Revelation of the ability of Burkholderia sp. USM (JCM 15050) PHA synthase to polymerize 4-hydroxybutyrate monomer.

The nutrition-versatility of Burkholderia sp. strain USM (JCM 15050) has initiated the studies on the use of this bacterium for polyhydroxyalkanoate (PHA) production. To date, the Burkholderia sp. has been reported to synthesize 3-hydroxybutyrate, 3-hydroxyvalerate and 3-hydroxy-4-methylvalerate monomers. In this study, the PHA biosynthetic genes of this strain were successfully cloned and characterized. The PHA biosynthetic cluster of this strain consisted of a PHA synthase (phaC), β-ketothiolase (phaA), acetoacetyl-CoA reductase (phaB) and PHA synthesis regulator (phaR). The translated products of these genes revealed identities to corresponding proteins of Burkholderia vietnamiensis (99-100 %) and Cupriavidus necator H16 (63-89%). Heterologous expression of phaCBs conferred PHA synthesis to the PHA-negative Cupriavidus necator PHB¯4, confirming that phaCBs encoded functionally active protein. PHA synthase activity measurements revealed that the crude extracts of C. necator PHB¯4 transformant showed higher synthase activity (243 U/g) compared to that of wild-types Burkholderia sp. (151 U/g) and C. necator H16 (180 U/g). Interestingly, the transformant C. necator PHB¯4 harbouring Burkholderia sp. PHA synthase gene accumulated poly(3-hydroxybutyrate-co-4-hydroxybutyrate) with 4-hydroxybutyrate monomer as high as up to 87 mol% from sodium 4-hydroxybutyrate. The wild type Burkholderia sp. did not have the ability to produce this copolymer.

Introduction

Since the introduction of phenoformaldehyde plastic in 1909 by Leo Hendrik Baekeland, petrochemical plastics have developed into a major industry and an indispensable commodity for modern life (Meikle, [1995]). It is estimated that more than 100 million tonnes of plastics are produced yearly. Most of these plastics end up after their useful life as discarded waste and some are disposed into the marine environment which pose a threat to the aquatic wildlife. In recent years, the widespread and increasing use of petrochemical plastics has raised concerns about the adverse impact of these recalcitrant plastics on the environment. Hence, biobased and biodegradable polymers are gaining widespread interest and acceptance as an alternative to some synthetic plastics. Polyhydroxyalkanoate (PHA), a storage and reserve compound accumulated naturally in the cytoplasm of numerous bacteria, is being considered as one of the most attractive and promising biodegradable thermoplastics for various industrial and biomedical applications (Sudesh and Iwata, [2008]).

Poly(3-hydroxybutyrate) [P(3HB)], the most common type of PHA, has mechanical properties such as Young’s modulus and tensile strength similar to polypropylene. Nevertheless, P(3HB) is a stiffer and more brittle plastic material compared to polypropylene (Tsuge, [2002]). Many other types of PHA with improved mechanical properties are synthesized by incorporating co-monomers such as 3-hydroxyvalerate, 3-hydroxyhexanoate and 4-hydroxybutyrate. The underlying challenge for the commercialization of PHA is the higher production cost compared to petrochemical plastics. To achieve the commercial application and wide use of PHA, efforts are directed on effectively lowering the production cost of PHA. Much research has been focused on reducing the production cost by strain development, developing more efficient fermentation and recovery processes and using inexpensive carbon sources. At the same time, more PHA applications are being developed, including the high value applications such as medical and pharmaceutical field at which cost of production is not the main concern (Chen, [2009]).

