNA sequences were obtained for 10 targeted genes encoding PAs biosynthetic enzymes from C. aronia using the designed primers. Many of the designed primers are conserved across different plant species, indicating that they could be used to obtain genes encoding PAs biosynthetic enzymes in non-related organism. The conserved primers might be used in colinearity and comparative genomics studies between highly related species [22]. The alignment PCR approach easily, specifically and effectively produced DNA sequences from the targeted genes in different plant species. Degenerate primers, rapid amplification of cDNA ends (RACE) primer technology and PCR-based walking strategies were used to characterize PAs biosynthetic enzyme genes ANR, ANS, F3H, DFR, LAR and FS in strawberry [23]. In that study, the degenerate primers were designed using MSA based on protein sequences. The same strategy was used to amplify full-length coding sequences of the ANR and LAR genes from grape [10]. Compared with the alignment PCR analysis, the degenerate primers approach is based on extracting DNA sequences from conserved amino acids in homologous proteins [24]. The degenerate primers are designed to amplify related but not identical DNA sequences. Such an approach might result in lower specificity of the designed primers and increase probability of producing non-targeted amplicons [24,25]. Several public databases have been developed for designing universal primers for a particular gene across different taxa, e.g. UniPrime [26], and UniPrime2 [27]. The alignment PCR protocol described in this study adapts the same principles, parameters and approaches for universal primers design described in the public databases. However, such databases are not suited for partial CDS sequences that are difficult to handle in MSA analysis. In this study, several partial DNA sequences retrieved from EST databases were subjected to contig assembly to produce full-length DNA sequences that were easier to analyze using MSA. The contig assembly of partial CDS approach could be used to improve currently existing public universal primers databases.

Conclusions

In this study, genetic information related to 10 different genes encoding PAs biosynthetic enzymes from C. aronia plant were obtained. Such information can be used to clone the full-length gene sequences from C. aronia. The information can also be used to improve PAs production in C. aronia using genetic engineering and tissue culture systems developed specifically for this plant species [28]. The designed primers showed high levels of sequence similarity with their corresponding genes in different Rosaceae plants; therefore, they could be used to isolate DNA fragments of PAs genes from different Rosaceae plants.

Methods

Plant material

Callus cultures of C. aronia were established as described previously [28]. To test the functionality of the identify primers with other Rosaceae species, leaf samples from apple (Malus domestica), peach (Prunus persica) and strawberry (Fragaria x ananassa) were used.

Bioinformatics analysis

First, DNA or protein sequences of the targeted PAs biosynthetic enzymes in Crataegus and closely related plant species and genera were retrieved from NCBI GenBank databases (Additional file 1: Table S1). The sequences were subjected to different BLAST algorithms to gather DNA sequences of the corresponding PA biosynthesis from different plant taxa, especially the Pyreae subtribe, Pyrodae supertribe, Spiraeoideae subfamily, Rosaceae family, Rosales order and Fabids. The obtained BLAST results were filtered and the best hits (expectation value (ΔE) less than 1e-50) were chosen for alignment PCR analysis. The retrieved DNA sequences were subjected to MSA analysis using the ClustalW program in the Vector NTI™ Suite version 11.5 (Invitrogen, Carlsbad, CA, USA). The MSA results were used to design taxa specific primers based on conserved DNA sequences, using alignment PCR and ‘primer design’ tools, as described in the VectorNTI Suite version 11.5 manual. Finally, the best primers combinations were selected for the PCR analysis.

RNA extraction and reverse transcription PCR

Callus cells of C. aronia and leaf samples of different Rosaceae plants were used to extract total RNA using the EZ-10 Spin Column Total RNA Mini-Preps Super Kit (Biobasic Inc., Ontario, Canada), following the manufacturer’s instructions. For reverse transcription (RT) -PCR analysis, 1 μg of the isolated total RNA samples were converted into first-strand cDNA using the GoScriptTM reverse transcription kit (Promega, Madison, Wisconsin), following the manufacturer’s instructions. The synthesized cDNAs were used as PCR templates to amplify DNA fragments encoding PAs biosynthetic enzymes. The PCR was performed in an Applied Biosystems 9700 thermocycler (Applied Biosystems, Carlsbad, CA, USA) using the i-MAXII PCR Master Mix solution (iNtRON Biotechnology, Seoul, Korea) and different primer combinations (Table 1). The 25 μl reactions contained 2.5 μl of the synthesized cDNA, 0.5 μM of each primer and 12.5 μl of i-MAXII solution, following the manufacturer's instructions. The PCR conditions were 94°C for 5 min; 35 cycles of 94°C for 45 seconds, 50–60°C (depending on the primer combination) for 30 seconds, and 72°C for 1 minute; and a final extension at 72°C for 10 minutes. The PCR products were separated on 1.5% agarose gels and visualized using the Safe Red stain (iNtRON Biotechnology, Seoul, Korea) using Gel Doc™ XR + (BioRad, Hercules, CA). DNA fragments of the expected sizes were excised from the agarose gel and extracted using the Wizard® SV Gel and PCR Clean-up System (Promega, Madison, Wisconsin), following the manufacturer’s instructions. The DNA fragments were sequenced using an ABI 3730XL DNA sequencer by Macrogen Inc. (Seoul, Korea).