Structural analyses in recent years revealed that different types of granule-associated proteins are located on the surface of PHA granules. The proteins include PHA synthases, intracellular PHA depolymerases, phasins, PHA synthesis regulator proteins and etc. (Pötter and Steinbüchel, [2006]; Rehm, [2006]; Jendrossek, [2009]). PHA synthases are the most important enzymes involved in PHA biosynthesis. They can be grouped into four classes based on their in vivo substrate specificities, primary amino acid sequences and subunit composition (Rehm, [2007]). Class І synthases, which are represented by the PHA synthase from Cupriavidus necator, are active towards short-chain length (R)-hydroxyacyl-CoA consisting of three to five carbon atoms (Pötter and Steinbüchel, [2006]). Class ІІ synthases are active towards medium-chain length (R)-3-hydroxyacyl-CoA that contain six to fourteen carbon atoms and are represented by Pseudomonas aeruginosa. Class І and ІІ PHA synthases comprise enzymes consisting of only one type of subunit (PhaC) with molecular masses (Mw) between 61 and 68 kDa. Class ІІІ PHA synthases, represented by the Allochromatium vinosum PHA synthases, comprise two subunits: PhaC and PhaE. Class IV PHA synthases, represented by the enzyme of Bacillus megaterium, consist of two different types of subunits (PhaC and PhaR). Both class ІІІ and IV PHA synthases prefer short-chain length (R)-hydroxyacyl-CoA. (Rehm, [2003]).

Burkholderia sp. USM (JCM 15050) was isolated from oil-polluted wastewater and has been known to utilize various carbon sources e.g. sugars, organic acids and triglycerides for PHA production (Chee et al. [2010]; Lau et al. [2010]). The focus of this research was the PHA biosynthetic genes cloned from this bacterium. Here, we reported for the first time that the heterologous expression of Burkholderia sp. PHA synthase in C. necator PHB¯4 lead to the accumulation of poly(3-hydroxybutyrate-co-4-hydroxybutyrate), P(3HB-co-4HB) with high 4-hydroxybutyrate (4HB) composition. Although the accumulation of PHA containing 4HB monomer was not observed in wild-type Burkholderia sp. culture, the PHA synthase of Burkholderia sp. was able to polymerize the 4HB monomer.

Materials and methods

Bacterial strains, plasmids and media

All bacterial strains and plasmids used in this study are listed in Table 1. C. necator PHB¯4 was cultivated in nutrient rich (NR) medium containing meat extract (10 g/L), peptone (10 g/L) and yeast extract (2 g/L) at 30°C. Escherichia coli strains were grown at 37°C in Lysogeny Broth (LB) medium consisting of the following components (per L): 10 g casein enzyme hydrolysate, 5 g yeast extract and 10 g NaCl. For maintenance of plasmid, kanamycin (50 μg/mL) or ampicilin (100 μg/mL) were added.

Table 1

Bacterial strains and plasmids used in this study

Strain or plasmid	Relevant characteristics	Source or reference
Strains
E. coli JM109	recA1, endA1, gyrA96, thi, hsdR17, supE44, relA1, Δ(lac-proAB)/F'[traD36, proAB+, lacIq, lacZΔM15]	Promega
E. coli S17−1	relA1, ΔlacU169, (ϕ80lacZΔM15), thi1, proA, hsdR17, hsdM+, recA, RP4-tra function	Simon et al., [1983]
C. necator PHB¯4	PHA-negative mutant of wild-type H16	Schlegel et al., [1970]
Burkholderia sp. USM (JCM 15050)	Wild type	Chee et al., [2010]
Plasmids
pGEM-T	Apr, lacZ, cloning vector	Promega
pBBR1MCS-2	Kmr, lacPOZ' mob+, broad host range	Kovach et al., [1995]
pBBR1MCS-2 phaCBsBH	pBBR1MCS-2 derivative harbouring BamHI-HindIII phaC from Burkholderia sp. with putative promoter	This study
pBBR1MCS-2 phaCBsBE	pBBR1MCS-2 derivative harbouring BamHI-EcoRI phaC from Burkholderia sp. with putative promoter	This study

Culture conditions for the synthesis of PHA

To determine the functional expression of the cloned PHA biosynthetic genes in vivo, PHA biosynthesis was carried out with transformant C. necator. Both one-stage cultivation and two-stage cultivation were carried out according to the method described previously (Lau et al., [2010]; Lau et al., [2011]). For inoculum preparation, transformant C. necator was grown in 50 mL of NR at 30°C, 200 rpm. 3% (v/v) of the total volume of the seed culture (OD600 nm = 4.5) were inoculated into nitrogen-limiting mineral salts medium (MM). The MM contained (per liter): 3.32 g Na2HPO4, 2.80 g KH2PO4, 0.50 g NH4Cl, 0.25 g MgSO4·7H2O and 1 mL trace elements solution (Doi et al., [1995]). The trace element solution consisted of 0.22 g CoCl2·6H2O, 9.7 g FeCl3, 7.8 g CaCl2, 0.12 g NiCl2·6H2O, 0.11 g CrCl3·6H2O, 0.16 g CuSO4·5H2O in one liter 0.1 N HCl (Kahar et al., [2004]). Different carbon sources (crude palm kernel oil, jatropha oil, fructose, 4-methylvaleric acid, sodium propionate, sodium valerate, γ-butyrolactone and sodium 4-hydroxybutyrate) were tested for their ability to promote PHA synthesis in transformant C. necator. The cultures were harvested by centrifugation (6000 g, 7 min and 4°C) after 48 h of incubation at 200 rpm, 30°C. Cell pellets were washed with hexane to get rid of excess oil-based carbon sources before being washed with distilled water. Cells grown in non-palm oil based carbon sources were washed only with distilled water.

For two-stage cultivation, 3% (v/v) of the inoculum from transformant C. necator culture was transferred into fresh NR broth which was then incubated for additional 24 h. The culture was centrifuged aseptically (6000 g, 7 min and 4°C) and washed with sterile distilled water before being transferred into nitrogen-free MM. The cultures were incubated at 30°C, 200 rpm for 48 h before being harvested.

Analytical procedures

The PHA content and composition were analyzed by gas chromatography (GC) spectrometry. Approximately 25 mg of lyophilized cells were subjected to methanolysis in the presence of 15%(v/v) sulphuric acid in methanol. The resulting hydroxyacyl methyl esters were assayed according to the method of Braunegg and co-workers. (Braunegg et al., [1978]).

DNA manipulation

The isolation of genomic DNA from Burkholderia sp., plasmids DNA isolation, agarose gel electrophoresis and transformation of E. coli were performed following standard procedures (Sambrook et al., [1989]). Restriction endonucleases, all other DNA-manipulating enzymes and kits were used as recommended by the manufacturers (Promega, USA).

Cloning of PHA biosynthetic genes from Burkholderia sp

The putative PHA synthase (phaC), β-ketothiolase (phaA), acetoacetyl-CoA redutase (phaB) and PHA synthesis regulator (phaR) genes were amplified form the chromosomal DNA of Burkholderia sp. using primer pairs І, ІІ and ІІІ respectively (Table 2). The resulting polymerase chain reaction (PCR) products were cloned into pGEM-T vector (Promega, USA) and sent for sequencing at 1st BASE Laboratory (Malaysia). Sequence comparisons and alignments were performed with the Basic Local Alignment Search tool (BLAST, National Center for Biotechnology Information) and ClustalW Multiple Sequence Alignment program (Thompson et al., [1994]). The potential promoter regions recognized by Sigma factor D (σD) were predicted using prediction of bacterial promoters (BPROM) provided by Softberry Inc. (http://www.softberry.com).