Abbreviations

ANR: Anthocyanidin reductase;ANS: Anthocyanidin synthase;C4H: Cinnamate 4-hydroxylase;CHI: Chalcone isomerase;CHS: Chalcone synthase;4-CL: 4-Coumarate:coenzyme A ligase;DFR: Dihydroflavonol reductase;F3H: Flavonoid 3-hydroxylase;LAR: Leucoanthocyanidin reductase;MSA: Multiple sequence alignment;PAL: Phenylalanine ammonia lyase;PAs: Proanthocyanidins.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

ASZ performed most of the experimental work and bioinformatics analysis; JSS developed the conceptual aspects of the work and edited the manuscript; AMA conceived the research, helped in the molecular and bioinformatics work and drafted the manuscript; all authors read and approved the final manuscript.

Additional file 1: Table S1

GenBank accession numbers of reference genes encoding Pyreae PAs biosynthesis enzymes used in this study. Click here for file

Additional file 2

Multiple sequence alignment analysis of the gene showing the position of the designed primers (underlined) used in this study. Click here for file

Additional file 3

Pairwise sequence alignment between the designed primers and the blast retrieved DNA sequences encoding PAs biosynthesis from , and spp. using the NCBI GenBank nucleotide (nr/nt) and est databases. Click here for file

Additional file 4

Estimated sizes of PCR amplicons of the PAs biosynthesis gene resulted from using different primers combinations and cDNA prepared from callus. Click here for file
  19 in total

1.  Hawthorn.

Authors:  Qi Chang; Zhong Zuo; Francisco Harrison; Moses Sing Sum Chow
Journal:  J Clin Pharmacol       Date:  2002-06       Impact factor: 3.126

2.  Light and an exogenous transcription factor qualitatively and quantitatively affect the biosynthetic pathway of condensed tannins in Lotus corniculatus leaves.

Authors:  Francesco Paolocci; Tessa Bovone; Nicola Tosti; Sergio Arcioni; Francesco Damiani
Journal:  J Exp Bot       Date:  2005-02-14       Impact factor: 6.992

3.  Development of simple sequence repeat markers specific for the Lr34 resistance region of wheat using sequence information from rice and Aegilops tauschii.

Authors:  Eligio Bossolini; Simon G Krattinger; Beat Keller
Journal:  Theor Appl Genet       Date:  2006-08-08       Impact factor: 5.699

4.  Proanthocyanidin synthesis and expression of genes encoding leucoanthocyanidin reductase and anthocyanidin reductase in developing grape berries and grapevine leaves.

Authors:  Jochen Bogs; Mark O Downey; John S Harvey; Anthony R Ashton; Gregory J Tanner; Simon P Robinson
Journal:  Plant Physiol       Date:  2005-09-16       Impact factor: 8.340

5.  Pigmented Soybean (Glycine max) Seed Coats Accumulate Proanthocyanidins during Development.

Authors:  J. J. Todd; L. O. Vodkin
Journal:  Plant Physiol       Date:  1993-06       Impact factor: 8.340

6.  Phenolic constituents and antioxidant capacities of Crataegus monogyna (Hawthorn) callus extracts.

Authors:  Theeshan Bahorun; Esha Aumjaud; Hemlata Ramphul; Maheshwaree Rycha; Amitabye Luximon-Ramma; Francis Trotin; Okezie I Aruoma
Journal:  Nahrung       Date:  2003-06

7.  Functional analysis of a predicted flavonol synthase gene family in Arabidopsis.

Authors:  Daniel K Owens; Anne B Alerding; Kevin C Crosby; Aloka B Bandara; James H Westwood; Brenda S J Winkel
Journal:  Plant Physiol       Date:  2008-05-08       Impact factor: 8.340

Review 8.  Evolution and current status of research in phenolic compounds.

Authors:  Alain-Michel Boudet
Journal:  Phytochemistry       Date:  2007-07-23       Impact factor: 4.072

Review 9.  Biosynthesis and genetic regulation of proanthocyanidins in plants.

Authors:  Fei He; Qiu-Hong Pan; Ying Shi; Chang-Qing Duan
Journal:  Molecules       Date:  2008-10-28       Impact factor: 4.411

10.  UniPrime2: a web service providing easier Universal Primer design.

Authors:  Robin Boutros; Nicola Stokes; Michaël Bekaert; Emma C Teeling
Journal:  Nucleic Acids Res       Date:  2009-04-28       Impact factor: 16.971

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.