Table 2

List of primers used in this study

Primer pairs	Primers’ sequences	Target gene
І	F: GCGAGTCACCGAAAATGTTTTATGTT	Burkholderia sp. phaC gene
	R: TGCGGCCCCTTCAGGTAGTTGTC
ІІ	F: AAGAAGAAGCGCAGCTACTGGGTC	Burkholderia sp. phaA gene
	R: TTGAACAGGCTCGTCAGATTGGTG
ІІІ	F: GGCCAGACCAACTATTCGACCGC	Burkholderia sp. phaB and phaR genes
	R: GCGACGGCCTTACTTCTTTTCCG
IV	F: GCGAGGATCCGAAAATGTTTTATGTT	Burkholderia sp. phaC gene
	R: ATGAGCTCACTACGTCCGTCATTTCC
V	F: GCGAGGATCCGAAAATGTTTTATGTT	Burkholderia sp. phaC gene
	R: ATGAATTCACTACGTCCGTCATTTCC

a All primers were synthesized by 1st BASE Laboratory (Malaysia). Restriction enzymes digestion sites were underlined.

Construction of plasmids

To construct a plasmid for expression of phaC in C. necator PHB¯4, PCR was performed with primer pairs IV to obtain the gene fragment containing the putative coding region, ribosome binding site and promoter. This PCR product was digested with BamHІ and SacІ and inserted in frame into BamHІ- and SacІ- restricted pBBR1MCS-2. The phaC was also cloned in reverse orientation to lac promoter in pBBR1MCS-2 to confirm the expression under its native promoter. The plasmid for expression was constructed by ligation of phaC amplified with primer pairs V into pBBR1MCS-2 at BamHІ and EcoRІ sites. Conjugation of C. necator PHB¯4 with E. coli S17–1 harbouring broad-host-range plasmids were performed as described by Friedrich et al., [1981].

PHA synthase activity assay

Wild-type Burkholderia sp. and transformant C. necator harbouring pBBR1MCS-2 phaCBH were cultivated for 24 h under conditions as described in the materials and methods section. Cells were harvested and resuspended in 20 mM Tris-HCl (pH 8). Cell extracts were obtained by disruption using sonication (two cycles, 7 min each) with a TOMY UD-200 sonicator and centrifugation at 13700 x g for 10 min at 4°C. Activities of PHA synthase were determined spectrophotometrically by monitoring the release of CoA at 412 nm (30°C). The standard assay contained 40 mM potassium phosphate buffer (pH 7.5), 2 mM 3HB-CoA, 10 mM 5,5’-dithio-bis(2-nitrobenzoic acid) and 35 to 40 μg of protein from soluble protein fraction (Bhubalan et al. [2011]). One unit of enzyme activity was defined as the amount of enzyme that catalyzed the release of 1.0 μmol CoA/min using a molar absorption coefficient of 13,600 M−1 cm−1. The protein concentration was assayed as described by Bradford using bovine serum albumin as standard.

Results

Identification and cloning of PHA biosynthetic genes from Burkholderia sp. USM (JCM 15050)

In order to determine the nucleotide sequence of PHA locus of Burkholderia sp. USM (JCM15050), primers for amplification were designed based on the annotated phaC, phaA, phaB and phaR obtained from genomic DNA sequencing of Burkholderia vietnamiensis, Burkholderia thailandensis, Burkholderia ambifaria, Burkholderia glumae, Burkholderia mallei, Burkholderia multivorans and Burkholderia cenocepacia. The nucleotide sequence obtained were deposited with GenBank (accession no. JN022533, JN835296-JN835297, JQ936592). The deduced amino acid sequence of phaC exhibited great similarity to PhaC of B. vietnamiensis (99% identity, accession no. YP_001119557.1), Pseudomonas putida (73% identity, accession no. BAB96552.1) and Cupriavidus necator (63% identity, accession no. YP_725940.1). The putative Shine-Dalgarno consensus sequences (TAAGG) were found 10 base pairs upstream of the putative start codon for phaC. The putative −35 region (TTCACA) and −10 region (TGATAAAAA) found were similar to the corresponding sequences of E. coli σ70 consensus promoter sequence. The product of phaC is a protein composed of 625 amino acids with a calculated molecular mass of 68.25 kDa. Although the nucleotide sequence of phaC from B. vietnamiensis was available following complete genomic DNA sequencing, functional characterization of the gene has not been reported. Comparison of the deduced amino acids sequence of phaC from Burkholderia sp. with homologous phaC genes from other bacteria was done by multiple alignment (Figure 1). The deduced amino acids sequence of phaC showed relatively high identity to other PHA synthase and the putative lipase box that has been found conserved in all the PHA synthase was also identified. The deduced amino acid sequences of putative phaA were similar to those β-ketothiolase from B. vietnamiensis (99% identity, accession no. YP_001119556.1), P. putida (90% identity, accession no. BAB96553.1) and C. necator (87% identity, accession no. YP_725941.1). The putative phaB exhibited significant identity to acetoacetyl-CoA redutase from B. vietnamiensis (99% identity, accession no. YP_001119555.1), P. putida (92% identity, accession no. BAB96554.1) and C. necator (89% identity, accession no. YP_725942.1). A putative PHA synthesis regulator is encoded by phaR and it is located downstream of phaB. The deduced amino acid sequence of phaR exhibited high identity to B. vietnamiensis (100% identity, accession no. YP_001119554.1) and C. necator (83% identity, accession no. YP_725943.1). As Burkholderia sp. 16 S rDNA gene (accession no. FJ667272.1) exhibited 92% identity to the corresponding gene of C. necator (accession no. CP000090.1), it is not surprising to find that the translated products of Burkholderia sp. PHA biosynthetic genes revealed identities to corresponding proteins of C. necator (63–89%).

Figure 1

Multiple alignment of the partial deduced amino sequences of of sp. USM (JCM 15050) with corresponding phaC sequence from Burkholderia vietnaminesis G4 (Genbank accession no. YP_001119557.1), Burkholderia sp. DSMZ9242 (GenBank accession no. AAF23364.1), Cupriavidus necator H16 (GenBank accession no. YP725940.1), Chromobacterium sp. USM2 (Genbank accession no. ADL70203.1) and Delftia acidovorans (Genbank accession no. BAA33155.1).

PHA accumulation in transformant C. necator PHB¯4

The functionality of the cloned Burkholderia sp. USM (JCM 15050) PHA synthase gene was investigated by heterologous expression of the gene in the PHA-negative C. necator host. Plasmid pBBR1MCS-2 phaCBH containing phaC and its putative promoter collinear to and downstream of the lac promoter was constructed. The expression was confirmed by complementation of the mutant host deficiency in PHA synthesis and the PHA-producing ability of the transformant strains were examined (Table 3). Interestingly, the heterologous expression of phaC in C. necator PHB¯4 has conferred the ability to synthesize P(3HB-co-4HB) copolymer with high 4HB composition in the mutant host strain. The 4HB composition reached 87 mol% in cultures supplemented with sodium 4-hydroxybutyrate in two-stage cultivation. In contrast, wild type Burkholderia sp. has limited ability to utilize 4HB-related carbon sources for growth and PHA production (results not shown). The highest PHA content of 66 wt% accompanied by relatively high dry cell weight of 2.4 g/L were obtained in transformant C. necator harbouring phaC cultivated on crude palm kernel oil (CPKO) in one-stage cultivation. Although a low fraction of 3-hydroxy-4-methylvalerate (3H4MV) monomer was synthesized by the transformant strain culture from 4-methylvaleric acid, it is in agreement with previous studies on the ability of Burkholderia sp. PhaC to polymerize 3H4MV monomer (Lau et al., [2010]). 3-hydroxyvalerate (3HV) monomer was also incorporated into the polymer in the presence of precursor carbon sources e.g. sodium valerate and sodium propionate. To examine whether the expression of phaC was affected by the lac promoter, pBBR1MCS-2 phaCBE was constructed by inserting phaC in reverse orientation to lac promoter. Transformant C. necator PHB¯4 harbouring pBBR1MCS-2 phaCBE showed similar cell growth and PHA accumulation to strain harbouring pBBR1MCS-2 phaCBH. These results suggest that the Burkholderia sp. PHA synthase gene was constitutively expressed in C. necator PHB¯4 from the native promoter.

Table 3

Effect of different carbon sources on the biosynthesis of PHA by transformant PHB¯4 harboring the PHA synthase gene of sp.

Carbon sourcesa	Dry Cell Weightb(g/L)	PHA contentc(wt %)	PHA compositiond(mol %)
			3HB	3HV	3H4MV	4HB
One-stage cultivation
pBBR1MCS-2 phaC  Bs BE
CPKO	2.1 ± 0.4	64 ± 9	100	0	0	0
pBBR1MCS-2 phaC  Bs BH
CPKO	2.4 ± 0.1	66 ± 2	100	0	0	0
Jatropha oil	2.3 ± 0.1	53 ± 1	100	0	0	0
Fructose	2.5 ± 0.1	61 ± 1	100	0	0	0
Fructose+ 4MV	1.6 ± 0.2	40 ± 8	97	0	3	0
Two-stage cultivation
Sodium propionate	2.7 ± 0.1	27 ± 3	70	30	0	0
Sodium valerate	3.2 ± 0.1	35 ± 1	60	40	0	0
γ-butyrolactone	2.3 ± 0.1	29 ± 1	69	0	0	31
sodium 4-hydroxybutyrate	2.0 ± 0.1	14 ± 2	13	0	0	87

CPKO, crude palm kernel oil; 4MV, 4-methylvaleric acid; 3HB, 3-hydroxybutyrate; 3HV, 3-hydroxyvalerate 3H4MV, 3-hydroxy-4-methylvalerate; 4HB, 4-hydroxybutyrate.

aCells were cultivated for 48 h, at 30 °C, 200 rpm in MM medium containing the indicated carbon sources (0.2 M carbon concentration: CPKO, jatropha oil, fructose, sodium propionate, sodium valerate, γ-butyrolactone, sodium 4-hydroxybutyrate and 0.02 M carbon concentration: 4-methylvaleric acid).

bDry cell weight after freeze-drying.

dPHA composition of the freeze-dried cells was determined by gas chromatography.

The ability of transformant C. necator PHB¯4 harbouring Burkholderia sp. PHA synthase gene to incorporate 4HB monomer into the PHA produced was investigated. To study the effect of 4HB-related carbon sources efficiency and concentration on 4HB composition of PHA synthesized, shake-flask cultures of transformant C. necator were cultivated on medium with different concentrations of γ-butyrolactone or sodium 4-hydroxybutyrate in two-stage cultivation. The dry cell weight, PHA content and 4HB composition showed slight increase with the increase of sodium 4-hydroxybutyrate concentration from 0.1 to 0.2 M carbon concentration for transformant C. necator cultures (Table 4). A maximum of 87 mol% 4HB composition was produced by the transformant strain cultivated on medium supplemented with 0.2 M carbon concentration sodium 4-hydroxybutyrate. The increase of sodium 4-hydroxybutyrate concentration from 0.2 to 0.4 M carbon concentration resulted in the decrease of 4HB composition. On the other hand, increased mol fractions of 4HB monomers in PHA produced were achieved by increasing γ-butyrolactone concentrations.

Table 4

Effect of different 4HB-related carbon sources concentrations on the biosynthesis of PHA by transformant PHB¯4 harboring the PHA synthase gene of sp.

Carbon sourcesa	Carbon concentration (M)	Dry Cell Weightb(g/L)	PHA contentc(wt %)	PHA compositiond(mol %)
				3HB	4HB
γ-butyrolactone	0.1	1.9 ± 0.1	10 ± 1	78	22
γ-butyrolactone	0.2	2.3 ± 0.1	29 ± 1	69	31
γ-butyrolactone	0.3	2.4 ± 0.2	31 ± 3	68	32
γ-butyrolactone	0.4	2.2 ± 0.1	24 ± 1	59	41
sodium 4-hydroxybutyrate	0.1	1.5 ± 0.1	Trace	28	72
sodium 4-hydroxybutyrate	0.2	2.0 ± 0.1	14 ± 2	13	87
sodium 4-hydroxybutyrate	0.3	1.9 ± 0.1	8 ± 1	40	60
sodium 4-hydroxybutyrate	0.4	2.0 ± 0.1	11 ± 2	46	54

3HB, 3-hydroxybutyrate; 4HB, 4-hydroxybutyrate.

aCells were cultivated for 48 h, at 30 °C, 200 rpm in MM medium containing different concentrations of 4HB-related carbon sources at two-stage cultivation.

bDry cell weight after freeze-drying.

cPHA content of the freeze-dried cells was determined by gas chromatography.

dPHA composition of the freeze-dried cells was determined by gas chromatography.

Assay of PHA synthase activity

In order to determine and compare the expression of Burkholderia sp. PHA synthase gene in C. necator PHB¯4 and its native host, crude extracts of transformant C. necator and wild-type Burkholderia sp. were subjected to PHA synthase assay (Table 5). The crude lysate from Burkholderia sp. exhibited specific activity of 151 U/mg, which was similar and comparable with that from C. necator H16 results published previously (180 U/mg) (Schubert et al., [1988]). C. necator PHB¯4 harbouring Burkholderia sp. PHA synthase exerted slightly enhanced in vivo PHA synthase activity compared to wild-type Burkholderia sp.

Table 5

Analysis of PHA synthase activity in wild-type sp. and transformant . 

Strain	PHA synthase sp act (U/g of protein)a	References
Burkholderia sp. USM (JCM 15050)	151	This study
C. necator PHB¯4 (pBBR1MCS-2 phaCBsBH)	243	This study
C. necator H16	180	Schubert et al., [1988]

a One unit of enzyme activity was defined as the amount of enzyme that catalyzed the release of 1.0 μmol CoA/min.

Discussions

Bacteria belonging to the genus Burkholderia was first used in 1989 for the production of P(3HB) homopolymer from fructose (Ramsay et al., [1989]). They are one of the most nutritionally versatile microorganisms that are capable of utilizing a wide range of carbon sources. In this study, the PHA biosynthetic genes from a locally isolated Burkholderia sp. strain USM (JCM 15050) were successfully amplified. The PHA biosynthetic genes of Burkholderia sp. consisted of a PHA synthase (phaC), β-ketothiolase (phaA), acetoacetyl-CoA reductase (phaB) and PHA synthesis regulator (phaR). The phaCphaA and phaB seems to be organized in an operon and the structural organization of these genes is closely related to other bacteria harbouring type I PHA synthase e.g. C. necator and Alcaligenes latus (Choi et al., [1998]; Rehm and Steinbüchel, [2002]) (Figure 2). Although the PHA synthase and other PHA biosynthetic genes are often found clustered in the bacterial genomes, there are some exceptions to these observations. In the genomes of Caulobacter crescentusParacoccus denitrificansMethylobacterium extorquens and Aeromonas caviae, the genes related to PHA biosynthesis are not directly linked to the PHA synthase (Rehm and Steinbüchel, [2002]). Some bacteria e.g. P. denitrificans contains other genes related to PHA synthesis (phasin, phaP and phaR) map close to the PHA locus. Both C. necator and Burkholderia sp. PHA locus also possess a putative phaR immediately downstream of phaB. The phaR encodes a protein with putative regulatory function in PHA metabolism (York et al. [2002]; Stubbe and Tian, [2003]; Pötter and Steinbüchel, [2006]).

Figure 2

Molecular organizations of PHA biosynthetic genes in sp. USM (JCM 15050) and other bacteria containing type I PHA synthase (Choi et al., [1998]; Kolibachuk et al., [1999]; Rehm & Steinbüchel, [2002]; Sudesh et al., [1998]).

The putative translated product of Burkholderia sp. PHA biosynthetic genes exhibited high homologies to the respective B. vietnamiensis and C. necator genes. As the most important enzyme involved in PHA biosynthesis, PHA synthase of Burkholderia sp. belongs to Class І that is active on short chain-length (R)-hydroxyacyl-CoA with three to five carbon atoms (Rehm and Steinbüchel, [2002]; Rehm, [2007]). Site-specific mutagenesis analysis of C. necator PHA synthase had shown that the conserved cystein-319, aspartate-480 and histidine-508 of the class I synthase are required for enzyme activity. These amino acid residues are conserved in all class I synthases and it was suggested that they are involved in covalent catalysis. In addition, another conserved residue, tryptophan-398 was suggested to function in PHA synthase subunit dimerization by the provision of a hydrophobic surface (Gerngross et al., [1994]; Jia et al., [2001]). In recent years, PHA synthases with improved substrate specificity, enzyme activity and stability were engineered by various approaches e.g. random mutagenesis, gene shuffling and recombination (Nomura and Taguchi [2007]). The introduction of a mutant PHA synthase (Ser325Thr/Gln481Lys) from Pseudomonas sp. 61-3 and lactate (LA) monomer supplying enzymes into E. coli had enabled the production of LA-based polyesters in a biological system (Shozui et al., [2010]). The same mutant Pseudomonas sp. PHA synthase was expressed in E. coli for the synthesis of glycolate-based polyesters containing medium-chain-length 3-hydroxyalkanoates (Matsumoto et al., [2011]).

The types and compositions of PHA that are produced by the biological system depend on the PHA synthase substrate specificity, the carbon sources supplied and the metabolic pathways that are functioning in the cell (Sudesh and Doi, [2005]). PHA-negative mutant PHB¯4 of C. necator is a desirable host for PHA production due to the strain ability to achieve stable high cell density fermentation and produce high PHA content from simple, inexpensive substrates (Taguchi et al., [2003]). Heterologous expression of Burkholderia sp. PHA synthase gene in PHA-negative mutant of C. necator enabled the synthesis of P(3HB-co-4HB) containing 87 mol% of the 4HB fraction. In contrast, wild-type Burkholderia sp. had reduced ability in utilizing 4HB-related carbon sources for growth and PHA production. It is for the first time that the Burkholderia sp. PHA synthase was shown to polymerize 4HB monomer. It is well documented that C. necator was equipped with the metabolic pathway to supply 4HB-CoA substrate even though only small amount of P(4HB) was accumulated (Nakamura et al., [1992]). The expression of Burkholderia sp. PHA synthase in a host that are capable of providing 4-hydroxybutyryl-CoA as substrate for the PHA synthase allowed the polymerization of 4HB monomer. These results support previous findings which suggested that the monomer supplying pathways operating in the cells are an important factor determining the provision of substrate for the polymerization by the PHA synthase (Sudesh et al., [1998]). In addition, the synthesis of P(3HB-co-4HB) with high 4HB composition by transformant C. necator suggested the preference of Burkholderia sp. PHA synthase for 4-hydroxybutyryl-CoA.

In this study, the PHA biosynthetic gene cluster Burkholderia sp. USM (JCM 15050) which consisted of a phaC, phaA, phaB and phaR were successfully cloned. The heterologous expression of Burkholderia sp. PHA synthase gene in C. necator PHB¯4 showed that the PHA synthase was capable of polymerizing 4HB monomer. The biosynthesis results also suggested Burkholderia sp. PHA synthase preference for 4HB-CoA as PHA with high 4HB composition (87 mol%) was synthesized by transformant C. necator harbouring the synthase. PHA synthase activity assay of wild-type Burkholderia sp. and transformant C. necator indicated that these two strains exhibited activities that are comparable and in a similar range with C. necator H16. More efforts to analyze the substrate specificity of PHA synthase in various hosts need to be done in order to understand fully the potential of the synthase.

Competing interests

The authors declare that they have no competing interests.